ID: 1186699003

View in Genome Browser
Species Human (GRCh38)
Location X:12069390-12069412
Sequence TAGACTATAGGCAGCAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186698998_1186699003 -2 Left 1186698998 X:12069369-12069391 CCCGGTTTGCTACATGGAAATTA No data
Right 1186699003 X:12069390-12069412 TAGACTATAGGCAGCAAGGGTGG No data
1186698999_1186699003 -3 Left 1186698999 X:12069370-12069392 CCGGTTTGCTACATGGAAATTAG No data
Right 1186699003 X:12069390-12069412 TAGACTATAGGCAGCAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186699003 Original CRISPR TAGACTATAGGCAGCAAGGG TGG Intergenic
No off target data available for this crispr