ID: 1186726384

View in Genome Browser
Species Human (GRCh38)
Location X:12363564-12363586
Sequence GGTCTCTGATGGTGGCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186726384_1186726395 18 Left 1186726384 X:12363564-12363586 CCCCTAAGCCACCATCAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1186726395 X:12363605-12363627 TTCCATGGCCCATACTGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 130
1186726384_1186726399 27 Left 1186726384 X:12363564-12363586 CCCCTAAGCCACCATCAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1186726399 X:12363614-12363636 CCATACTGCCAGGGCTTTGATGG 0: 1
1: 0
2: 2
3: 13
4: 178
1186726384_1186726400 28 Left 1186726384 X:12363564-12363586 CCCCTAAGCCACCATCAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1186726400 X:12363615-12363637 CATACTGCCAGGGCTTTGATGGG 0: 1
1: 0
2: 0
3: 6
4: 144
1186726384_1186726392 3 Left 1186726384 X:12363564-12363586 CCCCTAAGCCACCATCAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1186726392 X:12363590-12363612 CCAGCCACTCTTCATTTCCATGG 0: 1
1: 0
2: 3
3: 17
4: 244
1186726384_1186726394 17 Left 1186726384 X:12363564-12363586 CCCCTAAGCCACCATCAGAGACC 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1186726394 X:12363604-12363626 TTTCCATGGCCCATACTGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186726384 Original CRISPR GGTCTCTGATGGTGGCTTAG GGG (reversed) Intronic
902325467 1:15697311-15697333 GGTCTCTGGTGTTCGCTGAGGGG + Intronic
902869538 1:19305856-19305878 GGTCTTTGATGGTATCTGAGTGG - Intronic
906151841 1:43592065-43592087 GGTTTCTGCTGGAGGCTTAGTGG + Intronic
906601408 1:47132692-47132714 TGTCTGGGATGGTGGGTTAGGGG - Intergenic
910588348 1:88902674-88902696 GGTCTCTGCTGGTGGCAAATTGG - Intergenic
914830588 1:151168176-151168198 GACCTCTGAGGGTGGCATAGGGG - Exonic
915311922 1:155009309-155009331 GGTTTCTGCTGGCGGCTTGGCGG + Intronic
915548840 1:156619893-156619915 GGTCTCTTAACATGGCTTAGTGG + Intronic
915599586 1:156913907-156913929 GGTCCCGGATGGTGGCATATGGG - Exonic
918573279 1:186024492-186024514 GGTCTCTGTTACTGGCTAAGAGG + Intronic
924018437 1:239753963-239753985 AGTCTCGGATGGTAGGTTAGAGG + Intronic
924438113 1:244063496-244063518 GTTCTCTGATGGTGTCAAAGAGG + Intergenic
924630606 1:245736685-245736707 GGTCTCTGATGCTGGCAAACTGG + Intergenic
924844288 1:247749898-247749920 GGTCTCAGATGCTGGCCTAGTGG - Intergenic
1064265394 10:13821383-13821405 GGTCTCTGATCTTGGCTTCGGGG - Intronic
1065514514 10:26511784-26511806 AGTCACTGATGGTGGATGAGCGG + Exonic
1066148027 10:32583150-32583172 GGTCTCTGATGGAGATTTATAGG - Exonic
1067860574 10:49843274-49843296 GGTTTCTGATTGTAGCTCAGAGG + Intronic
1071037916 10:81269345-81269367 GGTTCCTGCTGGTGGCTTGGTGG - Intergenic
1071257179 10:83881270-83881292 GGTGTCTGATTGTGTCTTGGTGG - Intergenic
1071454324 10:85832935-85832957 GGTTTCTCATGGTGGTTCAGGGG - Intronic
1074336631 10:112582917-112582939 GGTCACTGATGGAGATTTAGAGG - Intronic
1074384357 10:113005308-113005330 GGTCTCAGAAGATGGGTTAGAGG + Intronic
