ID: 1186714428

View in Genome Browser
Species Human (GRCh38)
Location X:12235220-12235242
Sequence CAGCCACATCTCCCCCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186714428_1186714432 19 Left 1186714428 X:12235220-12235242 CCCTTCTGGGGGAGATGTGGCTG 0: 1
1: 1
2: 1
3: 18
4: 215
Right 1186714432 X:12235262-12235284 AATAATGTGTGCCGACCTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1186714428_1186714433 29 Left 1186714428 X:12235220-12235242 CCCTTCTGGGGGAGATGTGGCTG 0: 1
1: 1
2: 1
3: 18
4: 215
Right 1186714433 X:12235272-12235294 GCCGACCTCAAGGACAAATTAGG 0: 1
1: 0
2: 0
3: 1
4: 41
1186714428_1186714431 -8 Left 1186714428 X:12235220-12235242 CCCTTCTGGGGGAGATGTGGCTG 0: 1
1: 1
2: 1
3: 18
4: 215
Right 1186714431 X:12235235-12235257 TGTGGCTGGTAACAGCTTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 195
1186714428_1186714435 30 Left 1186714428 X:12235220-12235242 CCCTTCTGGGGGAGATGTGGCTG 0: 1
1: 1
2: 1
3: 18
4: 215
Right 1186714435 X:12235273-12235295 CCGACCTCAAGGACAAATTAGGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186714428 Original CRISPR CAGCCACATCTCCCCCAGAA GGG (reversed) Intronic
900285911 1:1900188-1900210 GAGCCACCGCGCCCCCAGAAGGG - Intergenic
900549413 1:3246604-3246626 CAGGCACAGCTCCACCAGAGGGG + Intronic
901149994 1:7095003-7095025 CAGGGACACCTCCCCGAGAAAGG - Intronic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
902087025 1:13871107-13871129 CAGCCAACTCCCCCCCAGGAAGG - Intergenic
902933470 1:19747256-19747278 CAGCCTCTTTTCCCTCAGAATGG - Exonic
903132349 1:21288635-21288657 CAGTCTCATCTTCCACAGAAGGG - Intronic
903592766 1:24469760-24469782 CAAGCACATCTTCCCTAGAAGGG - Intronic
904296070 1:29520609-29520631 CAGCCTGATCTGCCCAAGAATGG - Intergenic
904336850 1:29803455-29803477 CAGCCTGATCTGCCCAAGAATGG - Intergenic
904611906 1:31730708-31730730 CAGCCTCATCCTCCCCAGAGCGG - Intronic
904774928 1:32900881-32900903 CAGCCCCATCTTACCCAGAAGGG - Intronic
905293690 1:36940824-36940846 CAGCCACATCCCCAGCACAAGGG + Intronic
907194164 1:52672932-52672954 CAGCCACTTCTCCCCAAGCAGGG + Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907354839 1:53863663-53863685 CAGCGCCATCTGCCCCAAAAGGG + Intronic
908123586 1:61008220-61008242 TTGCCACATCTCCCCTAGACAGG + Intronic
912793636 1:112675947-112675969 CAGCCATATCTCACCCATACTGG - Intronic
912889020 1:113507931-113507953 CAGGCACATGACCCCCAAAAGGG - Intronic
915456043 1:156041554-156041576 CAGCCACATCTTCTCCAACAGGG - Exonic
919562535 1:199139675-199139697 CTGCCACATCTCCCATAGTATGG - Intergenic
920021655 1:202961045-202961067 CAGCCACCTCACCTCCAGGAAGG - Intergenic
920591033 1:207219099-207219121 CAGACTCTTCTCCCCAAGAAAGG + Intergenic
921557375 1:216615123-216615145 CAGGCTCATCACCCCCAGACAGG - Intronic
923954659 1:239002230-239002252 CAGCCACATGTGTCCCAGGATGG + Intergenic
924955869 1:248926047-248926069 CAGCCGCCTCTCCAGCAGAAGGG + Intergenic
