ID: 1186720388

View in Genome Browser
Species Human (GRCh38)
Location X:12297502-12297524
Sequence GTGGGAAAAAACAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 473}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186720388 Original CRISPR GTGGGAAAAAACAGAATTGT GGG Intronic
902543862 1:17173863-17173885 GTGGGAGATAATTGAATTGTGGG + Intergenic
904089485 1:27934886-27934908 GGGGCAAACAACAGAATTGCCGG - Intergenic
904867634 1:33593596-33593618 GTGGGAAGAACCTGAATTATGGG - Intronic
905768076 1:40619869-40619891 GAGGGAAAAGACAGAATCCTGGG + Intergenic
906039116 1:42773534-42773556 GTGAGAAAAAACTAAACTGTGGG - Intronic
907722258 1:56983176-56983198 GTGGGAAAGAACAGGCTTGGTGG + Intergenic
907722724 1:56987048-56987070 GTGGGAAAGAACAGCCTTGGTGG - Intergenic
907995243 1:59624774-59624796 GTGGGAAACAACTGAATCATGGG - Intronic
908050534 1:60225084-60225106 GTGGGAAAGAACAGATTTATGGG - Intergenic
908627104 1:66057753-66057775 GTGGGAAATAACTGAATCATGGG - Intronic
908637485 1:66184304-66184326 GTTTGAAGAAACAGAATTATAGG + Intronic
908642493 1:66240859-66240881 GTGGGAAAAGACTGAGGTGTGGG + Intronic
908860064 1:68474556-68474578 GTGTGAAAAAGCCTAATTGTGGG - Exonic
908901698 1:68963541-68963563 GTGGGAGATAATTGAATTGTGGG + Intergenic
910308641 1:85797517-85797539 GGGGGAAATAATAGAATTTTGGG + Intronic
910309230 1:85804713-85804735 GTGGGAGATGACTGAATTGTGGG - Intronic
910711573 1:90187415-90187437 GTGGCTAACAACAGAAATGTCGG - Intergenic
911407690 1:97463212-97463234 GTGGGAGATAACAGAATCATGGG + Intronic
912030042 1:105228733-105228755 GTGGGAAATAACAGAATCTTGGG + Intergenic
912031950 1:105258846-105258868 GAGGGAACAAATAGAATTTTGGG - Intergenic
912228203 1:107760626-107760648 GTGGGAAATAACAGAACAGCTGG - Intronic
912306352 1:108571494-108571516 GTGAGGAAAAACAGAACAGTAGG + Intronic
912316255 1:108669762-108669784 GTGGGAAACTACCGAAATGTAGG + Intergenic
913192972 1:116429230-116429252 GAGGGACAAAACAGAATTCCTGG - Intergenic
913414003 1:118584635-118584657 GGGGGAAAAGTCAGAATTCTTGG - Intergenic
914437886 1:147676214-147676236 GTAGGAAAAAAGAGACTTATTGG - Intergenic
914673435 1:149889335-149889357 GAGAGAAAAAATAGACTTGTGGG + Intronic
916209271 1:162346443-162346465 AAGGAAAAAAATAGAATTGTGGG + Intronic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916646451 1:166790634-166790656 GGTGGAAAGAACAGCATTGTTGG - Intergenic
917333062 1:173902409-173902431 AAGGGAAAAAACAGACTGGTAGG - Exonic
918064889 1:181093607-181093629 GTGGGAAAAAAGAGAATAAAGGG + Intergenic
919490784 1:198202778-198202800 GTGGGAAATAACTGAATCATGGG - Intronic
919608337 1:199714128-199714150 TTGTCAAAAAACAGATTTGTAGG - Intergenic
919917351 1:202147024-202147046 GTGGGAAAATAAAGACTTCTTGG - Exonic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920748239 1:208649179-208649201 GTGGGAGATAATTGAATTGTAGG + Intergenic
920836067 1:209512333-209512355 GTGTGAAAAAACAGAATACAAGG - Intergenic
922189759 1:223307919-223307941 GGGGGAAAGAACAGAATTGGTGG - Intronic
923892020 1:238226616-238226638 GTGGGAGAAAACTGAATCATGGG - Intergenic
923908899 1:238417443-238417465 GTGGGAAATAACTGAATCATGGG + Intergenic
1063577069 10:7271903-7271925 GTGGGAAATAACTGAATCATGGG - Intronic
1064402011 10:15029370-15029392 GTGGGAAATAACTGAATCATGGG - Intergenic
1064528865 10:16286210-16286232 GTGGGAGATAACTGAATTATGGG - Intergenic
1064566510 10:16645032-16645054 GGGGGAAAAAGCAGTCTTGTTGG + Intronic
1064846029 10:19654210-19654232 GTGGGAACAAACACATTTGATGG + Intronic
1065146172 10:22770648-22770670 GCTGGAAAAAAAATAATTGTGGG + Intergenic
1065460449 10:25957210-25957232 GTGGGAAGTAACTGAATCGTGGG + Intronic
1065561439 10:26968062-26968084 GTGGGAAGACACTGAAGTGTTGG - Intergenic
1065785718 10:29212395-29212417 GTAGGATGAAAGAGAATTGTAGG - Intergenic
1065864401 10:29901257-29901279 ACGGGAAAGAACAGATTTGTAGG + Intergenic
1065906915 10:30263092-30263114 GTGGGAGATAATTGAATTGTGGG + Intergenic
1066279739 10:33904515-33904537 GTGGGAAATAACTGAATCATGGG - Intergenic
1066319773 10:34290380-34290402 GTGAGAAATAACAGATTTCTAGG - Intronic
1068060874 10:52065697-52065719 GTTGGAAAAAATAGTATTTTTGG + Intronic
1068093579 10:52462701-52462723 GTGGGAAAAAACTGAAGTGCTGG + Intergenic
1068282300 10:54889992-54890014 GTGGAAAAATACAGAAATATTGG + Intronic
1068640544 10:59400411-59400433 GTGTCAAAAATCAGAGTTGTAGG + Intergenic
1068749066 10:60570570-60570592 GGGGAAAAAAACAGAAATGTGGG + Intronic
1069289590 10:66761239-66761261 GTGGGAACAATCAGCTTTGTAGG + Intronic
1070516951 10:77216996-77217018 GTGAGCAAAAACTGAATTTTTGG + Intronic
