ID: 1186706554

View in Genome Browser
Species Human (GRCh38)
Location X:12145980-12146002
Sequence CTCAAAAGTATGTAGACGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186706554_1186706561 12 Left 1186706554 X:12145980-12146002 CCCTCCGTCTACATACTTTTGAG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1186706561 X:12146015-12146037 ATTCTTTATCCTTACCCTTTTGG 0: 1
1: 0
2: 47
3: 355
4: 793
1186706554_1186706563 18 Left 1186706554 X:12145980-12146002 CCCTCCGTCTACATACTTTTGAG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1186706563 X:12146021-12146043 TATCCTTACCCTTTTGGGTTTGG 0: 1
1: 0
2: 2
3: 10
4: 157
1186706554_1186706562 13 Left 1186706554 X:12145980-12146002 CCCTCCGTCTACATACTTTTGAG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1186706562 X:12146016-12146038 TTCTTTATCCTTACCCTTTTGGG 0: 1
1: 0
2: 4
3: 65
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186706554 Original CRISPR CTCAAAAGTATGTAGACGGA GGG (reversed) Intronic
908174649 1:61542740-61542762 CTCAAAAGAATGTATACAAATGG - Intergenic
909587454 1:77306252-77306274 CTCAAAAAAATGGAGACAGAAGG - Intronic
910814205 1:91272518-91272540 CACAAAAGTAAGCAGAGGGAAGG + Intronic
913201999 1:116502479-116502501 CTAAAAAGAATGCAGAGGGAGGG - Intergenic
920657644 1:207888305-207888327 CTCAAAAGGAGGTATACGGAAGG - Intronic
921039354 1:211415458-211415480 CTCAAAAGAAGGTACACAGATGG + Intergenic
922995504 1:229955421-229955443 CTCAAAAGAATATATACGAATGG - Intergenic
1064065434 10:12177221-12177243 CTCAAAAGGCTGGAGACGGCAGG + Intronic
1065263439 10:23950689-23950711 CTCAAAACTATGAAAAGGGATGG + Intronic
1065268636 10:24003443-24003465 CTCAAAAGAAGGTAGACAAATGG - Intronic
1066069220 10:31788897-31788919 GTCAAAAGTATGTTGAAGGAGGG - Intergenic
1067516022 10:46945242-46945264 ATCAAAAGGATGCATACGGAGGG + Intronic
1067646226 10:48106568-48106590 ATCAAAAGGATGCATACGGAAGG - Intergenic
1067931056 10:50562838-50562860 CTAAAGAGTATGGAGACGGCCGG - Intronic
1068341767 10:55713505-55713527 CTCAAAAGTAGGTGAACAGAAGG - Intergenic
1068585984 10:58799193-58799215 ATCAACAGTATGCAGACCGAAGG + Exonic
1069237069 10:66089426-66089448 AACAAAAGTATATAGAAGGAAGG - Intronic
1070051491 10:72894491-72894513 CTCAAAAGTGTCAAGAAGGATGG - Intronic
1071054320 10:81491560-81491582 CTCAAAAGAATGTATACAAATGG - Intergenic
1078197045 11:9144829-9144851 CTTGAAAGTAAGTAGAAGGAGGG - Intronic
1079882107 11:25941333-25941355 CTCAAATGTATGTAAGCAGAAGG - Intergenic
1081253750 11:40867685-40867707 ATCATAAGTATATTGACGGAAGG - Intronic
1083361348 11:62110915-62110937 CTAAAAAATGTGCAGACGGAAGG - Intergenic
1085471084 11:76758578-76758600 CTCAAGTGTTTGTAGATGGAGGG + Intergenic
1085726882 11:78962114-78962136 CTCAAAAGTAGGAAGAGAGAGGG + Intronic
1092048707 12:5452526-5452548 TTCAAATGTATGTAAAAGGATGG - Intronic
