ID: 1186717868

View in Genome Browser
Species Human (GRCh38)
Location X:12272417-12272439
Sequence GAGGGTGACCAGGGAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 1, 1: 1, 2: 11, 3: 174, 4: 1078}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186717868 Original CRISPR GAGGGTGACCAGGGAGAGGA CGG Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900372114 1:2336723-2336745 GAGGCTGTCCAGGAACAGGAAGG + Exonic
900518088 1:3092691-3092713 GGGGGTGCCCAGCCAGAGGAAGG - Intronic
901082407 1:6591103-6591125 GAGGGAAACTGGGGAGAGGAGGG + Exonic
901224156 1:7602012-7602034 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
901269782 1:7942699-7942721 GAGAGTGGCCAGGGAGAGAGAGG - Intronic
901319388 1:8330335-8330357 GATGCTGACCAGGGTCAGGACGG - Exonic
901445878 1:9307903-9307925 GAGGGGGACCATGGCGAGGAGGG - Intronic
901496348 1:9624542-9624564 GAGGAAGAAGAGGGAGAGGAGGG - Intergenic
901513517 1:9730317-9730339 GAGCGCGACCAGGCAGAGGGTGG + Exonic
901526383 1:9825418-9825440 GAGGGGGAGCAGGGGAAGGAAGG - Intergenic
901643355 1:10704308-10704330 AAGGGGCACCAGGGAGAGAAAGG + Intronic
901655796 1:10768548-10768570 GCTGGAGTCCAGGGAGAGGAGGG - Intronic
901724483 1:11230068-11230090 GAGGGGGAATAGGGAGAGGTTGG - Intronic
901800276 1:11704463-11704485 GAGGCAGCCCAGGGGGAGGAGGG - Intronic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
902234017 1:15046408-15046430 GAGGAGGAGGAGGGAGAGGAAGG + Intronic
902715573 1:18270359-18270381 GAGGGTGAATGGGCAGAGGATGG + Intronic
902784020 1:18721425-18721447 GAGGGGGTCGAGGGAGAGGGAGG - Intronic
902784733 1:18725534-18725556 GAGGGGGAGCAGGGAAGGGAGGG + Intronic
903019646 1:20385108-20385130 GAGTGTGCAGAGGGAGAGGAAGG - Intergenic
903138814 1:21326459-21326481 GAAGGGGTCCAGGGAGAAGAAGG + Intronic
903215152 1:21839606-21839628 GAGGGTGGCCATGGTGAGGAAGG + Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903336690 1:22629141-22629163 GAGAGTGGCCAGGGAGAGCCTGG - Intergenic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
903410498 1:23139483-23139505 TAGGCTGAGGAGGGAGAGGAAGG - Intronic
903442329 1:23397447-23397469 GAGAGTGAGGAAGGAGAGGAAGG - Intronic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904528965 1:31155449-31155471 GCGGGTGGCCCGGGAGAGGCCGG + Intergenic
904594169 1:31632641-31632663 GAAGGTGAGGAGGGAAAGGAGGG + Intronic
904601336 1:31674216-31674238 GAGGGTGGCCAGGATGAGGGGGG + Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904841319 1:33373659-33373681 GAGGGTGACCAGTGGGAGAAGGG - Intronic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
905121203 1:35683291-35683313 GAGAGAGAGCGGGGAGAGGAGGG - Intergenic
905241779 1:36586275-36586297 GAGGGTGTCGTGGGAGGGGAGGG + Intergenic
905313529 1:37066629-37066651 GATGGTGACCAGGAAGGGCAGGG + Intergenic
905502646 1:38451870-38451892 GAGGATGACTAGGGAGGAGAGGG - Intergenic
905673302 1:39807640-39807662 GAGGGAGACGAGGGAGACGAGGG - Intergenic
905673304 1:39807649-39807671 GAGGGAGATGAGGGAGACGAGGG - Intergenic
905673306 1:39807658-39807680 GAGGGAGACGAGGGAGATGAGGG - Intergenic
905874575 1:41423819-41423841 GAGGGTGGCCTGGGAGGGGCAGG - Intergenic
906240567 1:44239787-44239809 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
906240570 1:44239796-44239818 GAGGGAGAGGAGGGAGTGGAGGG + Intronic
906269044 1:44460017-44460039 GGGGATGAACAGGGAGGGGACGG + Intronic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
906644731 1:47466219-47466241 GGAGGTAAGCAGGGAGAGGAAGG - Intergenic
907497234 1:54853210-54853232 GAGGGGGTGCAGGGAGAAGAGGG + Intronic
907722463 1:56984531-56984553 GAGGGTCACAAGGGAGTGTAAGG + Intergenic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908610928 1:65860189-65860211 GAGGGTGAGCGGTGAGGGGAGGG - Intronic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911084718 1:93966714-93966736 GATGGTGTCCAGGCAGAGGTGGG + Intergenic
911145940 1:94552544-94552566 GAGGGGGCCTAGGGAGGGGAAGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911502860 1:98710321-98710343 GAGGGTGAAAGGGGAGAAGAAGG + Intronic
911546897 1:99227963-99227985 GGGGGTGTCAAGGGAGGGGAGGG + Intergenic
912303106 1:108536814-108536836 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303109 1:108536823-108536845 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303112 1:108536832-108536854 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303115 1:108536841-108536863 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303133 1:108536896-108536918 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303136 1:108536905-108536927 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912524729 1:110273056-110273078 GAAGCTGAGCAAGGAGAGGAAGG + Intronic
912664938 1:111570481-111570503 GTGGGGGAGCAGGCAGAGGAGGG + Intronic
912688049 1:111782402-111782424 AAGGGGGACCTGGGAGAGAAAGG + Intronic
913118947 1:115721982-115722004 TAGGGGGCCCAGGTAGAGGAGGG + Intronic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
913966195 1:143379532-143379554 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
914060569 1:144205139-144205161 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
914118581 1:144761230-144761252 GAAGGTAGCAAGGGAGAGGAAGG - Intergenic
914340393 1:146755225-146755247 GAGGGGGACAAGGGAGATGGAGG - Intergenic
915236989 1:154491153-154491175 GACTATGACCAGGTAGAGGATGG - Intronic
915298962 1:154941323-154941345 AAGGGAGACCTGGGAGAGGTGGG + Intergenic
915625322 1:157110889-157110911 GAGGGAGGCCAGGGAGGGAATGG + Intergenic
915665138 1:157437565-157437587 GAATGTGACCTGGGAGAGCAAGG + Intergenic
915860392 1:159437920-159437942 TAGGGTGACCAAGGTGAGCAAGG - Intergenic
917447686 1:175120543-175120565 GGTGGTGACCAGGTAAAGGAGGG - Intronic
917620121 1:176786924-176786946 GAGGGTGGAGAGGAAGAGGAGGG + Intronic
918241736 1:182626249-182626271 GAGGGTGAGCAGGGAAGGGTGGG - Intergenic
919600291 1:199614055-199614077 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
919685442 1:200479648-200479670 GAGGATGGCCATGGAGAGGCTGG - Intergenic
919685547 1:200479989-200480011 GAGGATGGCCATGGAGAGGCTGG - Intergenic
919852497 1:201682449-201682471 GAGCCTGACCAGGGAGAGTGGGG - Intronic
919933293 1:202235630-202235652 GAAGAAGACCATGGAGAGGAAGG - Intronic
920101411 1:203519308-203519330 GGGGGTGAGCGGGGAGAGAAGGG - Intergenic
920376701 1:205512592-205512614 GAGTGTGAGGAGGGAGAGGCGGG + Intronic
920435412 1:205943756-205943778 GAGGGGGACGAGGCAGAGGAGGG + Intergenic
920839814 1:209545084-209545106 GAGGGCGGCCAGGGAAAGGACGG - Intergenic
920970622 1:210740814-210740836 GAGAGTGAGAAGGAAGAGGAGGG + Intronic
921617290 1:217284571-217284593 GAGGGGGGATAGGGAGAGGATGG - Intergenic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
922427705 1:225514802-225514824 GAGGGGGCCCTGGGGGAGGAGGG + Exonic
922562902 1:226582017-226582039 GAGGGAGAGCTGGAAGAGGAGGG - Intronic
922565184 1:226597017-226597039 GGGAGTGGCCAGGGACAGGAAGG + Intronic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922718162 1:227887499-227887521 GTGGGTCACCAGGGAGGGGAGGG + Intergenic
922742308 1:228020838-228020860 GAGGGTGACTAGGGAGAGGGAGG + Intronic
923139090 1:231145624-231145646 GAGAGGGAACAGGGAGAGGTTGG + Intergenic
923265086 1:232306503-232306525 GAGTGTGGGAAGGGAGAGGAAGG - Intergenic
923482586 1:234397749-234397771 GAGGGGGAAGAGGGGGAGGAGGG + Intronic
923545194 1:234918725-234918747 GAGGGGGCCCAGGGACGGGAAGG - Intergenic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
1062876449 10:946761-946783 GAGGGTGGCAAGGAAGAGGAGGG - Intergenic
1062987478 10:1782487-1782509 GAGAGAGAGGAGGGAGAGGAGGG + Intergenic
1063378088 10:5566057-5566079 GAGGATGATGAGGGCGAGGATGG + Intergenic
1063968246 10:11363381-11363403 GAGCGTGACCAGGGAGAGCGCGG + Intergenic
1064086457 10:12349459-12349481 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1064177117 10:13084813-13084835 GAGATTGTCTAGGGAGAGGAAGG + Intronic
1064493435 10:15884145-15884167 GTGGGATACCAGGAAGAGGAAGG + Intergenic
1064672548 10:17731394-17731416 GAGGGGGACAGGGGAAAGGAAGG + Intergenic
1064949182 10:20827922-20827944 GAGGGTGAAGAAGGAGGGGAGGG + Intronic
1065194925 10:23255089-23255111 GGAAGTGGCCAGGGAGAGGAGGG + Intergenic
1066219936 10:33326464-33326486 GAAGGTGTTGAGGGAGAGGAAGG - Intronic
1066453294 10:35550514-35550536 CAGGGAGGCCAGGGAGAGAAGGG - Intronic
1067251731 10:44592568-44592590 GGGGCTGACCTGGGAGTGGAGGG + Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067574933 10:47403127-47403149 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068067611 10:52151227-52151249 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
1068318622 10:55381053-55381075 GAGGCTGAGCAATGAGAGGAGGG + Intronic
1069265704 10:66454806-66454828 GAGGGAGAGGAGGGGGAGGAGGG + Intronic
1069265709 10:66454815-66454837 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1069275819 10:66589229-66589251 GAGGGGGATCAAGGAGAAGATGG + Intronic
1069526807 10:69179900-69179922 GTGGGTGAGCAGTGAGAGAATGG - Intergenic
1069530542 10:69215556-69215578 GAGGGTGACTCGGGTGAGAAAGG - Intergenic
1069828832 10:71270563-71270585 TAGGGAGCCCAGAGAGAGGAAGG + Intronic
1069899741 10:71700659-71700681 GAGGCTGGGAAGGGAGAGGAGGG + Intronic
1069929137 10:71870441-71870463 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929140 10:71870450-71870472 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929143 10:71870459-71870481 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929146 10:71870468-71870490 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1069974047 10:72198241-72198263 AGGGGTGAGGAGGGAGAGGAGGG + Intronic
1070367619 10:75751344-75751366 GAGGGAGACTGGGGAGAGGGAGG + Intronic
1070799873 10:79239068-79239090 GAGGTTGACCAGGATGAGGGGGG + Intronic
1070808989 10:79288077-79288099 GAGGGTATCCAGGCAGGGGAGGG + Intronic
1070823259 10:79375564-79375586 GCTAGTGACCAGGGAGAGGATGG + Intergenic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071275362 10:84049137-84049159 GAGAGGGAACAGGGAGGGGATGG + Intergenic
1071348195 10:84713445-84713467 GAGGGAGAAGAGGGAGAGCAGGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071566157 10:86672419-86672441 GAGGGTCTCTGGGGAGAGGAAGG + Intronic