1071442230 10:85710173-85710195 TTGGAAAAAAACACAATTGAAGG + Intronic
1073606120 10:104897314-104897336 GTTGGAAAAGACAAAATTCTGGG - Intronic
1073675214 10:105638955-105638977 GTGCGAGATAACTGAATTGTGGG + Intergenic
1075089242 10:119434114-119434136 GTGGGAGATAATTGAATTGTGGG - Intronic
1075499196 10:122956680-122956702 GTGGGAGATAACTGAATGGTGGG + Intronic
1075772086 10:124947651-124947673 CTGGGAAAAAATAGATTTGAAGG - Intronic
1076266405 10:129112717-129112739 GTGGGAAAAAACAGGAGAGAAGG + Intergenic
1077719455 11:4612911-4612933 AGGGGAAAAAACAGGATTGATGG + Intergenic
1077928729 11:6708581-6708603 GTGGGGGAAAGCAGAAGTGTAGG - Intergenic
1078804287 11:14681354-14681376 GTGGGAAGTAATTGAATTGTGGG + Intronic
1079546795 11:21642995-21643017 GGAGGAAAAAACAGTTTTGTGGG + Intergenic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080426249 11:32157380-32157402 GTGGAAAAATTCAGAATTGCTGG - Intergenic
1080611488 11:33907846-33907868 GTGGGAAAAAATAGATTCATTGG - Intergenic
1081061798 11:38488413-38488435 GTGGGAGACAACTGAATTATGGG - Intergenic
1081363184 11:42205018-42205040 GTTAGAAAGTACAGAATTGTGGG - Intergenic
1083078068 11:60062231-60062253 GTGAGAATGAACAGAAATGTGGG + Intronic
1086804064 11:91217415-91217437 TTGGGAAAAAACAGCAGTTTTGG - Intergenic
1088715570 11:112546311-112546333 TTGGGAAAAGACAGAAGTGAAGG + Intergenic
1088778221 11:113107696-113107718 GTGGGAGATAATTGAATTGTGGG - Intronic
1090116009 11:123974680-123974702 GTTGAAAAAAAGAGAATAGTTGG + Intergenic
1091150547 11:133324494-133324516 CTAGGAAAAAACGGAATTCTGGG + Intronic
1091241758 11:134057616-134057638 GTGGGATAAAATAAAAATGTGGG - Intergenic
1091927345 12:4364979-4365001 GAGACAAAAAACAGAAATGTTGG - Intergenic
1092518052 12:9236628-9236650 GGGGGAAGAAACTGAATGGTAGG + Intergenic
1092613889 12:10198919-10198941 GTGGGAAATAGCACAATTCTGGG - Intergenic
1092653151 12:10656053-10656075 GTGGGAAATAACTGAATTATGGG + Intronic
1093474718 12:19542266-19542288 GTTGGACAAAACTGAATTGAGGG - Intronic
1093793073 12:23277905-23277927 GTGGGAGAAAACTGAATCATGGG + Intergenic
1093796164 12:23314796-23314818 GGGGGAAAAAAAAGAAATTTGGG + Intergenic
1094247911 12:28323516-28323538 GTGCAATAAAACAGAAATGTAGG - Intronic
1095111382 12:38297762-38297784 GTGGGAGATAATTGAATTGTGGG - Intergenic
1095759522 12:45813782-45813804 GTGGCAAAAAAAAATATTGTGGG + Intronic
1096035886 12:48469837-48469859 GTGGGAAGAGACAGTGTTGTGGG - Intergenic
1096928509 12:55176312-55176334 GTGGGAGATAATTGAATTGTGGG - Intergenic
1097018112 12:56001485-56001507 GGGGGAAAAAACAGTAATATAGG + Exonic
1097097834 12:56563900-56563922 GTGGGAATTAGCAGAAATGTTGG + Intronic
1098462041 12:70742690-70742712 CTGGAAAAAAACAGAATTCGAGG + Intronic
1098500143 12:71182830-71182852 GTAAGAAGAAACAGATTTGTTGG + Intronic
1098944438 12:76574016-76574038 GTGGGAAAAAATGGTTTTGTGGG - Intergenic
1099693340 12:85989953-85989975 ATGAGAAAAAGCAGAATTATGGG + Intronic
1099707827 12:86180014-86180036 GGAGGAAAAAACAGTTTTGTGGG + Intronic
1099937259 12:89141595-89141617 GTGGGAAATGACTGAATTTTTGG - Intergenic
1100069652 12:90697766-90697788 GTTTGAAAAAATAGCATTGTTGG - Intergenic
1100080927 12:90849156-90849178 GTGGGAGAAAATTGGATTGTGGG - Intergenic
1100175466 12:92025361-92025383 GGGGGAAAAAACACAATTATAGG + Intronic
1100573513 12:95866270-95866292 ATGGGAAAAAAAAGAATATTGGG - Exonic
1100927784 12:99569509-99569531 TTGGGAAAAAACTAAAATGTAGG + Intronic
1101661341 12:106768185-106768207 GTCAGTCAAAACAGAATTGTAGG - Intronic
1102077858 12:110074144-110074166 GTGGGGAAAATCAGATTTGCAGG + Intergenic
1102162296 12:110779296-110779318 GAGGGAAAAAAGAGAAATGGGGG + Intergenic
1103071174 12:117943804-117943826 GTGGGAAATAATTGAATCGTGGG + Intronic
1103216192 12:119203092-119203114 AAAGGAAAAAACAAAATTGTAGG - Intronic
1103979905 12:124730166-124730188 GTGGGAGAGAATTGAATTGTGGG - Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1105749953 13:23413565-23413587 GTGGGGAAAAAAAGGAATGTAGG + Intronic
1105950629 13:25226358-25226380 GTGGAAAAAAAAACATTTGTTGG - Intergenic
1106530692 13:30588498-30588520 GGGGGAAAAAACAGAATAATGGG + Intronic
1108129385 13:47280927-47280949 GTGGGAAACATCAAAATGGTTGG + Intergenic
1108221149 13:48233895-48233917 GTGGGAAACAACAGAGGTTTAGG - Intronic
1109414954 13:62026971-62026993 GAGAGAAAAAACAAAATGGTTGG + Intergenic
1110046401 13:70838409-70838431 GTGGGAGACAACTGAATCGTGGG + Intergenic
1110277979 13:73661054-73661076 GTGGGAGAGCACAGGATTGTGGG + Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1110340646 13:74386001-74386023 GTGGGAGATAACTGAATTATGGG - Intergenic