1064008630 10:11717485-11717507 TCGCCACTTCTCTCCCAGAAGGG + Intergenic
1064138700 10:12772140-12772162 CAGGCACATGTCCCCCAGGCAGG - Intronic
1065163200 10:22945058-22945080 CAGCCATTTCTCCTCCAAAAGGG + Intronic
1065521645 10:26579566-26579588 CTGCCACCTCTCCCCAGGAAAGG - Intergenic
1065527467 10:26637831-26637853 CTGCCACCTCTCCCCGGGAAAGG - Intergenic
1065559370 10:26946558-26946580 CTGCCACCTCTCCCCAGGAAAGG + Intergenic
1065871006 10:29956395-29956417 CGGCCACTCCTCCCCCAGTATGG - Intergenic
1067070493 10:43127249-43127271 CAGCCACATGTCCTCCATCAGGG + Intronic
1068058358 10:52037291-52037313 CAGCCACATCTCCAGCACACAGG - Intronic
1068286402 10:54942275-54942297 AACCCACATCTCCCTCAGAATGG - Intronic
1068592353 10:58864546-58864568 CAGCCACATCTCCAGCACACAGG - Intergenic
1072379992 10:94858233-94858255 CAGACACCCCTCCCCCAGCAAGG + Intergenic
1073002731 10:100297456-100297478 CAGCCACAGCCCCTCCTGAAGGG + Exonic
1074111930 10:110428935-110428957 CAGCCACATCTCCAGCATGAAGG - Intergenic
1074752837 10:116603328-116603350 TAGCCAGCTCTGCCCCAGAATGG - Intronic
1074912765 10:117926613-117926635 CTGCCAAATCTCCTGCAGAATGG - Intergenic
1075918038 10:126186591-126186613 CAGCCAAATGTCACACAGAATGG - Intronic
1076311006 10:129507479-129507501 AAGCCAGATCTCCTCCAGCAGGG - Intronic
1077055906 11:592986-593008 TAGCCACCCCTCCCCCACAAAGG - Intronic
1077533885 11:3109910-3109932 CAGACACCTCTCCTCCCGAATGG + Intronic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1078983291 11:16562715-16562737 CTCCCACTTCTCCCGCAGAATGG + Intronic
1079135827 11:17775560-17775582 AAGCTACTTCTCTCCCAGAAAGG + Intronic
1079244827 11:18744263-18744285 CAGCCACAGCCACCCCAAAAGGG - Intronic
1083151319 11:60793565-60793587 CAGCCCCTTCCCCACCAGAAAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083773816 11:64883431-64883453 CAGCCTCATCAGCCCCAGCAAGG - Intronic
1083951372 11:65958489-65958511 CAACCACAGCTCCCCCTCAAGGG + Intronic
1085274635 11:75290414-75290436 CAGCCACATCTACCCCCGGCTGG + Intronic
1089385670 11:118066023-118066045 CAGCCCCCTCTTCCCCAGCAGGG - Intergenic
1096180184 12:49546421-49546443 CAGCCTCACCTCCCCCTGCAAGG - Intronic
1099337912 12:81387930-81387952 CAGCAACATTTCCAGCAGAAAGG + Intronic
1100691173 12:97039739-97039761 AGGCCACACCTGCCCCAGAAAGG - Intergenic
1104711230 12:130988158-130988180 TATCAACACCTCCCCCAGAAAGG - Intronic
1105673542 13:22645352-22645374 CAGCCAGATCTCCACAAGAGAGG + Intergenic
1105775133 13:23652924-23652946 CAATTACATCTCCCACAGAAAGG - Intronic
1105974014 13:25457055-25457077 AAGCCACATGTAGCCCAGAACGG - Intronic
1107152441 13:37127893-37127915 CAGCCAAATGTTCCCCAAAACGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1109182888 13:59234896-59234918 CAGCCACATCTCTCCTAGTCCGG - Intergenic
1114356919 14:21920593-21920615 CAGCCATAACTCAGCCAGAAGGG - Intergenic
1114388836 14:22283857-22283879 AAGCCTCATTTCCCACAGAAAGG + Intergenic
1116345142 14:43784169-43784191 CAGCCACCTCTCCCTTAGAGGGG + Intergenic