1071574347 10:86715013-86715035 GTGGGTCACCTGGGAGTGGAAGG + Intronic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071808545 10:89152195-89152217 GAGAGTGACCTGGGAAAGAATGG - Intergenic
1072682452 10:97516984-97517006 GCCTGTGACCAGGGAGAGGCAGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1073051333 10:100669382-100669404 GAGAGGGTCCTGGGAGAGGAAGG - Intergenic
1073063766 10:100746621-100746643 GAGGCTGACTAGGGAGAGGGTGG - Intronic
1073327496 10:102651101-102651123 GAGTGAGAGCAGGAAGAGGAAGG - Intronic
1074162415 10:110845609-110845631 TAGGGGGACCAGGGAAGGGAAGG - Intergenic
1074470825 10:113725236-113725258 GAGGGTTACAAGGGAGGGGAGGG - Intronic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075009611 10:118856444-118856466 GATGGTGAGCAGGCAGAGGTCGG + Intergenic
1075044894 10:119139139-119139161 GAGGGTCTACAGGGAGGGGAGGG + Intergenic
1075424834 10:122333486-122333508 TAGGGAGACCAAGGAAAGGAGGG + Intronic
1075797135 10:125128595-125128617 GTGGGGGTCAAGGGAGAGGAGGG + Intronic
1076319014 10:129564632-129564654 GAGGGTGAGGAAGCAGAGGAGGG - Intronic
1076319018 10:129564650-129564672 GAGGGGGAGGAAGGAGAGGAGGG - Intronic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076638157 10:131896421-131896443 GAGGGTGCACAGGGTGAGCAGGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076794066 10:132790366-132790388 GAGGGTGTCCAGGTAGAGCCCGG + Intergenic
1076923356 10:133467012-133467034 GACGGTGGCCAGGGATGGGAGGG + Intergenic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077043309 11:534005-534027 GAGAGGTACCAGGGAGAGGCTGG - Intronic
1077155730 11:1090070-1090092 GAGGGTGAGCAGGGTGGGGCGGG + Intergenic
1077218799 11:1406138-1406160 GCGGCTGGGCAGGGAGAGGAAGG - Intronic
1077278321 11:1728425-1728447 GAGGCTGGGCACGGAGAGGAGGG - Intergenic
1077287246 11:1773077-1773099 GAGGGTGTCCAGGCACAGGTGGG + Intergenic
1077295273 11:1823565-1823587 GAGGGTGAGCATGGACAGGGAGG + Intergenic
1077332159 11:1988505-1988527 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1077413166 11:2412856-2412878 GTAGGTGAACAGGAAGAGGAAGG + Exonic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077664153 11:4093116-4093138 GAGGGTGTCCAGGGAGTACAAGG - Exonic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1078971580 11:16418700-16418722 GAGGGGGGCCAGGGAGAGGGAGG + Intronic
1079370552 11:19848440-19848462 GAGGAGGACCAGAGAAAGGAGGG - Intronic
1079419456 11:20272477-20272499 GAGCTTGGCCAGGGGGAGGAAGG - Intergenic
1079457029 11:20645342-20645364 GGTGGTGTCCAGGGAGATGATGG + Intronic
1080646363 11:34191091-34191113 GATGGTGACCAAGGGGAGGAGGG - Intronic
1081115403 11:39193047-39193069 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
1081451531 11:43175304-43175326 GCGGGGAGCCAGGGAGAGGAAGG - Intergenic
1081869569 11:46377184-46377206 GTGGGTGAGCAGGGTGAGGTGGG - Exonic
1081905498 11:46666979-46667001 GAGGGAGAAAAGGGAGAGGATGG - Intronic
1081995209 11:47359477-47359499 GAGGGTCACTGGGGAGAGGCAGG + Intronic
1082786937 11:57322461-57322483 GAAGGAGAACAGGGAGAGGGGGG - Intronic
1082859329 11:57839075-57839097 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1082871171 11:57944623-57944645 GAGGGAGACCGGGGAGGGGGAGG + Intergenic
1083305961 11:61762183-61762205 AGGGCTGACCACGGAGAGGAGGG + Intronic
1083328516 11:61885916-61885938 GACGGGCGCCAGGGAGAGGATGG - Intronic
1083544437 11:63538192-63538214 GAGGGAGAGGAGGGTGAGGAAGG + Intronic
1083605455 11:63975981-63976003 GAGGGGGAAGAGTGAGAGGAAGG - Intronic
1083712613 11:64558536-64558558 GAGGGTGACTAGAGAGAGCTTGG - Intronic
1083882353 11:65554871-65554893 GATGGTGAAGAGGGAGAGGGTGG - Intronic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084655129 11:70510600-70510622 GAGGAGGAGCAGGGAAAGGAGGG - Intronic
1084680593 11:70664088-70664110 GAGGCTGAGCAGGGAGAGCTGGG + Intronic
1084742715 11:71149938-71149960 GAGGGGAAGGAGGGAGAGGAGGG + Intronic
1084762388 11:71282410-71282432 GAGGGTGGCCTGGAAGAGGTGGG - Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1086737885 11:90329831-90329853 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1086931708 11:92700457-92700479 GAGGGTGACCAGTGGCAGCAGGG + Intronic
1087113638 11:94499187-94499209 TAGGTTGACCAGGGTGAGGTAGG - Exonic
1087963988 11:104389788-104389810 GAGGGAGACAAGGGGGAGGGAGG - Intergenic
1088122913 11:106390694-106390716 GAAGGTGACCAGGAAAAGTAGGG - Intergenic
1088852394 11:113715579-113715601 GAAGGTCACCAGGGAAAGGAAGG + Intergenic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1089345942 11:117791809-117791831 GAGAGGGGGCAGGGAGAGGAAGG + Intronic
1089479397 11:118792138-118792160 GAGCGTGCGCCGGGAGAGGACGG + Intergenic
1089510320 11:118992507-118992529 GAGGGAGACCGTGGAGAGGGAGG + Intergenic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090078429 11:123594172-123594194 TTGGGTGACCTGGGAGGGGATGG + Intronic
1090502961 11:127279711-127279733 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1090655678 11:128842732-128842754 GAGCGTGGCCAAGGAGAGGAAGG - Intronic
1090686514 11:129128589-129128611 GAGGGAGACCGGGGAGAGGGAGG - Intronic
1090785635 11:130044877-130044899 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785638 11:130044886-130044908 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785641 11:130044895-130044917 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090949954 11:131464542-131464564 GAGAGTGAAAAGGAAGAGGAGGG - Intronic
1091082369 11:132682656-132682678 GAGAGCAACCAGGGAGAGAATGG + Intronic
1091231490 11:133990815-133990837 GAGAGACAACAGGGAGAGGAAGG - Intergenic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1091311120 11:134575977-134575999 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091311135 11:134576038-134576060 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091336075 11:134767280-134767302 GAGGGAGAGCAAGGTGAGGATGG + Intergenic
1091350327 11:134888843-134888865 GATAGTGATCATGGAGAGGAGGG + Intergenic
1202815140 11_KI270721v1_random:43681-43703 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091672444 12:2462083-2462105 GCTGGTGAGGAGGGAGAGGAGGG - Intronic
1092155203 12:6277998-6278020 GAGGGGGAGGAGGGAGAGGAGGG + Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092850187 12:12619067-12619089 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1093569065 12:20644853-20644875 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1094083829 12:26566466-26566488 GAGGAGGAGGAGGGAGAGGAGGG + Intronic
1094083832 12:26566475-26566497 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094488560 12:30944366-30944388 GAGGGGGATTAGGGAGATGATGG - Intronic
1094719791 12:33052410-33052432 GTGGGTGCTCAGGGAGGGGACGG - Intergenic
1095095102 12:38143098-38143120 GAGGGGGAGAAGGGAGGGGAAGG - Intergenic
1095945088 12:47749146-47749168 GTGGGAGACCAGGGGAAGGATGG - Intronic
1095982333 12:47980615-47980637 AAGGGTGAGCAAGGAGAGGCCGG - Exonic
1096781768 12:53995980-53996002 GAGGGGAACCAGGGAGGGGGCGG + Intronic
1096862766 12:54541929-54541951 GAGGGTGAAGAGGGGGAGGTGGG - Intronic
1096896106 12:54821822-54821844 GAGTGGGCACAGGGAGAGGAGGG + Intergenic
1097160607 12:57044083-57044105 GTGGGTGCCCAGGGTGAGGCAGG - Intronic
1097451783 12:59745100-59745122 GAAGGTGATGAGGGAGATGAGGG - Intronic
1098111476 12:67126526-67126548 CTGGGTGCCTAGGGAGAGGAAGG - Intergenic
1099138395 12:78938169-78938191 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1100550679 12:95644186-95644208 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100550684 12:95644195-95644217 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101950775 12:109173159-109173181 GAGGGTGAAAGGCGAGAGGAGGG + Intronic
1102555005 12:113720947-113720969 GAGTGGGAGAAGGGAGAGGAGGG + Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103005640 12:117418114-117418136 GAAGGGGAGGAGGGAGAGGAGGG + Intronic
1103286881 12:119809937-119809959 GAGGGCGACCAGGGAGGGCGTGG + Intronic
1103504515 12:121432880-121432902 GAAGGTGTCAAGGGAGAGGCAGG - Intronic
1103623314 12:122201519-122201541 GGTGGTGACCAGGGTGGGGAAGG + Intronic
1103724037 12:122989157-122989179 GAGGGTCACCAGAGTCAGGAAGG - Intronic
1103930269 12:124446455-124446477 GAGGTAGGCAAGGGAGAGGAGGG - Intronic
1103990410 12:124795328-124795350 GACTGGGACCAGGGAGAGGAGGG - Intronic
1104088400 12:125494819-125494841 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104535229 12:129612304-129612326 GATGTTGACAAGGGGGAGGATGG - Intronic
1104541685 12:129671702-129671724 GAGTGGGAGCACGGAGAGGAAGG + Intronic
1104781253 12:131422004-131422026 GAGGAGGACGTGGGAGAGGAGGG - Intergenic
1104845750 12:131845963-131845985 GGGGCCGACCAGGGAGAGGCAGG - Intronic
1104940288 12:132391990-132392012 GAGGGTCCCCAGGGAGAGCGGGG - Intergenic
1104940553 12:132392561-132392583 GAGGGTCCCCGGGGAGAGCAGGG - Intergenic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105425977 13:20295572-20295594 GAGGGTGACAAGGGAGCAGGAGG + Intergenic
1105683317 13:22752122-22752144 GAGAGGGAGCAGGGAGAAGATGG - Intergenic
1105994063 13:25653450-25653472 GAGGGTGGAGAGTGAGAGGAAGG + Intronic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1107115676 13:36742961-36742983 GAGGCCGACCTGGGGGAGGAAGG + Intergenic
1107518674 13:41157909-41157931 GAGGGTGGCAAGAGAAAGGAGGG + Intergenic
1107787544 13:43970737-43970759 GTGGGTGAGCAGGGTGAGGTGGG - Intergenic
1107790156 13:43993999-43994021 GAGGGTGGAGAGTGAGAGGACGG + Intergenic
1107849933 13:44561063-44561085 TCGGGGGACCAGGGAGAGGAGGG + Intronic
1107932302 13:45316289-45316311 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1108839786 13:54598224-54598246 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
1109188590 13:59299184-59299206 GAGGAGGAGCAGGGAGAAGAGGG + Intergenic
1109760935 13:66827809-66827831 GAGGATGACCAGGGACAAGGAGG + Intronic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110364334 13:74664285-74664307 AAGGGTGACGAGTCAGAGGAAGG + Intergenic
1111356749 13:87116262-87116284 GAGGGTGGAAAGTGAGAGGAGGG + Intergenic