1110791576 13:79591953-79591975 GTGGGAGATAATTGAATTGTGGG + Intergenic
1111409073 13:87850879-87850901 GAGGTAAAAAACAGAAGTGAGGG + Intergenic
1111423368 13:88047236-88047258 GTTGGAAAATCCAAAATTGTAGG + Intergenic
1111820199 13:93204587-93204609 GTGGAAAAAAACAGCCTTGGTGG + Intergenic
1111901725 13:94207696-94207718 GTGGGAATATACATGATTGTGGG + Intronic
1112359733 13:98706532-98706554 GTGGGAGATAACTGAATCGTGGG + Intronic
1112809637 13:103203091-103203113 ATGGGAAAAACCAGAATACTTGG + Intergenic
1112861133 13:103830555-103830577 GTGGGAGATAACTGAATTATGGG - Intergenic
1113979579 13:114262854-114262876 GTGGGAGAGAACACAATTATTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114388699 14:22282815-22282837 GTGGGCATAAAAAGAAATGTTGG - Intergenic
1115143231 14:30197891-30197913 GTGGGAAATAACTGAATCATGGG + Intergenic
1115507976 14:34110879-34110901 GTGGGAAATAACTGAATCATGGG + Intronic
1115822493 14:37226549-37226571 GTGGGAGAAAATCGAATCGTGGG - Intronic
1117726211 14:58676956-58676978 GTGGGAAAAAAGAATATTGAAGG - Intergenic
1118228674 14:63927462-63927484 GTGGGAGATAATTGAATTGTAGG + Intronic
1118468666 14:66054771-66054793 GTGGGAGGTAACTGAATTGTGGG + Intergenic
1118527345 14:66661252-66661274 CTGGGACAAAACAGAGTTGCTGG + Intronic
1119683445 14:76610850-76610872 GTGGGACAAAATAGAATTCAAGG + Intergenic
1119966158 14:78917800-78917822 GTGTGAAAACACAGATTTGAGGG + Intronic
1120137109 14:80883249-80883271 GTGGGAAAAAACAAAATAAAGGG + Intronic
1120377902 14:83732952-83732974 GTGGGAAGCAACTGAATTATGGG + Intergenic
1120403020 14:84056056-84056078 GTGGTAAAAAACACAATAATGGG + Intergenic
1120574978 14:86170552-86170574 AAGGGAAAAAACATAATTATGGG + Intergenic
1120817458 14:88878105-88878127 TTAGGAAAAAACAGAATTGGTGG - Intronic
1121330070 14:93044191-93044213 GTGGGACAACAGAGAATGGTGGG + Intronic
1121659768 14:95626009-95626031 GTGGGAGATAACTGAATTATGGG - Intergenic
1122259980 14:100511134-100511156 GTTGAAAGAAACAAAATTGTTGG - Intronic
1122589198 14:102833990-102834012 GGGGGAAAAAAAAGAATATTTGG + Intronic
1122768788 14:104087880-104087902 GTGGGAAACAAGAGACTTGGAGG + Intronic
1123191211 14:106573650-106573672 GCGGGATAAAAAAGAATTCTTGG + Intergenic
1123736167 15:23185717-23185739 GAAGGAAAAAGCAGAATTGAAGG - Intergenic
1123789311 15:23704228-23704250 TTGGGAAATAATAGAAATGTTGG + Intergenic
1124286875 15:28408690-28408712 GAAGGAAAAAGCAGAATTGAAGG - Intergenic
1124295826 15:28502937-28502959 GAAGGAAAAAGCAGAATTGAAGG + Intergenic
1124550114 15:30672851-30672873 TTGGCAAAATACAGAATTCTGGG - Intronic
1125047027 15:35253625-35253647 ATGGGAGAAAGCAGAAATGTGGG - Intronic
1126047887 15:44660826-44660848 GTGGTAAAAAACAAAAATGTGGG + Intronic
1126325802 15:47475997-47476019 GTGAAAACAAAGAGAATTGTTGG + Intronic
1126710798 15:51453854-51453876 GTTGGTAAAAACAGAATTAAAGG + Intronic
1130922016 15:88355265-88355287 GTGGGAATAAAGAGGATTGGTGG - Intergenic
1131883117 15:96879741-96879763 GTGCAAAAAAAAAGTATTGTAGG - Intergenic
1132823807 16:1892523-1892545 GTGGAAAAAGACAGAATAGCTGG + Intergenic
1133580203 16:7137356-7137378 GTGGGAGATAATCGAATTGTGGG + Intronic
1133599785 16:7327983-7328005 GAAGGAAGAAACAGAAGTGTTGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1134232502 16:12439629-12439651 GTGGGAAATAACTGAATCATGGG - Intronic
1134431580 16:14213680-14213702 ATGGGAATAAACAGAAATGGTGG - Intronic
1135531019 16:23254754-23254776 TTGGGGAAAAACAGAAATGCAGG + Intergenic
1137339968 16:47591891-47591913 AGAGGAAAAAACAGAATTTTAGG - Intronic
1139042590 16:63015955-63015977 GTGGAAGATAACTGAATTGTGGG + Intergenic
1139221153 16:65183584-65183606 GTGGGAAAAAATAGAAAAGCAGG - Intergenic
1139501453 16:67369820-67369842 GTGGGAAGTAACTGAATTATGGG - Intronic
1140267976 16:73436521-73436543 GTGGGAGATAACTGAATCGTGGG - Intergenic
1140836902 16:78803140-78803162 GTGGAATAAATCAGAACTGTTGG - Intronic
1142310602 16:89310380-89310402 TTGAGAAAGAACAGAATTGGAGG - Intronic
1143047582 17:4094631-4094653 CTGGGGAAAAACAGGTTTGTGGG - Intronic
1143874926 17:9984414-9984436 GGGAGAGAAAACAGAATTGAGGG + Intronic
1145843077 17:28012817-28012839 GTGGGAAAGAAGAGAACTGGTGG - Intergenic
1146085554 17:29825113-29825135 GTAGGAAAATAAAGATTTGTTGG - Intronic
1147227649 17:38992308-38992330 GTAGCTAAAAACAGAATTGCTGG + Intergenic
1148513466 17:48193414-48193436 GTGGGAAAAAATGGGATTATAGG + Intronic
1148528067 17:48361732-48361754 GTGAGAAAGAACAGAAATGCTGG - Intronic