1117799366 14:59427523-59427545 CAGCCACATTTATCTCAGAAGGG + Intergenic
1117958605 14:61141961-61141983 AGACAACATCTCCCCCAGAAAGG - Intergenic
1117998707 14:61502925-61502947 GAGCCACACATCCCCCAGGAAGG - Intronic
1120551934 14:85883333-85883355 CAGCCACATCACCCCAATATTGG - Intergenic
1121438149 14:93932360-93932382 CGGCCTCACCTCCCCCAGAGTGG + Intergenic
1121580219 14:95024527-95024549 CAGCCACCTCTCCCCAGCAATGG + Intergenic
1121744314 14:96276061-96276083 CAGCCAAATCTCCGCCCTAAAGG - Exonic
1123625030 15:22221403-22221425 CGGCCACATCTCACCCAGGCAGG + Intergenic
1124352076 15:28963259-28963281 CAGAAACATCTCCAACAGAAGGG - Intronic
1125581336 15:40788140-40788162 CAGCCACGTCTCCCCAAGCCCGG + Intronic
1130815267 15:87425239-87425261 CAGCCTGATCTCCTCCAGCACGG + Intergenic
1132045713 15:98561481-98561503 CAGCCACTTCTCCCACAGTTAGG + Intergenic
1133294388 16:4743837-4743859 CACACACATGTCCTCCAGAATGG - Intronic
1135485930 16:22864570-22864592 CAGCCCCTTCACCCCCAGGAGGG - Intronic
1138371189 16:56527686-56527708 CCTCCACCTTTCCCCCAGAATGG + Intergenic
1138603180 16:58069775-58069797 GAGCCACCTCGCCCACAGAATGG + Intergenic
1139386523 16:66576012-66576034 CAGCCACTGCTCACCCAGGAGGG + Intronic
1139486492 16:67259723-67259745 CTGACAAATCTCCCCCAGAAGGG - Intronic
1140481514 16:75265262-75265284 GAGCCACCCCTCCCCCAGGACGG - Intronic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1142884300 17:2903280-2903302 CAGCCACAGCTCCTCCTCAATGG - Intronic
1146375158 17:32288862-32288884 CAGCCCCTTCTCCTCCAGCAGGG - Exonic
1148355671 17:46974082-46974104 CAGCAAGATGTCCCCTAGAACGG - Intronic
1150241429 17:63636782-63636804 CAGCCACTTCTCCCACAGCCGGG - Intronic
1150291891 17:63987152-63987174 CAGCCCCATCCCCCCAACAAGGG + Intergenic
1152246179 17:79185727-79185749 AAGCCTCATCCCCTCCAGAAAGG + Intronic
1155961990 18:32002791-32002813 CAGCCACATCTCCAGCACACAGG + Intergenic
1156628477 18:38938985-38939007 CCCCCACATCCACCCCAGAAGGG - Intergenic
1156706179 18:39885262-39885284 AGGACCCATCTCCCCCAGAATGG - Intergenic
1157386831 18:47264512-47264534 TGGCAACATCTCCCCCAGAGTGG - Intergenic
1157563343 18:48663734-48663756 CACCCCCATCTCTTCCAGAATGG + Exonic
1159239940 18:65729290-65729312 CTGCTACATCTCCAGCAGAAAGG + Intergenic
1160740358 19:682783-682805 CCGCCAGAGCTCCCCCAGAGTGG - Exonic
1161816221 19:6501712-6501734 CTGCCACCTCTCCCCCAGCAAGG + Intronic
1162612763 19:11768779-11768801 CAGCCATATATCCCCAAGGAAGG - Intronic
1162739027 19:12763430-12763452 CAACCACACCTCCTCCTGAAGGG - Exonic
1163173411 19:15548587-15548609 CTGCTGTATCTCCCCCAGAAAGG - Intronic
1165364775 19:35358803-35358825 CAGCAGCATCTCCCCTAAAAGGG - Intronic
1165366593 19:35371272-35371294 CAGCAGCATCTCCCCTAAAAGGG - Exonic
924959075 2:17661-17683 CAGCCACCTCTCCAGCAGAAGGG - Intergenic
925207403 2:2018750-2018772 GATCAACAACTCCCCCAGAAAGG + Intronic
925404842 2:3599365-3599387 CAGTCAATTCTCCCGCAGAATGG - Intronic