1093311230 12:17588243-17588265 TGCAAAAGTATGTAGACAGTGGG - Intergenic
1093473758 12:19532779-19532801 CACAAAAGTATGTGGGCAGAGGG + Intronic
1096762847 12:53857184-53857206 CTCAAAAGTATGTATGAGGCTGG - Intergenic
1097152808 12:56991922-56991944 GTCAAAAGCATGTAGTGGGAAGG + Intergenic
1097218715 12:57434242-57434264 CTCAAAACTATGAAGTCTGAAGG - Intergenic
1101822124 12:108192242-108192264 CTAAAAAGTATGTTGCTGGAAGG - Intronic
1105791650 13:23806375-23806397 CCAAAATATATGTAGACGGAAGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1109031437 13:57194810-57194832 CTCAAAAGAATGTAGACAAATGG - Intergenic
1115150753 14:30282379-30282401 CTTAAAAATATGTAGAAGGCCGG - Intergenic
1127358911 15:58227846-58227868 CACAAAAATATGGAGACGGGAGG + Intronic
1131613856 15:93992609-93992631 CTCAAAAGAAGGTAGACAAATGG - Intergenic
1133783353 16:8956253-8956275 CTAAAAACTATTTAGAAGGAAGG - Intronic
1133980328 16:10628525-10628547 CTCAAATGTCTGTGGATGGATGG + Intronic
1137325356 16:47429707-47429729 CTCCAGAGAATGTATACGGATGG - Intronic
1140888457 16:79264828-79264850 CTCAAAAGTATGACGAAGGCAGG - Intergenic
1143528996 17:7490183-7490205 CTCAGAAGTATGCAGAGTGAAGG + Intronic
1150072141 17:62160343-62160365 ATTAAAAATATGTAGATGGAGGG - Intergenic
1159302405 18:66592095-66592117 CTCAAATGTATGTATATGGGAGG - Intronic
1164142478 19:22485287-22485309 ATCAAAAGGATGTAGACATAGGG - Intronic
926386855 2:12343743-12343765 CTCAAAAATTTCTAAACGGAGGG + Intergenic
930257073 2:49104904-49104926 CTCAAAAGTTTTTAGAAGGGTGG - Intronic
935266214 2:101396456-101396478 CTCATAAGTAAGTAGACAGTTGG - Intergenic
935363081 2:102264111-102264133 TTCAAAAGTATGCAGAGGGCTGG - Intergenic
1169924672 20:10770158-10770180 CTCAAAAGTATGAATACCAAGGG - Intergenic
1171526282 20:25814007-25814029 CTCATAATTATGTAGACATAAGG + Intronic
1171550545 20:26041878-26041900 CTCATAATTATGTAGACATAAGG - Intergenic
1173128418 20:40362667-40362689 CTCAACAGCATGGAGATGGAAGG - Intergenic
1177724350 21:24947879-24947901 CTAAAATGTATGTAGAAGTAAGG - Intergenic
1179896884 21:44368118-44368140 CTCAAAAATAAATAGATGGATGG - Intronic
1182024540 22:27107753-27107775 CTCATAAGTGTGTGGACAGATGG - Intergenic
949293806 3:2496848-2496870 CTCACAATTATGGAGACTGAAGG + Intronic
950630606 3:14279412-14279434 CTCAAAAGTAAGTAGTGGGGAGG + Intergenic
957709972 3:83843684-83843706 CTCAAATGTGTGTACAGGGAAGG - Intergenic
958715051 3:97770316-97770338 CTCAAAAGAATATAGACAAATGG - Intronic
958931362 3:100211357-100211379 CTTACAACTATGTAGAGGGAAGG + Intergenic
960916975 3:122705075-122705097 TTCAAAAGAATATAGAAGGAAGG - Intronic
960925194 3:122788547-122788569 CTCAAAGGTCTGTTGACGAATGG + Intronic
964606021 3:158561180-158561202 CTCAAAACTATGTTGATGGCAGG - Intergenic