1076917955 10:133433828-133433850 GGTCTCTGAGGGTGGGAGAGGGG - Intergenic
1076937953 10:133577905-133577927 GGTCTCTGAGGGTGGGAGAGGGG - Intergenic
1077703774 11:4464834-4464856 AGACTCTGATGAGGGCTTAGAGG + Intergenic
1078116145 11:8452885-8452907 GGTGACTGATTTTGGCTTAGCGG - Exonic
1079111147 11:17605923-17605945 GGTCTCTGGAGCTGGCTAAGTGG + Exonic
1085715116 11:78865572-78865594 TGTCACTGATGGTGGTTTTGAGG + Intronic
1085852789 11:80141115-80141137 GGGCTCTGAGGGTGGTTTAGAGG - Intergenic
1087212134 11:95455306-95455328 GGTCTCTGAGGGTGGGGTAGAGG + Intergenic
1088316717 11:108514419-108514441 GGACTCTGCTGGTGCCTTGGTGG + Exonic
1089395525 11:118134351-118134373 AATCTCTGATGGTGGCTTCCAGG - Exonic
1091950445 12:4588528-4588550 TGGCTCTGAAGGTGGCATAGTGG - Intronic
1092381679 12:8001853-8001875 GGTCTCTGTTGCTGGCAAAGTGG - Intergenic
1095767382 12:45911907-45911929 GGTTACTGATGGGGGTTTAGGGG - Intergenic
1098081793 12:66794267-66794289 GGTTTCTGTGGGTGGCTTATGGG + Intronic
1103039836 12:117685769-117685791 GGCCTCTGGTGGTGGGTTGGGGG - Intronic
1104778283 12:131403962-131403984 GGGGTCTGATGATGGCTGAGCGG - Intergenic
1105788262 13:23770672-23770694 GGTCTCTGGTGGTGGGTGAGTGG - Intronic
1113663865 13:112127044-112127066 GGCATCTGGTGCTGGCTTAGAGG - Intergenic
1113916801 13:113878826-113878848 GGTGTGTGATGGTGGTTTTGTGG - Intergenic
1115385150 14:32788743-32788765 GGTCTCTGTTTGTGCCTGAGTGG - Intronic
1118950623 14:70433644-70433666 GGTCTCTGCTGGTGGCAAATTGG + Intergenic
1120231312 14:81844323-81844345 GGTCTCTGCTGCTGGCTAATTGG + Intergenic
1120319812 14:82945145-82945167 GGTCAATGATGATGTCTTAGGGG + Intergenic
1122303866 14:100749097-100749119 GGTCTCTGCTGGTGGCCCATCGG - Intergenic
1124923260 15:34047017-34047039 GGTCTCTGTTTGTGCCTGAGCGG - Intronic
1125501589 15:40243030-40243052 GGGGGCTGATGGTGGCTTTGTGG - Intronic
1127298343 15:57629522-57629544 GGTCTCCCATGGTGGCCAAGAGG - Intronic
1130757121 15:86776053-86776075 GGTCTCTGATGATTGTTCAGTGG + Intronic
1132649587 16:1014454-1014476 GTTCTCTGATGCTGGCCGAGGGG + Intergenic
1132653356 16:1031371-1031393 GGCCCCTGATGGGGGCTCAGAGG + Intergenic
1137598055 16:49737931-49737953 GACCTCTGATGGTGGCTGGGAGG - Intronic
1137893005 16:52181914-52181936 GGTCCCTGCTGGAGGCTTTGAGG + Intergenic
1138643080 16:58401414-58401436 GGTTGCTGCTGGTGGCTTGGTGG + Intronic
1139468703 16:67167119-67167141 GGTCCCTGATGCTGGATGAGGGG + Exonic
1144465061 17:15490566-15490588 GGTCTCTTATTCTGACTTAGTGG + Intronic
1146603407 17:34237700-34237722 AGTCTCTGTTGGTGACTGAGTGG + Intergenic
1146628038 17:34448786-34448808 GATGTCTGCTGGTTGCTTAGGGG + Intergenic
1147323045 17:39657550-39657572 GCTCTCTGAAGGGGGCTTTGTGG - Intronic
1158594483 18:58804251-58804273 AGTCTCTGAGTGTGGCTGAGGGG - Intergenic
1161915301 19:7223914-7223936 AGTCTATTCTGGTGGCTTAGAGG - Intronic
1162732460 19:12727062-12727084 AGTCTCTGCTGGTGGCTTTGGGG + Intergenic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1164144843 19:22505643-22505665 GGTCCCTGTGGGTGGCTGAGAGG - Intronic
1164825051 19:31278751-31278773 TGTCTGAGATGGTGGCTTTGGGG + Exonic