925566196 2:5257187-5257209 CATCCACATTTCCCCCGCAAGGG + Intergenic
925970887 2:9105929-9105951 CAGCCAGATCATCCCCAGGAGGG + Intergenic
931960052 2:67472458-67472480 CAACCACATCTCCCCTAGCATGG - Intergenic
934078485 2:88448221-88448243 CAGCCTCATCTACCCCCGAGAGG - Exonic
935658106 2:105442126-105442148 CAGCCAGCTCTTGCCCAGAAAGG - Intergenic
937030539 2:118735598-118735620 CACCCACATCTCACCTTGAATGG - Intergenic
940681109 2:156786483-156786505 CAGGCTCACCTCCCCCAGGAAGG - Intergenic
941144849 2:161832190-161832212 GAGCCCCAACTCCCACAGAAGGG - Intronic
942513124 2:176723755-176723777 CAGCCACATCCCATTCAGAATGG + Intergenic
944251025 2:197580297-197580319 CAGCCACATCTCCAGCACACAGG + Intronic
944913424 2:204332741-204332763 CAGCCACTTCTCTTCCAAAAGGG + Intergenic
945663850 2:212718049-212718071 CTACCTCATGTCCCCCAGAAAGG + Intergenic
945705774 2:213229536-213229558 CAGCCACTGCTCTTCCAGAAAGG - Intergenic
947116192 2:226773765-226773787 CCATCACATCTCCCCCAGGAAGG + Intronic
947917404 2:233842135-233842157 CAGCTTCATCTCCCAGAGAATGG - Exonic
948265636 2:236633395-236633417 CTGCCCCCTCTCTCCCAGAAGGG - Intergenic
1170358948 20:15523451-15523473 CAGCCAAATCTTCCCCAAATCGG - Intronic
1172782179 20:37443428-37443450 CTGCCACATCTCCCTCGAAAGGG + Intergenic
1174403159 20:50286836-50286858 CAGCCCCACCCACCCCAGAACGG - Intergenic
1174459780 20:50674109-50674131 CAGACACATCTTACCCAGAGAGG - Intronic
1176206284 20:63890071-63890093 CAGCCACATCTCCGCGTGGATGG - Exonic
1177573956 21:22926557-22926579 TAGCTAGATTTCCCCCAGAAAGG - Intergenic
1179776922 21:43670603-43670625 CAGCCACATGTGGCCCAGGATGG + Intronic
1181090533 22:20469434-20469456 CTGAAACATCTCCCCCAGCATGG - Intronic
1181104530 22:20565965-20565987 GGGGCACATCTCCCACAGAAAGG - Intronic
1181528928 22:23504997-23505019 CAGCCACAGTTGCCCCAGAATGG - Intergenic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1182691855 22:32169878-32169900 CAGCCACAACTTACACAGAAGGG + Intergenic
1184130991 22:42516248-42516270 CAGCCACATCTGCCCAAGCCGGG + Intronic
1184141161 22:42578073-42578095 CAGCCACATCTGCCCAAGCCGGG + Intergenic
1184943596 22:47785532-47785554 CTACCACATCTCCTCCTGAATGG + Intergenic
1185028401 22:48428379-48428401 CAGCAGCATATTCCCCAGAAAGG + Intergenic
1185411500 22:50685337-50685359 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411521 22:50685426-50685448 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411556 22:50685574-50685596 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411577 22:50685663-50685685 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411591 22:50685722-50685744 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411625 22:50685870-50685892 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411674 22:50686077-50686099 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411709 22:50686225-50686247 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411763 22:50686461-50686483 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411798 22:50686609-50686631 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411826 22:50686727-50686749 CAGCTACAACTCTCCCAGAGGGG - Intergenic