1111991766 13:95123847-95123869 GCGGGTTACCAGGGTGAGGCGGG + Intronic
1112900551 13:104352488-104352510 GAGGGGGGGAAGGGAGAGGAGGG - Intergenic
1113120976 13:106923667-106923689 GGAGGTGAGGAGGGAGAGGAAGG + Intergenic
1113146056 13:107208877-107208899 GAGGGGGAGGAGGGGGAGGAAGG - Intronic
1113328955 13:109310899-109310921 GTGGGAGACGAGGGAGAGGGCGG - Intergenic
1113345760 13:109476916-109476938 GAGGGTGTCCAGGCAGGGGGAGG + Intergenic
1113376837 13:109772130-109772152 GAGGGTGGCCACTGAGATGACGG + Intronic
1113731620 13:112645558-112645580 GACGGTGAGCATGGCGAGGACGG + Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1113981978 13:114283850-114283872 GAGGGTGGCTGGGGAGGGGAGGG - Intronic
1114197989 14:20495724-20495746 AGGGGAGAGCAGGGAGAGGAAGG - Intergenic
1114215920 14:20657794-20657816 GTGGATGCTCAGGGAGAGGAAGG - Intergenic
1114239032 14:20849041-20849063 GAGGGCGGCCGGGGAGAGGAAGG + Intergenic
1114482441 14:23044188-23044210 GAGTGGGAGCAGGGACAGGAGGG - Exonic
1114552407 14:23540472-23540494 GGAGGTGACCATGGAGAGAAGGG + Intronic
1114773816 14:25458457-25458479 GAGGCTGCCCAGGAAGAGCAAGG - Intergenic
1116355163 14:43919245-43919267 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
1116374169 14:44176324-44176346 GAGGATGAAAAGGAAGAGGAGGG - Intergenic
1116791892 14:49348124-49348146 GAGGGTGACCTTGGAGAGGAAGG - Intergenic
1117761661 14:59035422-59035444 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118832258 14:69445294-69445316 GAGGATGAGGAGGAAGAGGAGGG - Intronic
1118862081 14:69672281-69672303 GAAGGTGAGAAGAGAGAGGAGGG + Intronic
1119490216 14:75025610-75025632 GAGGTTGTCCAGGGAGAATATGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119776401 14:77251807-77251829 GAGGGTGGACAGGGAAAAGATGG - Exonic
1120138873 14:80904343-80904365 GGGGGTGAAGAGGGAGAGAAAGG + Intronic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1120693058 14:87614684-87614706 GAGGGTGAAGGGTGAGAGGAGGG - Intergenic
1120833167 14:89016121-89016143 GAGGGTGACTAGGAAGATGGAGG + Intergenic
1121046443 14:90791666-90791688 GAGGGTGAACAGGGACTGGCGGG - Intronic
1121306978 14:92912674-92912696 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1121894902 14:97637658-97637680 GAATGTGGCAAGGGAGAGGAAGG + Intergenic
1122293904 14:100694331-100694353 GATGGGGAGGAGGGAGAGGAAGG - Intergenic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1122594360 14:102879005-102879027 GGGGGTGCCCAGTGAGTGGAGGG + Intronic
1122594893 14:102883478-102883500 GAGGGTGAGATGGGAGAGGTAGG + Intronic
1122598318 14:102908482-102908504 GAGGGTGCCCAGGCCGAGGGTGG - Exonic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1123034838 14:105467666-105467688 GAGGGTGCCCCAGGAAAGGAGGG - Intronic
1124252108 15:28113591-28113613 GCCGGTGAACAGAGAGAGGAGGG + Exonic
1125001114 15:34770785-34770807 GAGGCAGACCAGGGAGCTGATGG - Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125368388 15:38943405-38943427 GAGGCTGTCCAGGTATAGGAGGG - Intergenic
1125675958 15:41502760-41502782 GAGGGTGGGGTGGGAGAGGAGGG - Intronic
1125861375 15:43004363-43004385 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126309801 15:47302617-47302639 GAGAGTCACCAGTGAGAGAAGGG + Intronic
1126799253 15:52285407-52285429 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126799272 15:52285465-52285487 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126799275 15:52285474-52285496 GACGGAGAGGAGGGAGAGGAGGG - Intronic
1126799278 15:52285483-52285505 GAGGGAGAGGACGGAGAGGAGGG - Intronic
1127602482 15:60552126-60552148 GAGAGTTATCAGGGAGAGAAGGG + Intronic
1128113999 15:65094252-65094274 GAGGGAGATCAGGAAGAGGTGGG - Intronic
1128143988 15:65322182-65322204 GAGAGGGAGCAGGGAGAAGAAGG - Intergenic
1128668555 15:69557018-69557040 GAGGGTGGTCAGGGAGGAGAGGG + Intergenic
1128757552 15:70193825-70193847 GAGGGGGAGCAGGGGGAGAAGGG + Intergenic
1128825506 15:70712253-70712275 GATGGGGACCAAGGAAAGGAAGG - Intronic
1128940875 15:71786764-71786786 GGGGGGGAGGAGGGAGAGGAGGG + Intergenic
1129056957 15:72826820-72826842 GGGGGTGAGCGGGTAGAGGAGGG + Intergenic
1129090357 15:73143365-73143387 GAAGGTGACCCGGGAGTGGGAGG - Intronic
1129180727 15:73873290-73873312 GAGGGCTTCCAGGGAGAGGTGGG - Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129258677 15:74349840-74349862 GAGGCTGAGGAGGGAGAGGGAGG + Intronic
1129601233 15:76999794-76999816 ATGGGGGACCTGGGAGAGGATGG - Intronic
1129784449 15:78299728-78299750 GAGGGTGGGCGGAGAGAGGAGGG + Exonic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1130669002 15:85893707-85893729 GAGGGTGACCCCTGAGAGGGTGG + Intergenic
1130721016 15:86386078-86386100 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1130959805 15:88652342-88652364 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1131009355 15:89004374-89004396 GATGGGGCTCAGGGAGAGGAGGG - Intergenic
1131464728 15:92645992-92646014 GGGGGTGACCAGGCAGGGAAAGG - Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131597110 15:93809217-93809239 GAGGAAGAGGAGGGAGAGGAAGG + Intergenic
1131953989 15:97711498-97711520 GTGGGGGAACAGGGAAAGGAAGG + Intergenic
1132167689 15:99611993-99612015 GCTGGGGACTAGGGAGAGGAAGG + Intronic
1132481546 16:168781-168803 AGGTGTGAGCAGGGAGAGGAGGG - Intergenic
1132567689 16:630865-630887 GAGGGTCACCGGGGCGGGGAAGG - Intronic
1132728591 16:1349600-1349622 GAGGGCAGCCTGGGAGAGGAGGG + Exonic
1132849707 16:2019556-2019578 GAGGCTGAGCAGGCAGAGAATGG + Exonic
1132869691 16:2110346-2110368 GAAGGTGCCCACGGAGCGGAAGG + Exonic
1132953522 16:2578411-2578433 GAGGATGTCCAGGGAGCTGACGG + Intronic
1132960830 16:2621756-2621778 GAGGATGTCCAGGGAGCTGACGG - Intergenic
1133269254 16:4602550-4602572 GAGGGGCACTAGGGAGAGGGGGG - Intergenic
1133392602 16:5422237-5422259 GAGGAGGAGCAGGGAGAGGGAGG + Intergenic
1133742298 16:8660827-8660849 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1133964187 16:10519309-10519331 GAGGGAGAGGAGGGAGGGGAGGG - Intergenic
1133964199 16:10519333-10519355 GAGGGAGAGGAGGGAGGGGAGGG - Intergenic
1133964217 16:10519365-10519387 GAGGGAGAGGAGGGAGGGGAGGG - Intergenic
1134064522 16:11219220-11219242 GAGGCTGAAGAGTGAGAGGAAGG - Intergenic
1134449462 16:14354353-14354375 GAGGGGGAGTAGGGGGAGGAGGG + Intergenic
1134717728 16:16365256-16365278 GAAGGTGCCCACGGAGCGGAAGG - Intergenic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1134878247 16:17721396-17721418 GATGGGGAACAGGGAGATGAAGG - Intergenic
1134957024 16:18386903-18386925 GAAGGTGCCCACGGAGCGGAAGG + Intergenic
1135110318 16:19685903-19685925 GAAGGAGAGGAGGGAGAGGAAGG - Intronic
1135147425 16:19974758-19974780 GAGGGAGGGCAGGCAGAGGAAGG + Intergenic
1135161729 16:20102516-20102538 GAGGAAGACAAGGGAGAGGAGGG - Intergenic
1135180079 16:20265279-20265301 GAGGGTGGAGAGGGGGAGGAGGG - Intergenic
1135517652 16:23149104-23149126 GAGGGCGAGGAGGGCGAGGAAGG + Exonic
1135528820 16:23234949-23234971 GAGGGTTATCAGGGAAAGGAAGG - Intergenic
1135538214 16:23310984-23311006 GAGGGAGTCCAGGGAGTGAATGG + Intronic
1135639884 16:24110133-24110155 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135639887 16:24110142-24110164 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135907463 16:26525954-26525976 GATGATGACAATGGAGAGGAGGG - Intergenic
1135942757 16:26836546-26836568 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1136414628 16:30095887-30095909 GAGGGTCACCTAGGAGGGGAGGG + Exonic
1136493218 16:30624562-30624584 GGGGCTGCCCAGGAAGAGGAGGG + Intergenic
1137557076 16:49477335-49477357 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1137701909 16:50503552-50503574 GAGGTTGCCGAGGGAAAGGAGGG + Intergenic
1137776877 16:51062710-51062732 GAGGTTGAACAGGCAGAGCATGG - Intergenic
1138028041 16:53538518-53538540 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028044 16:53538527-53538549 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028047 16:53538536-53538558 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028050 16:53538545-53538567 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138142760 16:54582905-54582927 GAGGGCGAGCCGGGAGGGGAAGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138490244 16:57372398-57372420 GAGGGTGGGAGGGGAGAGGAAGG - Intergenic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1139380859 16:66529797-66529819 GAGGGACAGCAGGGAGAGGGAGG - Intronic
1139460254 16:67116492-67116514 GTGGGTGACAAGAGAAAGGAAGG - Intronic
1139941695 16:70610248-70610270 GAGAGGGATCTGGGAGAGGAGGG + Intronic
1139993895 16:70962181-70962203 GAGGGGGACAAGGGAGATGGAGG + Intronic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1140595550 16:76405660-76405682 GAGGAGGAGGAGGGAGAGGAGGG + Intronic
1140993903 16:80242524-80242546 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993906 16:80242533-80242555 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993909 16:80242542-80242564 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141797465 16:86285053-86285075 GAGGTTGAACAGGGAGCCGATGG - Intergenic
1142151150 16:88513066-88513088 GAGGGTGACCAGTGTGAGCGGGG - Intronic
1142265929 16:89063966-89063988 GTGGGTGACCAGGGTGGGGATGG - Intergenic
1142355548 16:89599886-89599908 GAGGGACAGCAGGGACAGGATGG + Intergenic
1142396113 16:89832611-89832633 GAGGGTGCCCAGGGACAGTGAGG - Intronic
1142546546 17:707952-707974 GAGGCTGAGGAGGGAGAGCAAGG - Intronic
1142913372 17:3113610-3113632 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1142913375 17:3113619-3113641 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1143104239 17:4520426-4520448 GGGGGTGACGAGGGACTGGAGGG - Intronic
1143119785 17:4599595-4599617 GAGGGTGACCAAGGTGACCAGGG - Intronic
1143245872 17:5485736-5485758 CATGGTGACTAGTGAGAGGAAGG - Intronic
1143297662 17:5883449-5883471 GAGGATGGGAAGGGAGAGGAAGG - Intronic
1144047321 17:11465671-11465693 GAGTGAGATCAGGCAGAGGAGGG - Intronic
1144613531 17:16746858-16746880 AAGGGAGAGAAGGGAGAGGAGGG - Intronic
1144613534 17:16746867-16746889 GAGGGAGAGAAGGGAGAGAAGGG - Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1144752088 17:17655933-17655955 GAGGGAGAGAAGGGAGGGGAGGG + Intergenic