1164903463 19:31947692-31947714 GGGCTGTGATGGTGACGTAGGGG - Intergenic
1165327778 19:35124369-35124391 GGTCTCTGAGTGTGGGTTCGTGG - Intergenic
1166785896 19:45366611-45366633 AGGCTGTGATGGTGCCTTAGAGG - Intronic
1168646221 19:58060627-58060649 GGTTTCTTCTGGTGGCTTATGGG - Intronic
1202640712 1_KI270706v1_random:83195-83217 GGTGTCTGATCATGTCTTAGAGG + Intergenic
925271877 2:2615739-2615761 GGTCTCTGGAGGTGGGATAGGGG + Intergenic
925436152 2:3839098-3839120 AATCTCTGATGGTGGCTTGAAGG - Intronic
925916794 2:8612713-8612735 GGCCTCTGAGTGTGGCTTGGAGG - Intergenic
929051600 2:37841679-37841701 GGTCTGTGATGGTGTCTTGGAGG + Intergenic
932593958 2:73082901-73082923 TGCCTCTGACGGTGGCTCAGTGG - Intronic
936165776 2:110117965-110117987 GGTCTCTGACGCTGGCTGACAGG + Intergenic
936249368 2:110855736-110855758 GGTTTCTGCTGGTGGGTTTGTGG + Intronic
938948344 2:136234846-136234868 GGTCTCCAATGGTGGCGAAGAGG + Intergenic
939532820 2:143386167-143386189 GCTCTGTGTTGGTGGCTGAGTGG - Intronic
939680363 2:145123761-145123783 GGTCTATGATGTTGGCTTGGGGG - Intergenic
945007375 2:205423168-205423190 CTTCTCTGATGGTTGCTGAGCGG + Intronic
946024381 2:216663073-216663095 GGGCTCTGCTGATGGCTTAGGGG + Intronic
948606528 2:239139291-239139313 GTGCTCTGAGGGTGGCTGAGAGG - Intronic
1172240208 20:33408138-33408160 GACCTCTGGGGGTGGCTTAGGGG + Exonic
1172848609 20:37944791-37944813 GGTCACTCATGGAGGCCTAGGGG + Exonic
1173159459 20:40641515-40641537 GGTCTTTGTTGGTGGCTTCAAGG - Intergenic
1174192592 20:48750825-48750847 GGCCTCTGATGTTGGATTGGGGG - Intronic
1174609955 20:51790839-51790861 GGTCTCTGACCCTGGCTCAGGGG + Exonic
1174618240 20:51853123-51853145 GGGCTCTGAAGATGGCTGAGAGG + Intergenic
1174691681 20:52512452-52512474 GGGCTTTGATGGTGGTTAAGGGG - Intergenic
1175923166 20:62459335-62459357 GGTCCCTGAGGGAGGCTGAGTGG - Intergenic
1176185773 20:63778035-63778057 GGTCTCGGATGAGGGCTAAGTGG + Intronic
1178390402 21:32193145-32193167 TGTCCCTGGTAGTGGCTTAGGGG - Intergenic
1180361231 22:11898667-11898689 GGTGTCTGATCATGTCTTAGAGG - Intergenic
1181557905 22:23682625-23682647 TGACTCTGAGGGTGGCTGAGGGG - Intergenic
1184812510 22:46845984-46846006 GGGCTGGGATGTTGGCTTAGGGG + Intronic
1185362501 22:50417088-50417110 GGCGTCTGAATGTGGCTTAGTGG + Intronic
949163374 3:909022-909044 GCTCTCTGCTGGTGGAGTAGTGG - Intergenic
949982352 3:9509677-9509699 GGTTTCAGATGGTGGCTGTGGGG + Intronic
950851292 3:16064401-16064423 AGTCTCTGATGGAGGCTTTGGGG + Intergenic
955648116 3:61162800-61162822 GGTTTCTGAGGGTGGGGTAGGGG - Intronic
963569121 3:146969924-146969946 CGTCTCTGATGATGGCTGATTGG - Intergenic
968437292 4:600349-600371 GGTCTCTGTGTGTGGCTGAGTGG + Intergenic
974209824 4:58757063-58757085 GGACTTTGATGGTGGCTTCCTGG - Intergenic
976301216 4:83517205-83517227 GGTCTCTGCTGCTGGCATATTGG + Intronic
977989819 4:103427743-103427765 GGTCTCTAATGGAGGCTCAGAGG - Intergenic
984104514 4:175528356-175528378 AGTCTCTGGTGGGGGCTGAGGGG - Intergenic
987054857 5:14181720-14181742 GGTCTGTAAAGGTGGATTAGAGG + Intronic