949947642 3:9202945-9202967 CAGCCACTTCTCCCCAAGCCAGG + Intronic
950684951 3:14610117-14610139 CAGTCATATCTTTCCCAGAATGG + Intergenic
951534500 3:23728913-23728935 CAGCCACACCTCCTCCTGCAAGG - Intergenic
953703675 3:45215447-45215469 CAGCCAGATCTCCTCGAGACTGG + Intergenic
954571941 3:51648232-51648254 CAGACACCTCTCCCCCAGCCAGG - Intronic
954870938 3:53767004-53767026 CATCCCCATCTCCCCTACAAGGG - Intronic
955338424 3:58106271-58106293 TTGCCACATCTCCAACAGAAGGG + Intronic
956884471 3:73545282-73545304 CAGCAACCTCTTCCCTAGAAAGG + Intronic
961036640 3:123647129-123647151 CAGCCACCTCTGCCCCAAGATGG - Intronic
961625651 3:128261916-128261938 CAGGGACATTTCCCCCAGACGGG + Intronic
963732300 3:148986083-148986105 CAGCCACATCTTCTCCAACAGGG - Intergenic
964381410 3:156101795-156101817 CTGCCTCATCTCCCCCAAGATGG + Intronic
966947246 3:184785537-184785559 CAGGCAGATCTCCCCAAGAAGGG + Intergenic
967896850 3:194402227-194402249 CAGCCACATATTCCCTAGCAGGG + Intergenic
972272803 4:37528378-37528400 CAGCCGCATCTCACCCAAGAAGG + Intronic
975763415 4:77640939-77640961 AAGACACATGTCCTCCAGAAAGG + Intergenic
980956065 4:139430505-139430527 CACCCACATCTCACCTTGAATGG - Intergenic
981068133 4:140506937-140506959 CTGCCACTTCTTCCCAAGAATGG - Intergenic
982370843 4:154631182-154631204 CAGCCCCATCTCCCCAAATAAGG + Intronic
983782581 4:171689933-171689955 CAGGCTCATGTCCCCCAAAAGGG - Intergenic
983888149 4:173003839-173003861 CAAGCCCATCTCACCCAGAACGG + Intronic
984275791 4:177607528-177607550 CAGCCTCAGCTAGCCCAGAAAGG + Intergenic
985434735 4:189917514-189917536 CTGCCACCTCTCCCCAGGAAAGG + Intergenic
985468469 5:20665-20687 CAGCCGCCTCTCCAGCAGAAGGG - Intergenic
986346150 5:6837206-6837228 CACCTCCATCTCCCCCAGATTGG + Intergenic
992502757 5:77358056-77358078 CGGCCACACCACCCCTAGAAAGG - Intronic
992804038 5:80319579-80319601 CAGTCACATCTCTCCTAGAATGG + Intergenic
994116833 5:96070834-96070856 TAGGAACATCTGCCCCAGAAGGG + Intergenic
999626397 5:153525223-153525245 TTGCCACATGTCCCCCAGGAAGG - Intronic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1000352521 5:160363069-160363091 CACCCAAATCTCACCCAGCAGGG + Intronic
1001867934 5:175121584-175121606 CAGCCACCTCTTCCCCTTAAGGG + Intergenic
1003442853 6:6159519-6159541 GAGCCACATCCCCCCAAAAAAGG - Intronic
1006054054 6:31367492-31367514 CAGCCCCAGGACCCCCAGAAGGG - Intergenic
1015044162 6:128759405-128759427 CAGCCCCATCTCCCCAAGCCTGG + Intergenic
1015339789 6:132085145-132085167 TAGCCATGTCTCCCCCAAAAGGG - Intergenic
1017694552 6:157001472-157001494 CAGGCTCCTCTCCCCTAGAAAGG - Intronic
1017988437 6:159465427-159465449 CAGCTACAGCATCCCCAGAATGG - Intergenic
1019341001 7:508924-508946 CAGCCTCGGCTCTCCCAGAAGGG + Intronic
1021104787 7:16624969-16624991 CAGCAAAATCTCACCCACAAAGG + Exonic