1145133201 17:20376932-20376954 GAGGGAGGGGAGGGAGAGGAGGG - Intergenic
1145762477 17:27433710-27433732 GACAGTGGCCAGGGTGAGGATGG - Intergenic
1145920431 17:28605272-28605294 GAGGGAGACCATGGAAAGGAGGG + Intronic
1145920443 17:28605317-28605339 GAGGGAGACCGTGGAAAGGAGGG + Intronic
1146295300 17:31645374-31645396 GAGGCAGAGCAGGGCGAGGAGGG + Intergenic
1146411501 17:32589526-32589548 AAGTGTGACAGGGGAGAGGAAGG + Intronic
1146944862 17:36866736-36866758 GAGGGTGAGCTGGGAGGGGCAGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147278244 17:39336956-39336978 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1147376143 17:40023437-40023459 TAGGGTGGGGAGGGAGAGGAGGG + Intronic
1147662117 17:42122361-42122383 GTGGGTGGTCAGGGAGAGGTAGG + Exonic
1147677530 17:42218476-42218498 GTGAGAGTCCAGGGAGAGGATGG + Intronic
1147688511 17:42301107-42301129 GTGAGAGTCCAGGGAGAGGATGG - Intronic
1147970757 17:44218452-44218474 GGGGGTCACGAGGAAGAGGAGGG - Intronic
1148341770 17:46877524-46877546 GAGGTTGAACAGGGAGACAACGG + Intronic
1148352385 17:46950358-46950380 GAGGGTGAGGATGGAGAGAAGGG + Intronic
1148530624 17:48387328-48387350 GAGAGTGCACAGGGATAGGAGGG - Intronic
1148744911 17:49912735-49912757 GAGGGCGTCGAGGAAGAGGAGGG - Intergenic
1148828393 17:50412019-50412041 GATGGTGACCATGGAAAGGGAGG - Intergenic
1148851747 17:50559025-50559047 AAGGGCAACCAGGGAGACGACGG + Intergenic
1149262963 17:54899678-54899700 GATGGTGACTAGGGAGACGAAGG - Intronic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1149625972 17:58081521-58081543 GAAGGGGAGCAGGGAGAGGGAGG + Intergenic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1150456120 17:65308206-65308228 GGGGGTGGGCAGGGAGAGGGAGG + Intergenic
1150506246 17:65701834-65701856 GAGGGAGAACAGAGAGAGTAGGG - Intronic
1150635265 17:66908662-66908684 GACGGTGACCAGGACCAGGATGG + Intergenic
1150699738 17:67436500-67436522 TAGGGAGGCCAGGGAGGGGAAGG + Intronic
1150780438 17:68116957-68116979 GAGGGAGACCGTGGAGAGGGAGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151431140 17:74064066-74064088 GAGGGTGGGAAGGGAGAGGAGGG + Intergenic
1151475622 17:74342983-74343005 GAGGGTGACCGGGGTGGGGCTGG - Intronic
1151501808 17:74494823-74494845 GAGGATGCCCAGGGAGAGAATGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152099814 17:78294465-78294487 GAGTGTGACCATGAAGAGCAGGG + Intergenic
1152328577 17:79657161-79657183 GAAGGAGAGAAGGGAGAGGATGG + Intergenic
1152461163 17:80443275-80443297 GAGGGTGCCCAGGCACAGCAGGG + Intergenic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152726986 17:81952337-81952359 GAGGGAGAGGAGGGAGGGGAGGG + Intergenic
1152727028 17:81952440-81952462 GAGGGAGAGGAGGGAGGGGAGGG + Intergenic
1153777121 18:8463944-8463966 GAGGGTTGGCAGGGAGAGCAAGG + Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1154396180 18:13991620-13991642 GAGGAGGACAAGGGAGAGGCTGG + Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155399210 18:25419774-25419796 TATGGTGACCAGGGAGGGAAGGG - Intergenic
1156463230 18:37333335-37333357 GAGGGAGAGGGGGGAGAGGAGGG - Intronic
1156463233 18:37333344-37333366 GAGGGGGAAGAGGGAGAGGGGGG - Intronic
1156463242 18:37333362-37333384 GAGGGGAAGAAGGGAGAGGAGGG - Intronic
1156495749 18:37524302-37524324 GAGGGTGACAAGGTGGAAGAAGG + Intronic
1156504157 18:37578249-37578271 TAGGATGGACAGGGAGAGGAGGG + Intergenic
1156528031 18:37786470-37786492 GAGGGTGGCAGGTGAGAGGAGGG - Intergenic
1156688830 18:39681843-39681865 GTGGGTGGGCAGGCAGAGGAAGG + Intergenic
1157503953 18:48212895-48212917 CAGGCTGGCCAGGCAGAGGAGGG - Intronic
1157563440 18:48664148-48664170 GAGGAAGGCCAGGGAGAGCAAGG - Intronic
1157742475 18:50105958-50105980 GAGGGTGACTAGGGTGGGTAGGG - Intronic
1158107663 18:53904236-53904258 GAGACTGAACAGGGAGAGAAAGG - Intergenic
1158307823 18:56125812-56125834 GAAGATGAAGAGGGAGAGGAAGG + Intergenic
1158345935 18:56517286-56517308 AAGGGTGACCATGGAGAGAATGG - Intergenic
1158559711 18:58503843-58503865 GAGGGAGGGGAGGGAGAGGAAGG - Intronic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1158876935 18:61742984-61743006 GAAGGTGGCCAGGGAAAGGAAGG + Intergenic
1159095851 18:63900718-63900740 AATGGGGACCAGGGACAGGATGG - Intronic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159915389 18:74183153-74183175 GAGCGGGAAGAGGGAGAGGAGGG - Intergenic
1160147234 18:76375563-76375585 CCCGGAGACCAGGGAGAGGATGG + Intronic
1160500990 18:79400933-79400955 GAGGGTGACTGTGGGGAGGAAGG - Intronic
1160585707 18:79912130-79912152 GAGTGGGAGCAGGGAGGGGACGG + Intronic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1160769002 19:821982-822004 GAGGGGGACGGGGGAGGGGAGGG + Intergenic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1160819843 19:1052695-1052717 GAGGAGGAGGAGGGAGAGGAGGG + Intronic
1160965268 19:1744608-1744630 GAGGGTGAGAAAGGGGAGGAAGG - Intergenic
1161022244 19:2015795-2015817 GAGGGGGAGGAGGGAGGGGAGGG + Intronic
1161238958 19:3211269-3211291 GAGGGAGAGGAGGGAGGGGATGG + Intergenic
1161258889 19:3324701-3324723 AAGGGAGGGCAGGGAGAGGATGG - Intergenic
1161378343 19:3951266-3951288 GAGGCTGACCAGGGGGACGGGGG + Intergenic
1161405624 19:4089756-4089778 GCGGGGGGACAGGGAGAGGATGG + Intergenic
1161415694 19:4145326-4145348 GAGGATGACGGGGGAGTGGAAGG + Intergenic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161718373 19:5890116-5890138 GAGGGAGGGGAGGGAGAGGAGGG + Intronic
1161803496 19:6429334-6429356 AAGGGGGAAGAGGGAGAGGAGGG + Intronic
1161810476 19:6468433-6468455 GGGGGTGTCCTGGGTGAGGATGG + Exonic
1162012110 19:7823543-7823565 GAGGGAGAAAAGGGAAAGGAAGG + Intergenic
1162237701 19:9321718-9321740 GAGGGTGGCAGGGGGGAGGAGGG - Intergenic
1162469646 19:10864791-10864813 GAGGGGGCCAAGGGAGAAGAGGG + Intronic
1162538347 19:11277465-11277487 GAGGGAGACCATGGAGAGAGAGG + Intergenic
1162789102 19:13053929-13053951 GGAGGTGTCCAGGGAGTGGATGG - Intronic
1163020121 19:14477233-14477255 GAGGGTGATCAGGGAAAGGCGGG - Intergenic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1163557102 19:17999031-17999053 GGAGGTGACCTGGGTGAGGAAGG + Exonic
1163645245 19:18485529-18485551 CAGGGAGACCAGGGAGACCAGGG + Intronic
1163904167 19:20137296-20137318 GAGGGAGACCGTGGAAAGGAGGG - Intergenic
1164291910 19:23877150-23877172 GAGGGGGCCCAGGCAGAGGCTGG + Intergenic
1164400147 19:27896518-27896540 GAGTGTGACTAGTGAGAGGCAGG + Intergenic
1164611132 19:29632442-29632464 GAGGGTGACCACAGAAAGGCAGG - Intergenic
1164683201 19:30149708-30149730 GGTGGTGGGCAGGGAGAGGAGGG - Intergenic
1164874101 19:31671114-31671136 GAGGTTGTCCTGGGTGAGGAGGG - Intergenic
1165072828 19:33265436-33265458 TACAGTGGCCAGGGAGAGGAAGG + Intergenic
1165331021 19:35141283-35141305 GAGGGGGGCTAGGGAGAGGCGGG - Intronic
1165393787 19:35552997-35553019 GAGGGAGCCCAGGGATGGGATGG + Intronic
1165406048 19:35631916-35631938 GACAGTGAGCAGGGAGAGAAGGG - Intronic
1165698330 19:37918180-37918202 GAGGGTGAGCAGGGGGACTAAGG + Intronic
1165783407 19:38446786-38446808 GGGAGAGACCAGGGAGAGGCTGG + Intronic
1165832754 19:38737313-38737335 GAGGATGACGAGGATGAGGAAGG - Exonic
1166193844 19:41193654-41193676 GTGGGGGACCAGGGCTAGGAGGG + Intronic
1166200033 19:41231361-41231383 GTGGGTTCCCAGGGAGAGGATGG - Intronic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
1166333163 19:42090339-42090361 GAGGGTGACAGGGTTGAGGAGGG + Exonic
1166359968 19:42249009-42249031 GAGGATGACGAGGCCGAGGAGGG + Exonic
1166774202 19:45302664-45302686 GCGGGTGACGAGGGTGCGGAAGG - Exonic
1166830789 19:45638628-45638650 GGGGGTGTCCTGGCAGAGGATGG - Exonic
1166832572 19:45647543-45647565 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1166832575 19:45647552-45647574 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1166859954 19:45804367-45804389 GAGGGCGACGAGGAGGAGGAAGG - Exonic
1167009393 19:46796728-46796750 GAGAGAGACCAGGAAGAGGCTGG + Intergenic
1167011847 19:46813741-46813763 GAGGGAGAGGAGGGAGAGGAAGG - Intergenic
1167138729 19:47634413-47634435 GAAAGTGGCCAGGTAGAGGAAGG + Intronic
1167163165 19:47780655-47780677 GTGGGGGATCGGGGAGAGGAGGG - Intronic
1167295560 19:48646902-48646924 GAGGGGGAGGAGGGAGAGGAGGG + Intergenic
1167295572 19:48646926-48646948 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1167385542 19:49160910-49160932 GAGGGTGATGAGGGAGAGAGGGG + Intronic
1167595130 19:50423503-50423525 GAGGGAGACCAGAGCCAGGAGGG + Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167600390 19:50451425-50451447 GAGGATGAGTGGGGAGAGGAAGG + Intronic
1167607367 19:50488586-50488608 GAGGGGGCCCCGGGAGAGGGAGG + Exonic
1167619602 19:50553410-50553432 GCGAGTGAGCAGGGGGAGGAGGG - Intronic
1167645505 19:50703183-50703205 GAAGCTGAACAGGAAGAGGATGG - Intronic
1167686506 19:50960039-50960061 GAGGAGGAGGAGGGAGAGGAGGG + Intronic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1167765518 19:51479697-51479719 GAGGGTGCAGATGGAGAGGAGGG + Intronic
1168110204 19:54188180-54188202 GAGGGAGGAGAGGGAGAGGAGGG - Intronic
1168317567 19:55490746-55490768 TGGGGTGAGCAGGGAGGGGACGG - Intronic
1168332579 19:55578858-55578880 GAGGGCGAACAGGAAGGGGAAGG - Exonic
1202699976 1_KI270712v1_random:157027-157049 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
925174642 2:1773851-1773873 TAGGGTGACAAGTGACAGGAAGG - Intergenic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925410117 2:3635040-3635062 GACGGTGACAAGGGCCAGGAGGG - Intronic
925538414 2:4940591-4940613 GATGGGGAGAAGGGAGAGGAAGG + Intergenic
925902045 2:8515818-8515840 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
925905122 2:8535539-8535561 GAGAAAGTCCAGGGAGAGGAAGG + Intergenic
925913308 2:8587295-8587317 GGAGGTGACCAGGGAGCCGAGGG - Intergenic
925957047 2:8977030-8977052 GATGGAGGCCAGGGAGAGGCAGG + Intronic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926184741 2:10680306-10680328 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
927550952 2:23998831-23998853 GAGGCTGAGGAGGGAGACGAAGG - Intronic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
928402269 2:30987713-30987735 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
