ID: 1186697419

View in Genome Browser
Species Human (GRCh38)
Location X:12051784-12051806
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186697409_1186697419 20 Left 1186697409 X:12051741-12051763 CCATTCACCCTCCATCCATCTGT No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697411_1186697419 12 Left 1186697411 X:12051749-12051771 CCTCCATCCATCTGTTTATTCAA No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697410_1186697419 13 Left 1186697410 X:12051748-12051770 CCCTCCATCCATCTGTTTATTCA No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697412_1186697419 9 Left 1186697412 X:12051752-12051774 CCATCCATCTGTTTATTCAACCA No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697413_1186697419 5 Left 1186697413 X:12051756-12051778 CCATCTGTTTATTCAACCAATAA No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data
1186697408_1186697419 24 Left 1186697408 X:12051737-12051759 CCATCCATTCACCCTCCATCCAT No data
Right 1186697419 X:12051784-12051806 CAATATTGTGTCAATCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186697419 Original CRISPR CAATATTGTGTCAATCATTG GGG Intergenic
No off target data available for this crispr