1021963272 7:25893560-25893582 GAGCCACATCTCACCCTGCAGGG + Intergenic
1022799201 7:33759646-33759668 GGCCCTCATCTCCCCCAGAATGG + Intergenic
1030887595 7:114957603-114957625 CATCCACATCTCCCTCTCAAAGG - Intronic
1032162223 7:129519687-129519709 AAACCACATCTCTCCCAGCAAGG - Intergenic
1032500308 7:132394995-132395017 CAGCCACACCTGCCCCGGAAAGG - Intronic
1034014492 7:147567211-147567233 CAGCAAAATCTTCCCCAAAACGG + Intronic
1034022337 7:147658586-147658608 CCGCCAAATCTCCCCCTGCAGGG + Intronic
1039448477 8:37651369-37651391 TAACCTCATCTCCCCCAGGAAGG + Intergenic
1039469465 8:37804257-37804279 CAGCCACATCTCCAGGAGAAAGG + Intronic
1041245420 8:55884403-55884425 AAGCCAAATATACCCCAGAAAGG - Intronic
1041406700 8:57507440-57507462 CAGCCTCATCTCACACAGAGAGG + Intergenic
1043230458 8:77793939-77793961 CTACCAGATCTTCCCCAGAAGGG + Intergenic
1046615419 8:116472189-116472211 CAGCAGCATAACCCCCAGAATGG + Intergenic
1048179544 8:132182484-132182506 CAGCCTCATCTCCCCAGGGAGGG + Intronic
1049751207 8:144285096-144285118 CAGCCACATCGCTGCCAGGATGG + Intronic
1051055955 9:12986237-12986259 CAGCCTAATCCCCCCCAAAATGG + Intergenic
1054342171 9:63876412-63876434 CTGCCACCTCTCCCCAGGAAAGG - Intergenic
1057023420 9:91718459-91718481 CAGCTATAACTCCCCCAGGATGG - Intronic
1057023449 9:91718554-91718576 CAGCTACAACTCCCCCAGGATGG - Intronic
1057427206 9:94962063-94962085 CAGCCACATTTTCCCAACAAAGG - Intronic
1057801697 9:98195079-98195101 CAGCCACAGCAACCCCAGGAAGG - Intergenic
1057913945 9:99041376-99041398 CAGCCACATCTGCCTCAAAAAGG - Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1060504054 9:124184856-124184878 CAGCCACATCCCCACAAGAGTGG + Intergenic
1061452390 9:130675349-130675371 CAGCCCCATCTCCCCCAGAAGGG - Intronic
1061710058 9:132481239-132481261 CAGCCCTGTCTCCCCCAGAGCGG + Intronic
1061764102 9:132870601-132870623 CAGCCCCTTCGCCGCCAGAAAGG - Intronic
1061860723 9:133467418-133467440 CAGCCACATCGCCACAAGTAAGG - Intronic
1062000049 9:134211373-134211395 CAGCCCCAGCACCCCCAGCAAGG - Intergenic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062453881 9:136626755-136626777 CAGCTTCTTCTCCCCCAGCATGG - Intergenic
1062479106 9:136743260-136743282 TGTCCACATCTGCCCCAGAAGGG - Intronic
1186508046 X:10109919-10109941 GGGCCACATCTCCCGCAGAGCGG - Exonic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1189906996 X:45771327-45771349 CAGCCACGTTTTCCCTAGAATGG + Intergenic
1192560528 X:72125137-72125159 AAGCCACATCTCCCCCACTTAGG + Intergenic
1194497920 X:94639886-94639908 CAACCAAATCACCCCCAGAAAGG + Intergenic
1195326871 X:103765303-103765325 CAGCCACATCTCCAGCACACAGG - Intergenic
1196375710 X:115030500-115030522 CAGCCACATCACCTCCAAAAAGG - Intergenic
1197553862 X:127930339-127930361 TAGCCACATGGCACCCAGAAGGG - Intergenic
1200101712 X:153691760-153691782 CAGCCCCAGCTCCCCCATCAGGG - Intronic
1200123373 X:153801782-153801804 CAGCCCCATCCCTCCCAGCAGGG - Intergenic