928409248 2:31041666-31041688 GAAGGTGAGCAGGGAGGGGAAGG + Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929947887 2:46384010-46384032 GAGGCAGACCAGGGAGTGGCAGG - Intronic
930486746 2:52019746-52019768 GAGGGCCAGCAGGGAGAGAAAGG + Intergenic
930997087 2:57733016-57733038 GAGGGTGACGAGGGAGAGCTGGG + Intergenic
931040037 2:58287242-58287264 GAGGGTGAGTAGGGTGAGTAGGG + Intergenic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931285303 2:60827249-60827271 GGAGGTGACCAGGCAGAGAAAGG - Intergenic
931432104 2:62216360-62216382 GAGGGAGGCCTGGGGGAGGAGGG + Intronic
932287163 2:70545186-70545208 GAAGGAGACCAAGGAGATGAAGG + Intronic
932805539 2:74779744-74779766 GACGGTCACCTGGGAGAGGCTGG - Intergenic
933260470 2:80126336-80126358 GAGGATCATTAGGGAGAGGAGGG - Intronic
933279148 2:80313523-80313545 GAGCAAGACCAGGTAGAGGAAGG + Intronic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
934036025 2:88088955-88088977 GAAGGTGAGCAGGCTGAGGACGG + Intronic
934056121 2:88252995-88253017 GAGGGAGACGAGGGAGGGAAGGG - Intergenic
934107856 2:88712506-88712528 GAGGGTGAACTGTGAGAGCAAGG - Intronic
934170908 2:89540502-89540524 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
934281213 2:91614820-91614842 GAAGGTAGCAAGGGAGAGGAAGG + Intergenic
934653259 2:96104215-96104237 GAGGGGGAAGAGGGAGGGGATGG - Intergenic
934662937 2:96152849-96152871 TGGGGTGACAGGGGAGAGGAGGG - Intergenic
934702169 2:96451325-96451347 GAGGGTGAGGAGGGAGTGAAAGG - Intergenic
935111777 2:100100855-100100877 AAGGAAGACCAGGGAGTGGAGGG + Intronic
935245636 2:101216690-101216712 GGAGGTGCCCAGGGAGAGCATGG - Intronic
935885707 2:107617142-107617164 AAGGGTACCCAGGTAGAGGATGG + Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936123188 2:109764313-109764335 AAGGAAGACCAGGGAGTGGAGGG - Intergenic
936155282 2:110042962-110042984 GAGGGGGCCCCTGGAGAGGAGGG - Intergenic
936189398 2:110328451-110328473 GAGGGGGCCCCTGGAGAGGAGGG + Intergenic
936221494 2:110607156-110607178 AAGGAAGACCAGGGAGTGGAGGG + Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936577341 2:113667772-113667794 GAAGGTGAGCAGAGAGAGGGTGG + Intergenic
936855119 2:116948358-116948380 GAGGGGAAGGAGGGAGAGGAGGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937062639 2:118991854-118991876 AAGGGAGACCAGGGAGTGAAAGG + Exonic
937228195 2:120381835-120381857 AAGGGTGACCAGGGAGCAGCCGG + Intergenic
937241441 2:120464995-120465017 GTGGGGGATCAGGGAGAGGGAGG + Intergenic
937286534 2:120757692-120757714 GAGGGAGACCAGGGTAAGAAGGG - Intronic
937320943 2:120960376-120960398 GAGGGCGAGCAGGGAGAGGTGGG + Intronic
937337811 2:121072511-121072533 ATGGGAGCCCAGGGAGAGGATGG - Intergenic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
938178726 2:129160911-129160933 AAGGGAGTCCAGGGAGATGAAGG + Intergenic
938287609 2:130130328-130130350 GAGGGTGACGAGAGGGAGCAGGG + Intergenic
938292981 2:130160146-130160168 GAGGGTGACCAGCGAGACCCAGG - Intronic
938317822 2:130342148-130342170 GAGGGTGACAAGGAAGAAGGTGG - Exonic
938427985 2:131208531-131208553 GAGGGTGACGAGAGGGAGCAGGG - Intronic
938478966 2:131643482-131643504 GAGGGGGAAAAAGGAGAGGAAGG - Intergenic
938683704 2:133716786-133716808 GAAGGTGACCAGGAAAAGTATGG - Intergenic
938836064 2:135105250-135105272 GAGGGAGACCATGGAGAGAGGGG - Intronic
938901569 2:135802720-135802742 GAGGGAGGACAGGGAGAGGTTGG + Intronic
938990138 2:136619416-136619438 GAGGGTGAAGAGTGAGAGGAGGG - Intergenic
939045475 2:137245056-137245078 GAGGGAGACGAGGAGGAGGAGGG - Intronic
940479698 2:154212683-154212705 GGAGGGGAACAGGGAGAGGAAGG - Intronic
940645758 2:156391475-156391497 GAGGATGAACAGGGATAAGAGGG - Intergenic
942113066 2:172701034-172701056 GAGGGAGAGGAGGGAGAAGAGGG + Intergenic
942321340 2:174739170-174739192 CTGGCTGGCCAGGGAGAGGATGG - Intergenic
942450750 2:176106881-176106903 GAGGGGGAAGAGGGGGAGGAAGG - Intronic
943575891 2:189630776-189630798 GAGGGTGAGTGGGGAGAGAATGG - Intergenic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
945219387 2:207468589-207468611 GAGAGTGCCCAGGGAGGGCATGG - Intergenic
945235070 2:207625613-207625635 GCGGGTGCACAGGGAGAGCATGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946408040 2:219502596-219502618 GAGATTGACCAGGGGGAGGGGGG + Intronic
946552845 2:220822547-220822569 GAAGGGGATCAGGGAGAAGAAGG - Intergenic
946866947 2:224049557-224049579 GAAGGTGGCTAGGGAGAGGTTGG - Intergenic
946972007 2:225104134-225104156 GAGGCTGAATAGGAAGAGGAGGG - Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
947713656 2:232329538-232329560 GAGGGGGACCCTGGAGAGCAGGG - Intronic
947733098 2:232441776-232441798 GAGGGGGACCCTGGAGAGCAGGG - Intergenic
947796269 2:232896025-232896047 GAGGGTGACGGGGAAGAGGAAGG - Intronic
947865931 2:233397732-233397754 GAGGGTGAACTGGAAGGGGAGGG + Intronic
947997887 2:234544189-234544211 GAGGATGACCTTGGAGAGGGTGG + Intergenic
948205081 2:236159334-236159356 GAGCCTGACCAGGCCGAGGAAGG - Intergenic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
948629671 2:239294048-239294070 GAGGGTGGGCTGGGAGACGATGG - Intronic
948802717 2:240440145-240440167 GAGGGTGTCCGGGGAGAGGGGGG - Intronic
948836824 2:240629895-240629917 GAGAGTGAGCAGGGGGAGCAAGG - Intronic
1168814796 20:728924-728946 GTGGGGGTCCAGGGAGATGAGGG + Intergenic
1168888821 20:1280499-1280521 GAGGCTGACAAGGCAGAGGTCGG + Intronic
1169074077 20:2750834-2750856 GAGGTTGACCTGGGGAAGGAAGG + Intronic
1169129344 20:3156757-3156779 GAGGGGGGCCAGGCAGAGGAAGG + Intronic
1169253908 20:4083093-4083115 GAGGGGGGCGGGGGAGAGGAGGG + Intergenic
1169253918 20:4083111-4083133 GAGGGGGGCGGGGGAGAGGAGGG + Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170592053 20:17778595-17778617 GAGGGAGACCATGGAGAGAGAGG - Intergenic
1170809014 20:19659069-19659091 GACTGTGAACATGGAGAGGAGGG + Intronic
1171250650 20:23643886-23643908 GAGGAGGAGCAGGGAGAGTAGGG - Intergenic
1172427147 20:34863182-34863204 GGTGGTGACTTGGGAGAGGAAGG - Intronic
1172429216 20:34876332-34876354 GGGTGTGACAAGGGAGAGGGTGG - Intronic
1173044456 20:39496243-39496265 GGGGGTGTGAAGGGAGAGGATGG + Intergenic
1173080764 20:39865004-39865026 GAGGGTGATGAGGGTGAGGTGGG - Intergenic
1173413125 20:42832359-42832381 GAGGGTGGAGAGGGAGAGGAGGG + Intronic
1173450008 20:43155524-43155546 GATGGTTAGCAGGGAGAGGATGG + Intronic
1173662929 20:44746344-44746366 AAAGGAGACCAGGGAGACGAGGG - Intronic
1173727800 20:45309113-45309135 GGGGGTGAGGAGGGAGGGGAAGG - Intronic
1173751799 20:45482265-45482287 GAGGGGGAGGATGGAGAGGAAGG - Intergenic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1174066053 20:47866838-47866860 GAGGCTGAGCAGGGAGACCAGGG - Intergenic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174339280 20:49886061-49886083 GAGGATGGCCGGGGAGGGGAGGG - Intronic
1174353477 20:49983652-49983674 TTGGGTGACCTGGGCGAGGAGGG + Intronic
1174451883 20:50625687-50625709 GAGGGAGACCTGGCTGAGGAGGG + Intronic
1174552174 20:51369968-51369990 GAGGGGGACCAGGGAGACTGTGG - Intergenic
1175038571 20:56023698-56023720 GAGGGTGAAGAGGGTGAGGAGGG + Intergenic
1175120143 20:56710778-56710800 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1175181051 20:57147951-57147973 GAGGGTGACATGGCAGAGGAGGG - Intergenic
1175301106 20:57943374-57943396 GCTGGTGAACAGGAAGAGGAAGG - Intergenic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1175594753 20:60222046-60222068 GGGGGTGAACTGGCAGAGGAGGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175831604 20:61967700-61967722 GAGGGGGAAAAGGGAGGGGAGGG - Intronic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1175883456 20:62274031-62274053 GAGGGCCACCAGAGACAGGAGGG - Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176672203 21:9745158-9745180 GAGGGAGAGTAGGGAGAGAAAGG + Intergenic
1176720429 21:10388192-10388214 GAGGGAGAAGAGGGAGAAGAAGG + Intergenic
1176723564 21:10412585-10412607 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1177204227 21:17993360-17993382 GAGGGTGATGGGTGAGAGGAGGG - Intronic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178534163 21:33398893-33398915 GATGGAGAGCAGGGTGAGGAGGG - Intergenic
1178879877 21:36441008-36441030 GAGGGTGAGGGGTGAGAGGAGGG - Intergenic
1179413442 21:41179397-41179419 GAGGGTGTCCAGGGTGAGTGAGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1179716874 21:43292996-43293018 GAGGGAGAACAGGGAGGGAATGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180008384 21:45033839-45033861 GAGGGCCACGTGGGAGAGGACGG - Intergenic
1180129258 21:45816464-45816486 GAGGGGGAGGAGGGAGAGGGAGG - Intronic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1180304723 22:11065357-11065379 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1180792720 22:18585323-18585345 GAGGTTGAGCAGGCAGAGCACGG + Intergenic
1180984608 22:19897035-19897057 GAGGGTGAGCTGGCAGTGGACGG - Intronic
1181174084 22:21026238-21026260 AAAGGTGACCTGGGAGAGGCAGG - Exonic
1181229016 22:21409996-21410018 GAGGTTGAGCAGGCAGAGCACGG - Intergenic
1181249635 22:21524869-21524891 GAGGTTGAGCAGGCAGAGCACGG + Intergenic
1181711871 22:24696206-24696228 GAGGGGGAGGAGGGAGAGAAGGG - Intergenic
1181711873 22:24696215-24696237 GAGGGGGAAGAGGGGGAGGAGGG - Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1181883376 22:25999528-25999550 GAGGGGGAAGAGGGGGAGGAGGG - Intronic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182142040 22:27967788-27967810 GAGGCTGGCCAGGGTGAGGAGGG - Intergenic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182662165 22:31932961-31932983 GAGGGAGACCAGGAAGGGGCGGG + Intergenic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183310965 22:37109338-37109360 GAGGGTGATCAGTGAGCAGAAGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183378420 22:37478592-37478614 GAGGGTGCCCCAGGAGGGGAAGG + Intronic
1183668327 22:39257624-39257646 GATGGAGAGCTGGGAGAGGAGGG + Intergenic
1183683981 22:39350995-39351017 ACGGGTGGTCAGGGAGAGGATGG + Intronic
1183735639 22:39643419-39643441 GGGGCTGGCCAGGAAGAGGAGGG - Intronic
1183950314 22:41349014-41349036 GGGGGTGCCCAGGGAGAGCCTGG + Intronic
1183951114 22:41353669-41353691 GAGGCTGACCAGGGTGTGGCAGG + Intronic
1183986640 22:41573917-41573939 GAGGGTGCGTTGGGAGAGGAGGG + Intronic