1148941860 17:51221378-51221400 GTGGGAAACAGCAGAACTCTTGG + Intronic
1149072335 17:52557317-52557339 GTGGGAAGTAAATGAATTGTGGG + Intergenic
1149594278 17:57854985-57855007 GTTAAAAAAAAAAGAATTGTAGG + Intergenic
1149787442 17:59448094-59448116 GTGGGAAAAAACAGTCGAGTAGG + Intergenic
1152152934 17:78614202-78614224 GTGGGAGATCACTGAATTGTGGG + Intergenic
1152160746 17:78667176-78667198 GTGGGAAATGACTGAAGTGTGGG - Intergenic
1152780123 17:82223756-82223778 GTGGGGAAAGAAAGAAGTGTGGG - Intergenic
1153036313 18:765730-765752 GTGGGAATAAACAGACTTTCAGG + Intronic
1153140118 18:1961958-1961980 AAGGGATAAAACAGAGTTGTTGG - Intergenic
1153874131 18:9351060-9351082 GAGCTAAAAAACAGAAATGTAGG - Intronic
1154403228 18:14062826-14062848 GTGGGACATAACACAATTATGGG - Intronic
1154404534 18:14077107-14077129 CTGGGAAAAAACAGATTTCATGG + Intronic
1155008046 18:21747039-21747061 GTAGGAAAAAACAGGATTTGAGG + Intronic
1155187703 18:23401929-23401951 GTAGGACCAAACAGACTTGTGGG + Intronic
1155230748 18:23772442-23772464 GTGGCAAACAACAGATTTGAGGG + Intronic
1155679192 18:28468738-28468760 GAAGGAAAAAAAAGAATTGAAGG + Intergenic
1155706994 18:28828339-28828361 GTAGGAAAAATCAGCAGTGTGGG - Intergenic
1157241317 18:46012246-46012268 ATGGGACAAAACAGCACTGTTGG + Intronic
1158525153 18:58206720-58206742 GTGAGAAGTAACAGAATTGCTGG + Intronic
1158590286 18:58773293-58773315 CTGGGAAATAGCAGAATAGTGGG - Intergenic
1159733707 18:72065500-72065522 GTGTGAAAAAACAGATTTGGGGG + Intergenic
1163375393 19:16927209-16927231 GTGGGAGATAACTGAATTATGGG + Intronic
1165722220 19:38087716-38087738 AAGGGAAAAAACAGCAGTGTTGG + Intronic
1168143724 19:54407174-54407196 TTGGGTAAAAGTAGAATTGTTGG + Intergenic
926252473 2:11163304-11163326 GTGGGATAGAACAGAATTGGTGG + Intronic
926557479 2:14376313-14376335 GTTGGAAAAAAAAGAGTTCTTGG - Intergenic
927252278 2:21007390-21007412 ATGGGAAAAAACAGGCTTGAAGG - Exonic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
929246225 2:39706615-39706637 AGGGGAAAAAAAAGAAATGTAGG - Intronic
929403501 2:41612847-41612869 GTGGGAGAAAACCGAGTTCTGGG - Intergenic
931099151 2:58975938-58975960 GGGGAAAAATACAGAATTGATGG - Intergenic
931839136 2:66130209-66130231 GTTGACAAAAACAGAATTGGAGG - Intergenic
932861930 2:75303281-75303303 GTGGGAAAAAATAGAAAGATTGG + Intergenic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
933619185 2:84517358-84517380 AAGGGAAAAAAAAGAATTGAGGG - Intronic
934157481 2:89216933-89216955 CTGGGAGACCACAGAATTGTAGG - Intergenic
934209839 2:89965810-89965832 CTGGGAGACCACAGAATTGTAGG + Intergenic
934636707 2:95996033-95996055 TTGGAAAAAAACAATATTGTAGG + Intergenic
935130214 2:100256189-100256211 TTAGGAAAAAGCAGTATTGTAGG + Intergenic
935387410 2:102514599-102514621 ATGGGAAGAAACATAATGGTAGG - Intronic
935465406 2:103390452-103390474 GTGGTAAAAAACAAAATCATAGG - Intergenic
935887847 2:107643071-107643093 GTGGGAGCTAACTGAATTGTGGG + Intergenic
935891519 2:107683922-107683944 GGGGGAAAAAAGAGATTTCTGGG + Intergenic
936831013 2:116647019-116647041 GGGGGAAAAAAAAGAAGTTTAGG + Intergenic
936905932 2:117535895-117535917 GTGGGAAAAATAAGAATAGAAGG - Intergenic
937695495 2:124804122-124804144 GTTGGAAAGCACAGAAATGTAGG - Intronic
938002762 2:127757662-127757684 TTGGGGGAAAACAGAATTCTGGG + Intronic
939207801 2:139130002-139130024 TTGGCAAAAAACAGTATTCTAGG - Intergenic
940920534 2:159300884-159300906 GTGGGAGAAAACAGAATACCTGG + Intergenic
941210317 2:162629450-162629472 GTGGGCTAAAATACAATTGTTGG + Intronic
941526948 2:166618153-166618175 GGGGGAAAAAATAGTTTTGTGGG + Intergenic
941601950 2:167553668-167553690 GTGGGAAAACACAGCAATTTAGG - Intergenic
942651547 2:178174201-178174223 GTGGGAAAAAACAGACTAGAGGG - Intergenic
942815531 2:180049343-180049365 CTTGGAAAAAATAAAATTGTGGG - Intergenic
943892879 2:193313112-193313134 GTGAAAAAGAACAAAATTGTGGG - Intergenic
944917677 2:204377763-204377785 GTGGGAGGAAACAGAATCATGGG + Intergenic
945133712 2:206602804-206602826 GTGCTAAAAGACAGAATTTTTGG - Intronic
945147050 2:206749158-206749180 GTGGGTAAAAAGAGAATTTGTGG - Exonic
947005585 2:225507716-225507738 GTGGGAAAAGACTTAAATGTAGG + Intronic
947349300 2:229225879-229225901 GTGGGAGATAACAGAATCATGGG - Intronic
947629155 2:231640695-231640717 TTGGGCACAAACAGAATTGCAGG - Intergenic
947789334 2:232854549-232854571 GGGGGAAGAAAAAGACTTGTGGG + Intronic
1169024851 20:2361454-2361476 GTGGAAAAAATAAGCATTGTGGG - Intergenic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170795232 20:19541358-19541380 GTGGGAAAAAAGAGAAGAGAAGG - Intronic
