ID: 1186697411

View in Genome Browser
Species Human (GRCh38)
Location X:12051749-12051771
Sequence TTGAATAAACAGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186697411_1186697420 15 Left 1186697411 X:12051749-12051771 CCTCCATCCATCTGTTTATTCAA No data
Right 1186697420 X:12051787-12051809 TATTGTGTCAATCATTGGGGTGG No data
1186697411_1186697416 10 Left 1186697411 X:12051749-12051771 CCTCCATCCATCTGTTTATTCAA No data
Right 1186697416 X:12051782-12051804 CCCAATATTGTGTCAATCATTGG No data
1186697411_1186697419 12 Left 1186697411 X:12051749-12051771 CCTCCATCCATCTGTTTATTCAA No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697411_1186697418 11 Left 1186697411 X:12051749-12051771 CCTCCATCCATCTGTTTATTCAA No data
Right 1186697418 X:12051783-12051805 CCAATATTGTGTCAATCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186697411 Original CRISPR TTGAATAAACAGATGGATGG AGG (reversed) Intergenic
No off target data available for this crispr