1184037705 22:41926412-41926434 GAGGCTGGCCGGGGAGGGGAGGG + Intronic
1184406407 22:44303219-44303241 GGGTGCCACCAGGGAGAGGATGG - Intronic
1184445674 22:44545489-44545511 GAGGGTGACCAGGGTCAAGGTGG - Intergenic
1184514969 22:44956245-44956267 GAAGCTGAGCAGGAAGAGGAAGG + Intronic
1184691079 22:46117549-46117571 GAGGTGGACCAGGAAGGGGAAGG + Intergenic
1184935684 22:47718704-47718726 GAGGCTGGGCAGGGAGAGCAGGG - Intergenic
1184942632 22:47780433-47780455 GAGGGTGAGCAAGGTGAGGCAGG - Intergenic
1185046157 22:48529639-48529661 GAGGGTGTCCAGGCAGGAGATGG + Intronic
1185171544 22:49297422-49297444 AAGGGTGACGAGGGCGAGGCGGG + Intergenic
1185397628 22:50600914-50600936 GGGGGTGCGCAGGGAGCGGAGGG - Intronic
949455607 3:4235217-4235239 AAGGGGGATAAGGGAGAGGAAGG + Intronic
949493420 3:4610282-4610304 GAGTGTCATCAGGGAGAGGGAGG - Intronic
949879716 3:8651833-8651855 GATGGTGAAGAGGCAGAGGAGGG - Intronic
950187037 3:10951688-10951710 GATGGGGAGGAGGGAGAGGAGGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
951677787 3:25261732-25261754 GTAGGTGACCAGGGAGATGAAGG - Intronic
951912889 3:27769754-27769776 GATGGTGATCAGAGACAGGAAGG - Intergenic
952106155 3:30071509-30071531 GAGGGGGAAGAGTGAGAGGAGGG + Intergenic
952538376 3:34338310-34338332 TAGGGTGGACAGGGAAAGGAGGG + Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953666621 3:44930306-44930328 GGGGGTGAGCAGGGAGGGGAAGG + Intronic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954048175 3:47951326-47951348 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
954109822 3:48427766-48427788 GAGGCTCCCCAGGGAGAGGATGG - Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
954133102 3:48569968-48569990 GAGGAGGATCAGGGGGAGGAGGG + Intronic
954443959 3:50536623-50536645 GAGGCTGAGCAGGGAGTGGGTGG - Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954569898 3:51631979-51632001 GAGGCTGAGAAGGGAGAGGAGGG - Intronic
954608937 3:51934130-51934152 TAGGGTGACCTGGGGGAGGGTGG - Intronic
954805662 3:53218520-53218542 GAGAATGAGCAGGGAGAGCAGGG + Intergenic
955056246 3:55458439-55458461 GAGGGTGGGGAGGCAGAGGATGG - Intergenic
955286657 3:57647890-57647912 GAGAGTGAGCAGGGTAAGGAGGG + Intronic
955286809 3:57649757-57649779 GAGAGTGAGCAGGGTAAGGAGGG - Intronic
956518351 3:70076215-70076237 GAGGGTGGCGTGGGAGAAGAAGG + Intergenic
956674542 3:71722007-71722029 GAGAGTGACAAGGGAGAAAAGGG + Intronic
956849706 3:73217730-73217752 GAGGGAGAAAAGGGAGGGGAGGG - Intergenic
957040076 3:75329721-75329743 GAGGGAGAGCAGGGGAAGGAGGG - Intergenic
957629539 3:82701570-82701592 GGGGGTGGCGAGTGAGAGGAGGG - Intergenic
958136738 3:89503647-89503669 GAGGGTGGTAGGGGAGAGGAGGG + Intergenic
959591820 3:108090651-108090673 GAAGACGACCAGGGAAAGGAAGG + Intronic
960015191 3:112879411-112879433 GAGGATGAAAAGTGAGAGGAGGG - Intergenic
960388471 3:117050022-117050044 GAGGGAGACGAGGGAGAGGAGGG - Intronic
960595892 3:119407659-119407681 GTGGGTGACCAAGGAGAGGTTGG + Intronic
961044862 3:123701263-123701285 GAGGGAGAGCAGGGGAAGGAGGG - Intronic
961086375 3:124071082-124071104 GAAGGTGATCAGGAAGGGGAGGG + Intergenic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961514537 3:127424522-127424544 GTGTGTGAACAGGGAGAGGGAGG - Intergenic
961514542 3:127424549-127424571 GTGTGTGAACAGGGAGAGGGGGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961537256 3:127577715-127577737 GGGGGTGAGAAGGGAGAGGAAGG - Intronic
961703475 3:128765321-128765343 GATGGTGAGGAAGGAGAGGAAGG - Intronic
961827304 3:129605902-129605924 GCGCGTGTCCAGGGAGCGGATGG + Exonic
961829908 3:129618122-129618144 GAGGGTGGTCAGGCAGAGGAGGG + Intergenic
961936589 3:130591065-130591087 GAAGGCTACCTGGGAGAGGAGGG + Exonic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
963076251 3:141349120-141349142 GAGGGAGAAAAGGTAGAGGAGGG - Intronic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
963949450 3:151182806-151182828 GGAGGTGCCCAGGGAGCGGATGG + Intronic
964546014 3:157834658-157834680 GAGCTTAGCCAGGGAGAGGATGG - Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
966542370 3:181106437-181106459 GAGGCACTCCAGGGAGAGGAAGG - Intergenic
966724496 3:183097495-183097517 GAGGATGAGGAGGGCGAGGACGG - Intronic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
967016216 3:185484202-185484224 GATGCTGAGCAGGGATAGGAAGG + Exonic
967035419 3:185645631-185645653 AAGGGAGAGAAGGGAGAGGAAGG + Intronic
967374319 3:188783554-188783576 GAGGGTGGAGGGGGAGAGGAGGG + Intronic
967553806 3:190831446-190831468 GAGGGGGCCCTGGAAGAGGAGGG - Intergenic
967972858 3:195012150-195012172 CAGGGTGGCCAAGGACAGGAGGG + Intergenic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968460656 4:723289-723311 GAGGTCCACCGGGGAGAGGAGGG + Intronic
968512316 4:1001121-1001143 GGGGGTGACAAGGGATAGGTTGG + Intronic
968577776 4:1375957-1375979 GGGGGTGGGGAGGGAGAGGAGGG + Intronic
968591414 4:1461514-1461536 GAGGGTGAACAGGGAACAGAGGG + Intergenic
968605195 4:1532108-1532130 GAGGGTGACCGGAGAAAGGGAGG + Intergenic
968626399 4:1628323-1628345 GAGGGTGGCATGGGAGAGGGTGG + Intronic
968844367 4:3031758-3031780 GGGTGTGACCAGGGAGAGAGTGG + Intronic
968889287 4:3359175-3359197 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
968890345 4:3365360-3365382 GAGGGAGACAGGTGAGAGGAGGG + Intronic
968944635 4:3657251-3657273 GAGGGGGACCAGGGGAGGGAGGG - Intergenic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
968963694 4:3758683-3758705 GAGGGGGAAGAGGAAGAGGAGGG + Intergenic
969028864 4:4195377-4195399 GAAGGTGGCAAGGGAGAGGAAGG - Intronic
969138539 4:5050507-5050529 GAGAGAGACCAGGTAGGGGACGG + Intergenic
969255191 4:5996537-5996559 GAGGTTGACCAGGCAGAGGGTGG - Intergenic
969454757 4:7294806-7294828 GAGGGGGAGGAGGGAGAGGAGGG - Intronic
969454769 4:7294830-7294852 GAGGGGGAGGAGGGAGAGGAGGG - Intronic
969454828 4:7294987-7295009 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
969454831 4:7294996-7295018 AAGGGGGAGGAGGGAGAGGAGGG - Intronic
969454859 4:7295065-7295087 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
969508504 4:7603136-7603158 GAGGGAGACCATGGAGAGAGAGG + Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
970734742 4:19152638-19152660 GAGGGTGAAGGGTGAGAGGAGGG - Intergenic
971084145 4:23250628-23250650 GAGGAGGAGGAGGGAGAGGAAGG + Intergenic
971570938 4:28209992-28210014 GAGGGGGAAGAGGGGGAGGAAGG - Intergenic
971633795 4:29031232-29031254 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
972307349 4:37844364-37844386 GAGCGTGAACAGGGAGACAAAGG + Exonic
972720094 4:41687871-41687893 GTGGGAGAACAGGGAGAGAAAGG - Exonic
972728031 4:41763519-41763541 GAGAGTGAAGAGTGAGAGGAGGG + Intergenic
973673359 4:53239412-53239434 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
973953595 4:56041067-56041089 GAGGTTGAGCAATGAGAGGAAGG - Intergenic
974330805 4:60475783-60475805 TAGGGTGACCATTGAGAGGGAGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975452363 4:74544148-74544170 GAGGGTGGACAGGGAGAGACTGG + Intergenic
975603253 4:76125692-76125714 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975655927 4:76641316-76641338 GAGGATGAGCAGGGAGAAGATGG - Intronic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
975756980 4:77580755-77580777 GAGGGGAAGGAGGGAGAGGAGGG - Intronic
976221928 4:82762958-82762980 GAGGGGGACCAGGAAGGCGATGG - Intronic
976757219 4:88511494-88511516 GGGGGTGAGGAGGGACAGGAGGG + Intergenic
976775168 4:88698918-88698940 GGGGGTGAGGAGGGTGAGGAAGG - Intronic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
978459972 4:108940627-108940649 CAGGGTGACCAAGGACAGGCAGG - Exonic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
980156259 4:129110661-129110683 GAAGGCAAACAGGGAGAGGAAGG - Intronic
980254167 4:130355392-130355414 GAGGGGGTACAGGGAGGGGATGG - Intergenic
980333019 4:131434305-131434327 GAGGGTCAGCGGGGAGAGGAGGG - Intergenic
981439543 4:144767801-144767823 GAGGGTGAAGGGTGAGAGGAGGG + Intergenic
981444787 4:144823131-144823153 GAGGGTGGAGAGCGAGAGGAGGG - Intergenic
981528795 4:145733168-145733190 GAGGCGGACCGGGGAGGGGAGGG - Intronic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
981629109 4:146797638-146797660 CAGGGTGAGGTGGGAGAGGAAGG - Intronic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
982695828 4:158599269-158599291 GTGAGGGACCAGGAAGAGGAGGG - Intronic
983081242 4:163387607-163387629 GAGGGTGTCAGGGGAGGGGAAGG + Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
984307465 4:178013580-178013602 GAGGCTGAGAAGGGAAAGGAAGG + Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984634635 4:182097635-182097657 CAGGGTGACCCAGGAGAGAAGGG - Intergenic
984778561 4:183504793-183504815 GAGGGTGACTGGGGACAGGCGGG + Intergenic
985177388 4:187215807-187215829 GAGGGTGCTGAGGGAGATGATGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985402530 4:189606690-189606712 GAGGGAGAGTAGGGAGAGAAAGG - Intergenic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
985511901 5:318078-318100 GAGGGTGAGGGGGGAGATGAAGG - Intronic
985574196 5:665951-665973 GACGGTGAGCAGGGCGGGGATGG - Exonic
986166301 5:5274345-5274367 GAGGATGAACAGGCAGAGCATGG - Intronic
986287119 5:6367512-6367534 GAGCTTGTCCAGGGAGAGGGTGG + Intergenic
986541969 5:8853874-8853896 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987146326 5:14994296-14994318 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987784129 5:22477236-22477258 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
987906020 5:24078303-24078325 GAGGAGGAGTAGGGAGAGGAGGG + Intronic
988402649 5:30781384-30781406 GTGGGGGACCAGGGGCAGGATGG + Intergenic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
988992077 5:36680951-36680973 GAGGATGACCAGGGTTGGGAAGG + Intronic
990807857 5:59686845-59686867 GGGAGTTACCAAGGAGAGGATGG + Intronic
991045225 5:62215483-62215505 GATGGTTACCAGGGACTGGATGG - Intergenic
991175673 5:63685155-63685177 GAGGGAGAAAAGGAAGAGGAAGG - Intergenic
994094417 5:95835912-95835934 GAGGGTGCCGAGGCTGAGGATGG + Intergenic
994222859 5:97216597-97216619 GTCAGTGACCAGGGAGAAGAGGG - Intergenic
994423159 5:99547804-99547826 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