1172436558 20:34932712-34932734 CTGGGTAAAAAGAGAATTATGGG - Intronic
1172708284 20:36899653-36899675 GTGGGAAGAAAAAGAATTGCAGG + Intronic
1173366687 20:42392117-42392139 GAGGGAAAACACAGGCTTGTAGG - Intronic
1174181612 20:48678596-48678618 GTGGGAAACTACTGAATCGTGGG + Intronic
1174480096 20:50825219-50825241 AAAGGAAAAAACAGAACTGTAGG - Intronic
1174602681 20:51737605-51737627 GAGTGAAAAAAGAGAATTGTTGG + Intronic
1174969867 20:55262949-55262971 GAGGGAAAAAAGAGAAGGGTAGG - Intergenic
1175049294 20:56139146-56139168 GTGGAAAAAAACAGAAATAAGGG + Intergenic
1175474361 20:59260149-59260171 GTGACCACAAACAGAATTGTGGG + Intergenic
1175693918 20:61086954-61086976 GTGGGAAGTAACAGAATCATGGG - Intergenic
1177030081 21:15971835-15971857 GAGACAAAAAACAGAAATGTAGG - Intergenic
1177320889 21:19519054-19519076 CAGGGCAAAAACAGAAGTGTAGG - Intergenic
1177367469 21:20156115-20156137 GTGGGAAAAAACTAAATCATGGG + Intergenic
1177556003 21:22689461-22689483 ATGAAAAAAAACAGAATTGAGGG - Intergenic
1177639671 21:23830658-23830680 GGGTGAAAAAACAGAATTTAGGG - Intergenic
1177938395 21:27378731-27378753 GTGAATAAAAACAAAATTGTGGG - Intergenic
1177944403 21:27449220-27449242 GTGGGGAAGCACATAATTGTAGG - Intergenic
1178039533 21:28624447-28624469 GAGGATAAAAACAGAGTTGTGGG + Intergenic
1178562918 21:33655944-33655966 GAGAGAAAAAAGAGGATTGTAGG + Intronic
1179198676 21:39192333-39192355 GTGAGAAAATAGAGCATTGTGGG - Intronic
1179598194 21:42457602-42457624 GTGGGAGATAAGTGAATTGTGGG - Intergenic
1181361900 22:22343958-22343980 GTGGCAAAAACCACAAATGTTGG - Intergenic
1184576896 22:45376571-45376593 GTGACAAAAAAAAGAATTGCTGG + Intronic
949371343 3:3337883-3337905 GTGGCAAGAAACTGAATAGTAGG + Intergenic
949501792 3:4687044-4687066 CTGTGACAAAACAGAGTTGTGGG - Intronic
949599670 3:5584288-5584310 GTGTGAAGAAACAGAATAGGTGG + Intergenic
949697246 3:6713197-6713219 CTGGGAAAAAAAAGTATTGTAGG + Intergenic
950269996 3:11606224-11606246 GTGGGAGATAACTGAATCGTGGG - Intronic
950516722 3:13471295-13471317 GTGAGGCAAATCAGAATTGTGGG + Intergenic
951054917 3:18136436-18136458 GTGGGAGGTAACTGAATTGTGGG - Intronic
952204110 3:31162531-31162553 GTAGGAAATATCAGAATTGGAGG + Intergenic
952458972 3:33504525-33504547 TTGGGCTAAGACAGAATTGTAGG - Intronic
952625856 3:35402479-35402501 TTGGGAAAAGAAAGAATTGAAGG - Intergenic
954900115 3:54011970-54011992 GTGGGAAACAACTGAATCATGGG + Intergenic
955066365 3:55536707-55536729 GTGGGAAATAACTGAAGGGTAGG + Intronic
955342483 3:58135863-58135885 GTGGAAACAGACAGAATTGATGG - Intronic
955634290 3:61009040-61009062 GAGGGAAGAAACACAATTATTGG - Intronic
956541183 3:70341356-70341378 GTGGAAAAAAACAATATTCTTGG - Intergenic
957892740 3:86380910-86380932 GTGGCAAAAATCAGAATGTTTGG - Intergenic
958457237 3:94347332-94347354 GTGGGAAAGAACAGAAATTGGGG - Intergenic
959332872 3:105027850-105027872 ATGGGACAAAACAGAAATCTTGG + Intergenic
959756538 3:109906163-109906185 GGAGGAAAAAACAGTCTTGTGGG - Intergenic
959923668 3:111897615-111897637 TTGAGAAAAGACAGAATTTTAGG + Intronic
960055828 3:113275812-113275834 GGGGAAAAAAACAGAATAGAAGG - Intronic
960852045 3:122065836-122065858 GTTGGAAGAAACTGAATTGGGGG + Intronic
961063452 3:123853124-123853146 GAGAGAAAAAAAAAAATTGTGGG + Intronic
961637023 3:128339966-128339988 GTGGGAGATAATTGAATTGTAGG - Intronic
962157864 3:132967816-132967838 GTGGGAAATAATTGAATCGTGGG - Intergenic
963477457 3:145824877-145824899 GTGGGAGACAACTGAATTATGGG + Intergenic
963605119 3:147406658-147406680 GTGAGAAAAAAAAAAGTTGTGGG - Intronic
964383270 3:156119876-156119898 GTGTGAAAAAACAGAAGAGTGGG - Intronic
964802584 3:160571869-160571891 TTGGAGAAAAACAGAATTATAGG + Intergenic
965187213 3:165480685-165480707 TTGAGAAAAAACACACTTGTAGG + Intergenic
965396518 3:168165846-168165868 GTGGGAAACGACAGGATTTTAGG + Intergenic
967576004 3:191093934-191093956 CTGGGAAGAAACAGAAATGGTGG - Intergenic
967657039 3:192063125-192063147 GTGGGAAATAAGAAAATAGTGGG + Intergenic
967894915 3:194387912-194387934 GTGGGAATAAAAAGGAATGTGGG - Intergenic
968014673 3:195318951-195318973 GAGGGAAAAAATAGTATTGTGGG + Intronic
970627550 4:17905528-17905550 GTAGAAAAAAAAAGAAATGTTGG - Intronic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
971134641 4:23855005-23855027 GTGGGACATAACTGAATCGTGGG + Intronic
971705194 4:30032700-30032722 GTTGGAAAATACAGAAGTCTGGG - Intergenic
972227847 4:37034385-37034407 ATGGGAACAAATAGAATTGGTGG - Intergenic
972248353 4:37271180-37271202 GTGGGAAAAAATAGAGTGGATGG - Intronic
