ID: 1186699508

View in Genome Browser
Species Human (GRCh38)
Location X:12074898-12074920
Sequence CAGTATTTGTAAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186699504_1186699508 16 Left 1186699504 X:12074859-12074881 CCCAAATGCTTTAAATTATGGTC No data
Right 1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG No data
1186699505_1186699508 15 Left 1186699505 X:12074860-12074882 CCAAATGCTTTAAATTATGGTCT No data
Right 1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186699508 Original CRISPR CAGTATTTGTAAAGGGAAGA AGG Intergenic
No off target data available for this crispr