965183200 3:165431020-165431042 CTCAAAAGAATATATACAGATGG - Intergenic
965502813 3:169476692-169476714 CACAAAAATATGTAAAGGGAAGG - Intronic
972547876 4:40098441-40098463 TTTAGAAGTATGTAGACAGAAGG + Intronic
976684915 4:87802133-87802155 CTCAAGATTATTTAAACGGATGG + Intronic
979180853 4:117725332-117725354 CTCAAAAGCATGTGGAAAGAAGG - Intergenic
980621947 4:135319254-135319276 CTCAAAAGGAGATAGACAGAAGG - Intergenic
982171090 4:152662570-152662592 CACAAAAGTATGGATGCGGAGGG + Intronic
982833544 4:160093162-160093184 CTCAAAAGTAGGTATACAAATGG - Intergenic
986187496 5:5458608-5458630 CTCACAAGAATGTAGAAGCAAGG + Intronic
987077894 5:14401526-14401548 CTTAATAGTTTGGAGACGGAGGG + Intronic
988876323 5:35450834-35450856 CTCAAAAGAAGGTATACGAATGG + Intergenic
989483363 5:41959175-41959197 CTCAAAAGAAGATATACGGATGG - Intergenic
995438399 5:112162887-112162909 CTCAAAAGTAAGTGGACTAACGG - Exonic
997909994 5:137862308-137862330 CTCAAAAGTATTTCCACTGATGG - Intergenic
998630997 5:143898501-143898523 CTCAAATATTTGTAGAAGGAAGG - Intergenic
998913624 5:146990927-146990949 CTCAAAAGAAGGTATACGAATGG + Intronic
1002877541 6:1225074-1225096 CTCTAAAATATGTAGAAGGAGGG - Intergenic
1004288787 6:14347765-14347787 CCCAAAGGTATGGAGAAGGATGG - Intergenic
1004625408 6:17371504-17371526 CTCAAAAGAAGGTACACAGAAGG - Intergenic
1006707301 6:36031703-36031725 CTCAAAAAAATGAAGATGGATGG - Intronic
1010561204 6:77352964-77352986 CTGAAAAGTATGTGGACAAAAGG - Intergenic
1011596005 6:89016893-89016915 CTCAAAAGAAGGTAGACAAATGG + Intergenic
1011923566 6:92613399-92613421 CTCAAAAGAAGGTACACAGATGG - Intergenic
1012738257 6:102978698-102978720 CTCAAAAGTATATATACAAATGG + Intergenic
1014309043 6:119776089-119776111 CTCAAGAGTATGTATACTGTTGG + Intergenic
1021006640 7:15403827-15403849 CACACAAGTATTTAGACAGATGG + Intronic
1024995651 7:55271526-55271548 GTCAAAAGCATGTTGACAGAAGG + Intergenic
1030349546 7:108468729-108468751 CACAAAAGTATGCAGTCTGAGGG - Intergenic
1035851846 8:2927973-2927995 CTCCATACTATGTAGACAGATGG - Intergenic
1036602531 8:10274903-10274925 CTCAAAAGAAGATAGACGAATGG - Intronic
1061280432 9:129595056-129595078 CTCAAGAGGAGGTAGACTGAGGG + Intergenic
1062019655 9:134312777-134312799 GTCAGAAGTAAGTAGAAGGAAGG - Intergenic
1186706554 X:12145980-12146002 CTCAAAAGTATGTAGACGGAGGG - Intronic
1188240370 X:27780181-27780203 TCCAAAAGTATTTAGACAGAAGG + Intergenic
1188765522 X:34087082-34087104 CTATAAATTATGTAGAAGGAGGG - Intergenic
1188980685 X:36724406-36724428 CTCAAAAGGGTGTACATGGATGG + Intergenic
1192492730 X:71590368-71590390 CACAAAAGTATGTAAAAAGATGG + Intronic
1193296888 X:79843993-79844015 ATCAAAAGGATGTAGACGTGTGG - Intergenic
1193556838 X:82964182-82964204 CTCAAAAGTAGATACACGAATGG - Intergenic
1196319923 X:114274493-114274515 ATCCAAAGTAAGTAGAAGGAAGG + Intergenic