972667008 4:41175351-41175373 GTTGGAAAAAACAGAATATAGGG - Intronic
972864033 4:43208362-43208384 GGGGGAAAAAAGAGGAATGTAGG - Intergenic
973209067 4:47595219-47595241 GTGTAATAAAAAAGAATTGTGGG + Exonic
973538073 4:51904800-51904822 GTAGGAAAAAACAGATTTGAGGG - Intronic
973790276 4:54371906-54371928 GTGGGAAAGAAGAGCATTTTAGG + Intergenic
974912629 4:68141669-68141691 GGGGTAAAAAACAGAAATGAAGG + Intergenic
975172207 4:71245370-71245392 GAGGGCAAAGACAGAAGTGTGGG + Intronic
976026846 4:80698318-80698340 GTGGTACAAAACACAATTCTTGG - Intronic
977800280 4:101220938-101220960 GTGGCTAGAAACAGAATAGTTGG - Intronic
978358699 4:107905347-107905369 GTGGGAAATAACTGAATCATGGG - Intronic
978678265 4:111345555-111345577 GTGGGAAAAAACAAAACTTTAGG + Intergenic
979299571 4:119071153-119071175 GTAGGAAAAAGCAGATTTTTAGG + Intergenic
979899312 4:126198113-126198135 GTGGTAAAACACAGGATTATAGG - Intergenic
980324607 4:131324882-131324904 GTGGGAGATAACTGAATTATGGG + Intergenic
980513541 4:133824265-133824287 GTGGGAAAGAACTGAATCATGGG + Intergenic
981517854 4:145629854-145629876 GTGGGAAATGACTGAATTATGGG - Intronic
982114563 4:152086979-152087001 GGGGGAAGAACCAGAATTATTGG + Intergenic
982238488 4:153274555-153274577 GTGGGAAGAAATATAATTTTGGG + Intronic
983422289 4:167534318-167534340 ATAGGAAAACAAAGAATTGTTGG - Intergenic
983983766 4:174032341-174032363 GTAGGAAAAAAAAGAGTTGTAGG + Intergenic
984112948 4:175643009-175643031 GGGGGAAAAAAGAGAATTCAAGG - Intronic
984678057 4:182572665-182572687 GTAGAAAAAAACAAAATTGAAGG + Intronic
984921167 4:184765657-184765679 GTGGGAAAAAAAAGTATGGGTGG + Intronic
986901148 5:12435258-12435280 GTGGGAAATAATTGAATTATGGG - Intergenic
987494892 5:18630635-18630657 GAGGGAAAAAATAGTTTTGTGGG - Intergenic
987509342 5:18815490-18815512 GAGGAAAAAAACAGTTTTGTGGG - Intergenic
987738019 5:21869961-21869983 GTGGAAGAAAACTGAATTATGGG + Intronic
987888644 5:23845878-23845900 ATGGGAAAAATCAGAAGAGTTGG - Intergenic
988119471 5:26942276-26942298 GTGGGAAGTAATTGAATTGTGGG - Intronic
988210072 5:28192603-28192625 ATGGGAACAACCATAATTGTAGG + Intergenic
988487510 5:31678905-31678927 GGGGGAAAAAAAAGAAATATAGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988984138 5:36600365-36600387 TTGGGCAAATACAGTATTGTAGG - Intergenic
989703964 5:44305584-44305606 ATGGGAAAAAATAGAACTGAAGG + Intronic
990481217 5:56213064-56213086 GTGGGATATAACAGAAAAGTTGG + Intronic
991292054 5:65042701-65042723 GGAGGAAAGAAAAGAATTGTAGG - Intergenic
992308498 5:75468380-75468402 GAGGAAAAAAAGAGAAGTGTAGG + Intronic
993391610 5:87325250-87325272 GTGGGAAGTAACTGAATTATGGG - Intronic
993812817 5:92503976-92503998 ATGGGAAATAACACAATTGGAGG - Intergenic
994122818 5:96135632-96135654 TTGGGAAAAAAGAGAAATCTTGG - Intergenic
994556242 5:101308736-101308758 TTGGGAAAAATCCAAATTGTGGG - Intergenic
995339188 5:111038063-111038085 GTTGGAAAAAACAAAAGTCTTGG + Intergenic
995477044 5:112558690-112558712 GTGGGAAACAACTGAATCATGGG + Intergenic
996742557 5:126814315-126814337 GTAGGAAAAAATAAAATTGAGGG - Intronic
997940602 5:138154003-138154025 AAGGGTCAAAACAGAATTGTGGG - Intronic
998620946 5:143793678-143793700 GTGGAAATAAAGACAATTGTAGG - Intergenic
998631717 5:143905996-143906018 CTGGGAAAAAACAAAATAGAAGG + Intergenic
999050780 5:148522005-148522027 GTGGGAGATAACTGAATTATGGG + Intronic
999079822 5:148832609-148832631 GGGGAAAAAAACAGATTTCTCGG + Intergenic
999387674 5:151166552-151166574 ATGGAAAAAAACAGAATTTTAGG - Intergenic
999573906 5:152952518-152952540 ATGGGAAAAAAAACAAGTGTTGG + Intergenic
999609337 5:153352191-153352213 TTGTGAAAATACAGAATTCTGGG - Intergenic
1000205316 5:159052567-159052589 GGGAGAAAAAACAAAAGTGTGGG - Intronic
1000358540 5:160424961-160424983 GCCAGAAAAAACAGCATTGTAGG + Intronic
1000432558 5:161167691-161167713 GTGGAAGAAAACAGAAGTTTAGG + Intergenic
1001734139 5:173985066-173985088 GTGGGAAGTAACTGAATTGTGGG - Intronic
1001836410 5:174836480-174836502 GGAGGAAAAAACAGCTTTGTGGG + Intergenic
1003662424 6:8075084-8075106 GGGGGAGAAGACAGAAGTGTTGG + Intronic
1003784457 6:9468778-9468800 GTGGGAAAATACAGAATGAATGG - Intergenic
1004230641 6:13830157-13830179 GTGGGAAAATACAGAAGAGGGGG + Intergenic
1004853362 6:19724125-19724147 GTGACAAAAAGCAGAATTATAGG - Intergenic
1005036241 6:21557593-21557615 GTGGGAGAAAACACATTTCTTGG - Intergenic
1005094194 6:22094855-22094877 GTGGGAGAAAATTGAATCGTGGG - Intergenic
1006595730 6:35191653-35191675 GAGGGAATAAACAGAAGTATTGG + Intergenic
1007783854 6:44269255-44269277 GTGGGAAAGATCTGAATTCTAGG + Intergenic
1008512703 6:52291611-52291633 GTGGGAGATAACTGAATTATGGG + Intergenic
1008669071 6:53748095-53748117 GGGGGAAAAACCAGAATAATGGG + Intergenic
1009876671 6:69514494-69514516 GTGGAAAAAAACAAAACTGTTGG + Intergenic
1010263712 6:73844871-73844893 GGAGGAAAAAACAGTTTTGTGGG + Intergenic
1010298517 6:74230238-74230260 GTAAGAAAAACCATAATTGTTGG + Intergenic
1010500274 6:76591011-76591033 TTGGGAAAAAACAAAAGAGTTGG + Intergenic
1013442910 6:110189798-110189820 GTGGTAAAAAACAGAACAGATGG - Intronic
1013974510 6:116061338-116061360 GTGGGAAAAAGCAACATTTTGGG - Intergenic
1014346053 6:120270749-120270771 GTGGGAGATAACTGAATTATGGG + Intergenic
1014375654 6:120669721-120669743 GTGTGATAAAACAAAATAGTGGG - Intergenic
1014911277 6:127096443-127096465 GTGGAGAGAGACAGAATTGTCGG + Intergenic
1015209726 6:130683406-130683428 GAGGGAGAAAACAGAATCCTGGG + Intergenic
1015489656 6:133811622-133811644 CTGGGAAAACACAGAACTATAGG - Intergenic
1015856726 6:137632830-137632852 GTGGGAGATAATTGAATTGTGGG - Intergenic
1015901562 6:138073620-138073642 GTGGGAGATAACTGAATTATGGG + Intergenic
1015926367 6:138313737-138313759 GTTGGAAAAAGCTGCATTGTGGG - Intronic
1016337815 6:143026943-143026965 GTGGCAAGACACTGAATTGTAGG - Intergenic
1017231325 6:152077097-152077119 GAGGAAAAAAACAGTTTTGTGGG + Intronic
1017502799 6:155040841-155040863 GTAGGAAAAAACAGAGCTTTTGG + Intronic
1017979628 6:159388896-159388918 GTGAAAACAAACAGAATTGAGGG - Intergenic
1021004460 7:15376177-15376199 GGGGGAAAAAAAAGGAATGTGGG - Intronic
1021146744 7:17098600-17098622 GGGGGAAAAAACAGGATAGAAGG + Intergenic
1021229384 7:18067386-18067408 GTGGGAAAATCCAGCATTCTCGG + Intergenic
1021864057 7:24937246-24937268 GTGGGAGAAAATTGAATTATGGG - Intronic
1022327827 7:29348233-29348255 GAGGGAAAACAAAGAATTCTGGG - Intronic
1023813410 7:43929815-43929837 GGGAAAAACAACAGAATTGTAGG + Intronic
1024158165 7:46647524-46647546 GTGGGAGATAACTGAATTATGGG - Intergenic
1024597241 7:50948288-50948310 GTGGGAAAAATAAGAATAGGAGG + Intergenic
1024757440 7:52552200-52552222 GTGGGAAATAACTGAATCATGGG + Intergenic
1025170159 7:56749154-56749176 GTGGGAGATAATTGAATTGTGGG + Intergenic
1025701726 7:63826564-63826586 GTGGGAGATAATTGAATTGTGGG - Intergenic
1026107699 7:67433993-67434015 GTGGGAGATAACTGAATTATGGG + Intergenic
1026171130 7:67954906-67954928 GTGGGAGATAATTGAATTGTGGG - Intergenic
1027519118 7:79181524-79181546 GGGGGAAAAAATAGTTTTGTGGG - Intronic
1027598773 7:80211858-80211880 GGGGGAAAAAGTAGAAATGTCGG + Intronic
1027600140 7:80230277-80230299 GAGGGAAAAAATAGAAAAGTAGG + Intergenic
1027801780 7:82762011-82762033 GTGGGAAATAAAATATTTGTTGG - Intronic
1028215026 7:88121181-88121203 TTTGGAAAAACCAGAATTGGAGG - Intronic
1028926715 7:96365627-96365649 GTGGGAAAAAAAAGAAAAGGAGG - Intergenic
1029867987 7:103656640-103656662 TTGGGAATAAACAAAATTATTGG - Intronic
1030444370 7:109630613-109630635 ATGGGAAAAAACAGAGATGAGGG - Intergenic
1030444620 7:109633595-109633617 GTGAGAAAAAATAGGACTGTTGG - Intergenic
1032411174 7:131694145-131694167 GTGGGAAAAACCAGAAAGATGGG + Intergenic
1033429969 7:141280375-141280397 GTGGGAGATAACAGAATCATGGG + Intronic
1033872955 7:145779397-145779419 GTTGCATAATACAGAATTGTGGG + Intergenic
1034092723 7:148378960-148378982 GAGGGAAGGAACAGAATGGTAGG + Intronic
1034829565 7:154297746-154297768 GTGGGAGAAAACATAATAGAAGG - Intronic
1034876845 7:154732303-154732325 GTGGGACAGCACAGAATTTTTGG + Intronic
1035447690 7:158954015-158954037 GTGGGAAGTAACTGAATCGTGGG + Intronic
1035452265 7:158985124-158985146 GTGGGAGATAACAGAATCATGGG - Intergenic
1035455271 7:159004818-159004840 TGGGGAAAGAACCGAATTGTTGG + Intergenic
1036117601 8:5975246-5975268 GTGGGAGATAACTGAATTATGGG - Intergenic
1037117143 8:15240484-15240506 GTGGGAGATAACTGAATCGTGGG + Intergenic
1038242405 8:25822089-25822111 GTGGGAAACAAGAGCATTGGTGG + Intergenic
1039460353 8:37738331-37738353 GTAGGAGAAAACAGTATTTTAGG - Intronic
1040665240 8:49623881-49623903 GTGGGAGAAAACGGGACTGTAGG - Intergenic
1040891535 8:52322242-52322264 GTGGTAAAAATGAGAATTGTAGG - Intronic
1043009450 8:74863508-74863530 GTAGGAAAATACAGAACTGAAGG - Intergenic
1043097571 8:75994813-75994835 GTGGAAGAAAACAGAAATTTGGG + Intergenic
1043251735 8:78083375-78083397 GTGGGTAAAATGAGAAATGTTGG + Intergenic
1043593499 8:81857263-81857285 ATAGGAAAAAACAGAAATATGGG - Intergenic
1043842366 8:85122996-85123018 GTAGGAAAAACCAGACTTCTGGG - Intronic
1044009858 8:86981332-86981354 GAGGGAAAAACCAGAAATTTGGG - Intronic
1044044424 8:87413286-87413308 GTGTGAAAAAATAGAATCTTGGG - Intronic
1044354715 8:91207761-91207783 GTTGGAGAAAACAGCAGTGTGGG + Intronic
1045375600 8:101570944-101570966 GTGGAATAAAAAAGAAGTGTTGG - Intronic
1045872285 8:106940351-106940373 GTGGGAAGAAAAAGATTAGTGGG - Intergenic
1046151159 8:110228165-110228187 GTTTGAGAAAACAGAAATGTGGG - Intergenic
1046185661 8:110713135-110713157 GTTGGAGAAAACAGATTTGAAGG - Intergenic
1047030859 8:120879059-120879081 GTGAGGAAAAACAGACATGTAGG - Intergenic
1048117488 8:131541562-131541584 GTGGGAGATAATTGAATTGTGGG + Intergenic
1049954337 9:678433-678455 GTAAGAAAAATCAGAATTATGGG + Intronic
1050282451 9:4065122-4065144 CTGGGAAAAATCAGAAATCTAGG - Intronic
1050733801 9:8739780-8739802 GTGGGAGATAACTGAATTATAGG + Intronic
1051592786 9:18793510-18793532 TGGGGAAACAACAGAAATGTGGG - Intronic
1052007974 9:23373419-23373441 GTGGGACAAAAAATAATTCTAGG - Intergenic
1052236601 9:26218589-26218611 GTGTGAAAAAAAAGAAATGTTGG + Intergenic
1052427617 9:28325520-28325542 GTGGGAGATAACTGAATTATGGG + Intronic
1052461836 9:28774793-28774815 GTGGGAATCAACAAAATTGTGGG + Intergenic
1052849530 9:33368486-33368508 TTTGGAGAAACCAGAATTGTGGG + Intronic
1054922860 9:70559405-70559427 GAGGGAAAAAATAGATTTTTTGG + Intronic
1057193657 9:93101772-93101794 GTGGAAAAAAACAGTATGGCAGG - Intronic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1059291561 9:113229300-113229322 GGGGGAAACAACAAAGTTGTTGG - Intronic
1059321705 9:113475359-113475381 GTTGAAAAAAACAGAGGTGTAGG + Intronic
1059729652 9:117044293-117044315 GTGAGAATGAACAGCATTGTGGG + Intronic
1059794588 9:117678843-117678865 AGGGGAAAAAACAGAATTCTTGG + Intergenic
1059916636 9:119110587-119110609 ATGGGAAACAACAGCCTTGTTGG - Intergenic
1060209994 9:121704150-121704172 TTGGGAAAAATCAGAAATGTAGG - Intronic
1062690237 9:137837807-137837829 GTGAGAGAAAACAGGCTTGTGGG + Intronic
1185949696 X:4419007-4419029 GTGTTAAAAAACACAATTATGGG + Intergenic
1186117612 X:6321415-6321437 GTGGGAAATAACTGAATCATGGG - Intergenic
1186212771 X:7267532-7267554 TTGTGAAAAAACAGATATGTTGG + Intronic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186458768 X:9731694-9731716 ATGGGAGAAAATGGAATTGTAGG + Intronic
1186459084 X:9734213-9734235 ATGAGAGAAAAAAGAATTGTGGG + Intronic
1186607678 X:11109155-11109177 GTGGGAGAGAGCAGAATTGTGGG + Intergenic
1186607798 X:11110162-11110184 GTGGGAAGGAATAGAATTTTGGG + Intergenic
1186720386 X:12297484-12297506 GTGGGAAAGAACGGAATTGTGGG + Intronic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1186720408 X:12297654-12297676 GTAGAAGAGAACAGAATTGTGGG + Intronic
1186847836 X:13548721-13548743 GTGAGAGAAAAGAGAATTGTGGG - Intergenic
1187571865 X:20512224-20512246 GTGAGAAATAACAGAAAAGTAGG + Intergenic
1188057651 X:25560243-25560265 GGGGGAAAGCACAGAATTTTTGG - Intergenic
1188742184 X:33799220-33799242 GTGGCAAAAGATAGAATTTTTGG + Intergenic
1188814670 X:34697453-34697475 GTGAGAAAACAGTGAATTGTTGG + Intergenic
1189732074 X:44032035-44032057 GTGGGCAGACACACAATTGTGGG - Intergenic
1190719557 X:53136187-53136209 GTGGGTGAAAACAGAGTTTTAGG - Intergenic
1191764511 X:64682602-64682624 GTGGGAAAGAACAACATTGAAGG + Intergenic
1191977951 X:66894432-66894454 GTTGGAAAAAACAGAATTTTAGG + Intergenic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1192685964 X:73305426-73305448 TTGGAAAAACACAGTATTGTGGG + Intergenic
1193753859 X:85382174-85382196 GTGTGAAACAAAAGAACTGTTGG - Intergenic
1194106586 X:89776487-89776509 GTGGCAGAAAACAAAATTGCAGG - Intergenic
1194307280 X:92263355-92263377 GTGGGAAAAGAAAGTATTGGGGG - Intronic
1194331335 X:92586273-92586295 GTTGAAAAAAACACAATTCTCGG - Intronic
1195090632 X:101455090-101455112 GTGGGAAAGAAGAGATTTGAAGG + Intronic
1195148571 X:102043259-102043281 GTGAGAAAGAACAGGATTGGGGG - Intergenic
1196131300 X:112159837-112159859 GTGGAGAAAAACAGAGGTGTAGG - Intergenic
1196327525 X:114425279-114425301 TTAGGAAAAAAAAAAATTGTGGG + Intergenic
1196996250 X:121387592-121387614 GTAGGAAAAAACTGTTTTGTGGG + Intergenic
1197969331 X:132098573-132098595 GTGGGAACAGACAGAACTTTGGG + Intronic
1197969353 X:132098783-132098805 GTGGGAACAGACAGAACTTTGGG + Intronic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1199406947 X:147473313-147473335 GTGGGAAAAAGCAGAAAAGTAGG + Intergenic
1200353700 X:155526175-155526197 GAGGGAAAAAAGAGTTTTGTGGG + Intronic
1200458550 Y:3424347-3424369 GTGGCAGAAAACAAAATTGCAGG - Intergenic
1200640037 Y:5705332-5705354 GTTGAAAAAAACACAATTCTCGG - Intronic
1201651498 Y:16293592-16293614 ATGGTAAAAAAAAGATTTGTAGG + Intergenic