994573210 5:101540037-101540059 AAGGGTGAAGAGTGAGAGGAGGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995682414 5:114734760-114734782 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
996070263 5:119123377-119123399 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
996139056 5:119882347-119882369 GAGGGTAACAGGGGAGATGATGG + Intergenic
996700026 5:126441451-126441473 GAAGGTGACAAAGTAGAGGACGG - Intronic
996844722 5:127886483-127886505 GAGGAGGACGAGGAAGAGGAGGG - Intergenic
997615921 5:135246146-135246168 GAGAGTGAGCAGGGAGGGGCAGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998307771 5:141096292-141096314 GATGGAGACCAGGGAGGCGAGGG - Exonic
998310318 5:141123491-141123513 GATGGAGACCAGGGAGGCGAGGG - Exonic
998313448 5:141157494-141157516 GATGGAGACCAGGGAGGCGAGGG - Intergenic
998314939 5:141174331-141174353 GATGGAGACCAGGGAGGCGAGGG - Exonic
998315516 5:141179533-141179555 GATGGAGACCAGGGAGGCGAGGG - Exonic
998316058 5:141184055-141184077 GATGGAGACCAGGGAGGCGAGGG - Exonic
998316613 5:141188814-141188836 GATGGAGACCAGGGAGGCGAGGG - Exonic
998317247 5:141194048-141194070 GATGGAGACCAGGGAGGCGAGGG - Exonic
998317920 5:141201270-141201292 GATGGAGACCAGGGAGGCGAGGG - Exonic
998318876 5:141210403-141210425 GATGGAGACCAGGGAGGCGAGGG - Exonic
998321432 5:141236050-141236072 GATGGAGACCAGGGAGGTGAGGG - Intergenic
998322005 5:141241412-141241434 GATGGAGACCAGGGAGGCGAGGG - Intergenic
998387504 5:141766232-141766254 GGTGGGGACCAGGGACAGGAAGG - Intergenic
998430401 5:142065340-142065362 GAGGGTGGAAAGGCAGAGGAGGG + Intergenic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
999000599 5:147918481-147918503 GGGGCTGAGCAGGGAGGGGAAGG + Intergenic
999102336 5:149036879-149036901 AAGGGTGAGAATGGAGAGGAAGG - Intronic
999240840 5:150126538-150126560 GAGGATGATAAGGGAGATGATGG + Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999646125 5:153718710-153718732 GTGGGGGACCAGGGATAGGGTGG - Intronic
999695131 5:154182058-154182080 GAGGCTGACCAGGTACAGGTGGG + Intronic
999712690 5:154332431-154332453 GAGGGCGTTCAGGCAGAGGAAGG - Intronic
999771989 5:154782819-154782841 GCTGGTGACCAAGGTGAGGAGGG + Intronic
1000021954 5:157325840-157325862 GAGGCTGACAAGGCATAGGAAGG - Intronic
1000332232 5:160214941-160214963 GATGGTGACCAGGGACAAGCTGG - Intronic
1000364227 5:160476307-160476329 CTGGGTGACCAGGGACAGGTGGG + Intergenic
1000447038 5:161334792-161334814 GAAGGAGACCCAGGAGAGGATGG + Exonic
1000721870 5:164718388-164718410 GAGGGTGAGGAGTGGGAGGAGGG - Intergenic
1001213866 5:169837065-169837087 GAAGGTGAGCTGGGAGTGGATGG - Intronic
1001597435 5:172907147-172907169 GAGGGAGACCAGGCAGGGGATGG - Intronic
1001753362 5:174147984-174148006 GAGGGTGGGCAGGGAGGGCAGGG + Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002394139 5:178940494-178940516 GGTGGGGACGAGGGAGAGGAAGG - Intergenic
1002965363 6:1960776-1960798 TAGGGTGACCGGGGATAGAAAGG + Exonic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003049375 6:2765905-2765927 GAGGGTGAGGAGGGCGACGACGG + Exonic
1003135008 6:3428254-3428276 GAGGGTGAGGAGGGGCAGGAAGG - Intronic
1003532213 6:6947128-6947150 GAGGGGGAGGAAGGAGAGGAGGG - Intergenic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1004205470 6:13587853-13587875 GAAGGTGAACTGGGGGAGGAAGG + Intronic
1004299936 6:14448388-14448410 GATGGTGACCAGGAAAAGTATGG - Intergenic
1004320672 6:14629037-14629059 GAGGGTGACCAAGGAAGGGAGGG - Intergenic
1004335869 6:14763962-14763984 GAGGAGGAGGAGGGAGAGGAGGG - Intergenic
1004365812 6:15011653-15011675 GAGGGTGGTGAGTGAGAGGAGGG + Intergenic
1004675784 6:17841013-17841035 GAAGGTGACCAGGAAAAGTATGG - Intronic
1004975508 6:20961439-20961461 GAGGGAGATCAGGGGGAGGTGGG + Intronic
1005695762 6:28351322-28351344 GAGGGTGTCCACGGTGGGGAAGG - Intronic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1006295594 6:33168722-33168744 AAGGGTGACCGAGGCGAGGATGG - Exonic
1006437813 6:34035317-34035339 GAAGGAGAACAGGGGGAGGATGG + Intronic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1007290548 6:40782909-40782931 GAGGATCAGCAGGGAGAGGAGGG - Intergenic
1007344324 6:41216830-41216852 GCGGGAGGCCAGGGACAGGAGGG + Intergenic
1007692103 6:43709120-43709142 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1008090047 6:47284491-47284513 GGAGATGACCAGGGAAAGGAGGG - Intronic
1008316084 6:50043007-50043029 GAGGGAGACTAGGTTGAGGAAGG - Intergenic
1009938661 6:70263269-70263291 GAAGGTGACCAGGGAGAACTCGG - Exonic
1010059270 6:71603917-71603939 GAGAGGGAGGAGGGAGAGGAGGG - Intergenic
1010717172 6:79243189-79243211 GAGGGAGAAAAGGGAGAGGCAGG + Intergenic
1011253568 6:85398775-85398797 GAGGGTGAAGGGTGAGAGGAGGG + Intergenic
1011695918 6:89912523-89912545 GGCGGTGACCAGGAAGGGGAGGG + Intergenic
1012404243 6:98876798-98876820 AAGGGTGGTGAGGGAGAGGACGG + Intronic
1012413174 6:98983436-98983458 GAGGGTGCCCAGGCAGGGGCAGG + Intergenic
1013422260 6:109977989-109978011 GAGGGTGAGCTGGGAGGGGAGGG - Intergenic
1014123273 6:117750407-117750429 GAGGGAGACCATGGAGAGAGAGG - Intergenic
1014136572 6:117896488-117896510 GAGGGATAGCAGGGAGAGGGAGG - Intergenic
1014709286 6:124787474-124787496 AAGGCTGACTAGGGAGGGGAAGG + Intronic
1015159709 6:130138949-130138971 GAAGATGTCCAGAGAGAGGAAGG + Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015728614 6:136325074-136325096 GAGAGTGAGAAGGAAGAGGAAGG + Intergenic
1015843736 6:137497238-137497260 GAGGGTGACCGAGGAGCGGAGGG - Intergenic
1015916178 6:138219403-138219425 GAAGGTGAGGAGGGGGAGGATGG + Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016731554 6:147433075-147433097 GAGGGTGGGTTGGGAGAGGAAGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017991974 6:159497794-159497816 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018757443 6:166862570-166862592 GAGCGTGGCCAGGGAAGGGAGGG - Intronic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1018996714 6:168715783-168715805 GATGGTGAGGAGGAAGAGGATGG + Intergenic
1019174165 6:170151621-170151643 GAGGCTGGCCCAGGAGAGGAGGG - Intergenic
1019476409 7:1246763-1246785 GAGGATGATTTGGGAGAGGAAGG + Intergenic
1019517421 7:1446182-1446204 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517478 7:1446326-1446348 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019517517 7:1446432-1446454 AAGAGTGAAGAGGGAGAGGAGGG + Intronic
1019531486 7:1505777-1505799 CAGGGTGACAAGGCAGAGGGAGG - Intergenic
1019537634 7:1537523-1537545 GAGGGTGACAGTGGAGAGGCTGG - Intronic
1019712193 7:2522795-2522817 GAGGGCTGTCAGGGAGAGGAAGG + Intronic
1020931702 7:14404932-14404954 GAGATTAACCAGGGAGAGGATGG - Intronic
1021614537 7:22488421-22488443 GAGGGTGACTAGGTAGGGCAAGG - Intronic
1022013712 7:26330452-26330474 GAGAGTTACCAGGGAGGGGCGGG + Intronic
1022075758 7:26968328-26968350 GAGGGTGGAGAGTGAGAGGAAGG - Intronic
1023047377 7:36222381-36222403 GAGGAGGACAAGGAAGAGGAGGG + Intronic
1023414414 7:39918703-39918725 GAAGGAGACCAGAGAGAGGGGGG - Intergenic
1023869522 7:44255558-44255580 GAGGGTGCGGAGGCAGAGGAGGG - Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024406292 7:48985231-48985253 GAGGGTGGAGGGGGAGAGGAGGG - Intergenic
1026794817 7:73359419-73359441 GAGGGTGACCAAGGTCAGGGAGG - Intergenic
1026868018 7:73835149-73835171 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868021 7:73835158-73835180 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868024 7:73835167-73835189 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868027 7:73835176-73835198 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026984278 7:74545240-74545262 GAGGGAGGCCAGGGTGAGGGTGG + Intronic
1027176867 7:75909644-75909666 GAGGGAGAGGAGGGAGAGGTGGG + Intronic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1027418755 7:77999571-77999593 GAGGGAGGGCAGGGAGAGGAGGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1029139516 7:98400476-98400498 GAGAGTGAACGGGGAGCGGAGGG + Intronic
1029350459 7:100009723-100009745 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029350476 7:100009784-100009806 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029380903 7:100213927-100213949 GAGGGTAACCCAGGGGAGGATGG + Intronic
1029420266 7:100468338-100468360 AAGGGTGTGAAGGGAGAGGAAGG + Intronic
1029469149 7:100742862-100742884 GACGGAGACGAGGGAGAGGGAGG + Intronic
1029514890 7:101018255-101018277 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1029514932 7:101018371-101018393 GAGGGAGTCCTGGGGGAGGAGGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031595056 7:123640630-123640652 GAGGGGGAGGGGGGAGAGGAGGG + Intergenic
1031595066 7:123640648-123640670 GAGGGGGAGGGGGGAGAGGAGGG + Intergenic
1031866136 7:127039998-127040020 GAGGGTGAGGAGGGAGGGGAGGG + Intronic
1031866144 7:127040016-127040038 GAGGGTGAGGAGGGAGGGGAGGG + Intronic
1032338161 7:131045455-131045477 GAGGATGGCTTGGGAGAGGAGGG - Intergenic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1033551477 7:142451819-142451841 CAGGGTCACCAGGGAGAGACGGG - Intergenic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1034520032 7:151612667-151612689 GAAGGTGAGCAGGCAGAGGTGGG - Intronic
1034645417 7:152642037-152642059 GGGGTTGGGCAGGGAGAGGAAGG - Intergenic
1034679199 7:152915789-152915811 GAGGGTGAGAAGGGGGAGAAGGG - Intergenic
1035022617 7:155808394-155808416 GAGGGCAGCCAGGGAGAGGGCGG + Intronic
1035027536 7:155835872-155835894 GAGGGTGACCTGGGCGTGGCTGG - Intergenic
1035100222 7:156389977-156389999 GAGGGAGAGAAGGGGGAGGAAGG - Intergenic
1035311329 7:157970849-157970871 GAGGGGGACCAGGGAGTGTCAGG - Intronic
1035368183 7:158361881-158361903 GAGGGGGATGAGGGAGAGGCAGG - Intronic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1035557849 8:579754-579776 GTGGGTGACCAGGCAGCGAATGG - Intergenic
1035574474 8:696084-696106 GATGGGGAGGAGGGAGAGGAAGG - Intronic
1035747773 8:1974140-1974162 GAGGGGGGACCGGGAGAGGAGGG + Intronic
1036378194 8:8218763-8218785 GTGGGAGCCCAGGCAGAGGAGGG - Intergenic
1036448745 8:8846333-8846355 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036744270 8:11392958-11392980 GACGGTGGACAGGGAGAGAATGG + Intronic