992109763 5:73481946-73481968 GGTCTCTGCTGCTGGCACAGTGG + Intergenic
992422471 5:76620337-76620359 AGACTCTGATGGCGGCTTAAAGG + Intronic
999227835 5:150041977-150041999 GGTCCCTCACGGTGGCTAAGAGG - Intronic
1002926063 6:1606346-1606368 GGTCTGTGATGGCAGCCTAGTGG + Intergenic
1005107319 6:22237735-22237757 CCTCTCAGATGGTGGCTCAGAGG + Intergenic
1005804549 6:29462153-29462175 GGTGGATGATGGTGGCATAGTGG - Exonic
1005819777 6:29588328-29588350 GGTGGATGATGGTGGCATAGTGG - Exonic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1011136532 6:84106474-84106496 GGTCTCTGCTGCTGGCATATTGG + Intergenic
1014455852 6:121634449-121634471 GGTCTCTGCTGCTGGCTAATCGG - Intergenic
1014524033 6:122479713-122479735 TGTCTCTGATGTTGGGTTTGGGG - Intronic
1015946310 6:138504667-138504689 GGTCCCTGATGGAGGATCAGAGG + Intronic
1016886192 6:148961938-148961960 GGTCCCTGATGGTAGCATGGTGG + Intronic
1019309166 7:351925-351947 GGTCTCTGATGGAGGCCCACGGG - Intergenic
1019484695 7:1284170-1284192 GGTATCTGTGGGTGGCCTAGAGG + Intergenic
1020021876 7:4874071-4874093 GGTCTCTCCTGCTGGCTTGGAGG - Intronic
1020998538 7:15297220-15297242 GGTCTTTGATGGTAGATTCGGGG - Intronic
1025220284 7:57102150-57102172 GGTCTCTCATGCTGTCGTAGTGG - Intergenic
1025631063 7:63273732-63273754 GGTCTCTCATGCTGTCGTAGTGG - Intergenic
1025969433 7:66308506-66308528 GATCTCTGGTGGTGGCTGATTGG - Intronic
1027514206 7:79121780-79121802 GGTCACTAATGAGGGCTTAGAGG - Intronic
1030905328 7:115174376-115174398 GGTATCTGAGGGTGACTTGGTGG - Intergenic
1031353237 7:120761026-120761048 GTTCTCAGAGGGTGGCTTACTGG - Intergenic
1031362818 7:120867485-120867507 GGTCACTTATGATGGCTTGGGGG - Intergenic
1032223157 7:130009332-130009354 GCTGTCTGATGGTGGCATGGAGG + Intergenic
1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG + Intergenic
1035582481 8:748283-748305 GGACTCTGGTGGTGGCTCCGTGG + Intergenic
1038700836 8:29847906-29847928 GGTCTCTGAGTGTGGCTTTTTGG - Intergenic
1042755705 8:72208287-72208309 GGTCTGTGGTGGTTGCTTATTGG - Intergenic
1043617157 8:82140327-82140349 GGTCCAGGATGGTGGTTTAGGGG + Intergenic
1054810696 9:69431520-69431542 GGTCCCTGGTGGTGGCTGGGCGG - Intronic
1056085127 9:83140540-83140562 GAACTCTGATGGTACCTTAGTGG + Intergenic
1056583193 9:87909550-87909572 GATCTCTGATGGTGGATCTGAGG - Intergenic
1057159483 9:92877751-92877773 GATCTCTGATGGTGGATCTGAGG - Intronic
1057799367 9:98180803-98180825 GGTCTCTGGTTGTGGCTTCCAGG - Intronic
1059156909 9:111998079-111998101 GATCTCTGAGGGTGGGATAGTGG + Intergenic
1061904252 9:133688519-133688541 GGTCTCTGCTGTTGGGTCAGCGG - Intronic
1061911732 9:133728594-133728616 GGGCTCTGATGGGGTCTCAGGGG - Intronic
1186726384 X:12363564-12363586 GGTCTCTGATGGTGGCTTAGGGG - Intronic
1193053619 X:77126692-77126714 GGTCTCTGATGCTGGCAAATTGG - Intergenic
1197244919 X:124158077-124158099 GGTCTCTGATGCTGGCAAATTGG + Intronic
1197738734 X:129872735-129872757 GGTCTCTGACCCTGGCTTGGTGG - Intergenic
1201454839 Y:14158740-14158762 GGTTTCTGCTGGTGGATTCGTGG - Intergenic
1201602810 Y:15749336-15749358 GGTTTCTGCTGGTGGGTTCGTGG - Intergenic