1036779747 8:11637845-11637867 GAGGGAGACCCTGAAGAGGAAGG + Intergenic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037574553 8:20188861-20188883 GTGGGTGACCAGGGAGTCTATGG + Intergenic
1037930648 8:22878199-22878221 GAGGGTGAGCATGGAGAGGGAGG + Intronic
1037952549 8:23028444-23028466 GAGAGAGAACAGGGAGAGGCAGG + Exonic
1038284955 8:26198475-26198497 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1038419484 8:27423308-27423330 GAGGGTGAAAAGGCAGGGGATGG - Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038646955 8:29369952-29369974 GCAAGTGACCAGGCAGAGGAGGG + Intergenic
1038895609 8:31778333-31778355 GGTGGTGACCAGAGAGAGGCTGG - Intronic
1039475737 8:37838595-37838617 GGGGGTGACCAGGAAGGAGAAGG - Intronic
1039803753 8:40981764-40981786 GTGGGTGAGTAGGGAGGGGAAGG + Intergenic
1039886174 8:41655183-41655205 GAGCGTCACCAGGGAGTCGAGGG + Intronic
1039893358 8:41699173-41699195 GAGGGGAGCCTGGGAGAGGATGG + Intronic
1040539550 8:48340040-48340062 GAGGGTGACAGGTGGGAGGAGGG - Intergenic
1040639786 8:49320140-49320162 GAGAAGGAGCAGGGAGAGGAGGG + Intergenic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1041066103 8:54084984-54085006 GAGGAAGAGGAGGGAGAGGAGGG - Intronic
1041116380 8:54541481-54541503 GAGGGTGAAGGGTGAGAGGAGGG + Intergenic
1041164648 8:55079273-55079295 GAAGGTGACCAGGAAAAGTAAGG - Intergenic
1041276019 8:56157909-56157931 GGGGGAGAGCAGGGAGAGGGAGG + Intergenic
1042039589 8:64577961-64577983 TTGGATGGCCAGGGAGAGGAGGG + Intergenic
1042061655 8:64824545-64824567 GAGACTGGTCAGGGAGAGGAGGG - Intergenic
1042807659 8:72789500-72789522 GAAGTTGACCAGGTAGAGAAGGG + Intronic
1042845873 8:73169190-73169212 GACGGTGGCCAGGGAGGGGATGG - Intergenic
1043445316 8:80313844-80313866 GAGGATGAAGTGGGAGAGGAGGG - Intergenic
1044778159 8:95715526-95715548 GAGGGAGGCAAGGGAGAGAATGG - Intergenic
1044794685 8:95885011-95885033 GTCTGTGACCAGGAAGAGGATGG - Intergenic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045711689 8:104992177-104992199 TAGGGTGAGAAGTGAGAGGAAGG - Intronic
1046146118 8:110160802-110160824 GAGGGAGAGGAAGGAGAGGAGGG + Intergenic
1046146121 8:110160811-110160833 GAAGGAGAGGAGGGAGAGGAGGG + Intergenic
1046146122 8:110160820-110160842 GAGGGAGAGGAGGGAGAAGAAGG + Intergenic
1046239516 8:111472328-111472350 GAGGGTGGAGAGGGAGAGGAGGG + Intergenic
1047303394 8:123634172-123634194 GAGGAAGAGGAGGGAGAGGAAGG + Intergenic
1047402535 8:124558662-124558684 CAGGGGGACCAGGGAGAGTGGGG + Intronic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1048306917 8:133290880-133290902 GAGGTTGCCCCGGGAGAGGCTGG + Intronic
1048852688 8:138659705-138659727 GAGGGTGTCCCAGGAGATGAGGG + Intronic
1048856860 8:138693680-138693702 CAGGGTGCCAAGGGACAGGAAGG - Exonic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1048966496 8:139618651-139618673 GAGGACGACCAGGTTGAGGAAGG + Exonic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049656570 8:143801632-143801654 CAGGGTGACAACGGAGAGCAAGG + Intronic
1049785628 8:144449332-144449354 GGGGGCGGCCAGGGTGAGGATGG + Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1051107591 9:13597588-13597610 GAGGGTGAGAAAGGAGAGAAAGG + Intergenic
1051681390 9:19611371-19611393 GAGAGAGATGAGGGAGAGGAAGG + Intronic
1051814497 9:21089064-21089086 GAGGAGGAGAAGGGAGAGGAAGG - Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1052994523 9:34544120-34544142 GAGGCAGAAGAGGGAGAGGAAGG + Intergenic
1053209031 9:36211958-36211980 GAGGGAGAGGAGGAAGAGGAAGG + Exonic
1053316781 9:37058813-37058835 GAGGCAGACCAGGGAGCTGAAGG - Intergenic
1053360278 9:37481658-37481680 AGAGGTGACCAGGAAGAGGAGGG + Intergenic
1053594195 9:39543612-39543634 TAGGGTGCCCTGGCAGAGGAGGG - Intergenic
1053654050 9:40197578-40197600 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053851975 9:42298658-42298680 TAGGGTGCCCTGGCAGAGGAGGG - Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054366165 9:64343794-64343816 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054572058 9:66821345-66821367 TAGGGTGCCCTGGCAGAGGAGGG + Intergenic
1054673795 9:67833524-67833546 GAGGGTGACGAGGAGGAGAAGGG + Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1055580739 9:77703864-77703886 GAGGGAGATGAGGGAGACGAGGG + Intergenic
1055824474 9:80307066-80307088 GAGGGAAGCGAGGGAGAGGAAGG - Intergenic
1056869656 9:90265526-90265548 GAGGGTTATCAGGGTAAGGATGG - Intergenic
1057047021 9:91893781-91893803 GAGTGTGGCAGGGGAGAGGATGG - Intronic
1057279869 9:93701678-93701700 GACTGAGACCAAGGAGAGGATGG - Intergenic
1057360404 9:94368436-94368458 GAGGGTGACAAGGAAAAAGAGGG + Intergenic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1057662938 9:97019642-97019664 GAGGGTGACAAGGAAAAAGAGGG - Intergenic
1058153375 9:101486371-101486393 GAGGGCGACTGGGCAGAGGAAGG - Intronic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058419533 9:104820755-104820777 GAGGGTGGCGGGGGAGAGGATGG + Intronic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058677171 9:107410196-107410218 GAGGCAGTCCAGGGAGAGGCTGG + Intergenic
1058768920 9:108211600-108211622 GTTGGGGAACAGGGAGAGGAAGG - Intergenic
1058835511 9:108855869-108855891 CAGGGTGACCCTGGAGAGGCAGG - Exonic
1059277652 9:113109350-113109372 GAGGGGGATCAGGAACAGGAAGG + Intergenic
1059278599 9:113115201-113115223 GAGGGGGATCAGGAACAGGAAGG - Intergenic
1059409733 9:114124383-114124405 GAGGGGGAGGAGGGAGAGGAAGG + Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1060072575 9:120563197-120563219 AAGGGTGTCCAGGCAGAGGGTGG + Intronic
1060197898 9:121635095-121635117 GAGGGTGGCTATGGAGTGGAGGG + Intronic
1060214437 9:121730221-121730243 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060445159 9:123680878-123680900 GAGGCTGACCAAGTCGAGGAAGG + Intronic
1061086892 9:128404778-128404800 GGGGGGGACCAAGGGGAGGAGGG + Intergenic
1061275783 9:129568866-129568888 GAGGGGGAGGAGGGAGAGGCCGG + Intergenic
1061618193 9:131793902-131793924 GAGGGAGGGCAGGGAGAGGTGGG + Intergenic
1061781152 9:132996733-132996755 GAGGCTGCTCAGGGAGGGGAGGG + Intergenic
1061967631 9:134025238-134025260 GAGGAGGAGCTGGGAGAGGAGGG - Intergenic
1062105498 9:134752781-134752803 GAGGGTGGCCAGGGGGACCAGGG + Intronic
1062198296 9:135286872-135286894 GAGGGAGGCCTGGGGGAGGATGG - Intergenic
1062337600 9:136079244-136079266 GGGGGAGACCAGGGAGAGGCAGG + Intronic
1062361921 9:136192412-136192434 GATGGTGAGGAGGGAGAGGAGGG + Intergenic
1062499848 9:136847624-136847646 GAGGGCGAGCTGGGAGAGGGAGG - Exonic
1062562447 9:137147712-137147734 GAGGGAGACCAAGGAGAGGGAGG + Intronic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1062625087 9:137438899-137438921 GAGGGTGGCACGGGAGAGGCAGG - Intronic
1062658327 9:137615372-137615394 GAGGGTGCCCAAGGCGAGGCCGG - Exonic
1062671445 9:137712204-137712226 AGGGGTGACCAGGGAGAGAAGGG - Intronic
1203780427 EBV:97519-97541 GAGGGTGATGACGGAGATGACGG + Intergenic
1185672214 X:1821846-1821868 GGGGAAGACCATGGAGAGGAGGG + Intergenic
1186045507 X:5532560-5532582 GAGGGAGACAAGGGAGAGAGAGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186900771 X:14053124-14053146 GAGGAGGAAGAGGGAGAGGAGGG + Intergenic
1187255480 X:17637949-17637971 TAGGCTTACCAGGGATAGGATGG + Intronic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1187565625 X:20446830-20446852 GAGGCTGGCAAGTGAGAGGAAGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1190778778 X:53577485-53577507 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1190803183 X:53811990-53812012 GAGGGTGGGAAGTGAGAGGAAGG - Intergenic
1191976503 X:66877762-66877784 GAGTGGGAGAAGGGAGAGGAGGG - Intergenic
1192133140 X:68571696-68571718 GTGTGTGAGCAGGGAGGGGATGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192425380 X:71070331-71070353 GATGGTGACAATGGAGAGGAGGG + Intronic
1192503005 X:71665512-71665534 GAGGATGAAGAGGGAGAGGAGGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192529335 X:71872022-71872044 GAGGGTGAAAAGGGAGAGGAGGG + Intergenic
1192554435 X:72078636-72078658 GAGGGTGACCTTGGCAAGGATGG - Intergenic
1193350726 X:80462026-80462048 GAGGGTGGAAAGTGAGAGGAGGG - Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1194257902 X:91656871-91656893 GAGGGTGTAGAGTGAGAGGAAGG - Intergenic
1194712515 X:97252901-97252923 GAGACTGTTCAGGGAGAGGAGGG + Intronic
1194918318 X:99731789-99731811 GAGGGTGAAGGGTGAGAGGAAGG + Intergenic
1195117035 X:101709558-101709580 GAGGGAGATAAGGGAGAGGGAGG - Intergenic
1195257698 X:103105257-103105279 GAGGGAGACCATGGAAAGGGAGG + Intergenic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1195888791 X:109670611-109670633 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1195944241 X:110192103-110192125 GAGAGTGAAAAGGGAGAGGTTGG - Intergenic
1196025045 X:111033306-111033328 GAGGAGGAGGAGGGAGAGGAGGG - Intronic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196332210 X:114485685-114485707 GAGGGTGGGCGGGGTGAGGAGGG - Intergenic
1196665300 X:118309644-118309666 GAGGGTGCCTAGGAAGAAGAAGG - Intergenic
1196731095 X:118942252-118942274 GAGGGGGAGAAGGGAGAGAATGG + Intergenic
1196780690 X:119381473-119381495 GAGGCTGCCCAGGGAAAGCATGG - Intergenic
1197642645 X:128984028-128984050 GAGGGTGAAGGGTGAGAGGAAGG + Intergenic
1197870666 X:131059491-131059513 GAGGGGAAGCAGGGAAAGGAGGG + Intronic
1197893392 X:131287394-131287416 GAGGGTGAAGAGGGAGTGAAGGG - Intronic
1198242024 X:134796589-134796611 GAGGGGGGAAAGGGAGAGGAAGG + Intronic
1198556761 X:137802326-137802348 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198746469 X:139896252-139896274 GAGGAAGACCAGGGAGGTGAAGG - Intronic
1199462825 X:148102416-148102438 GAGGGTGCAGAGTGAGAGGAGGG + Intergenic
1199474512 X:148230980-148231002 GAGAGGGAAGAGGGAGAGGAAGG - Intergenic
1199498918 X:148487643-148487665 GAGGATGAAGAGGAAGAGGAGGG - Intergenic
1199629833 X:149769863-149769885 GGGGGGGACCAGGGAGTGGGGGG + Intergenic
1199842615 X:151665498-151665520 GATGGAGACCAGGATGAGGAAGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200234441 X:154461508-154461530 GAGGGTGAAGAGGCAGAGGATGG - Exonic
1201146325 Y:11067197-11067219 GGGGGAGGGCAGGGAGAGGAAGG + Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic