ID: 1186731507

View in Genome Browser
Species Human (GRCh38)
Location X:12415375-12415397
Sequence ACTGGGGAGGAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1281
Summary {0: 1, 1: 1, 2: 7, 3: 128, 4: 1144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186731507_1186731515 16 Left 1186731507 X:12415375-12415397 CCATCCATCCTCTCCTCCCCAGT 0: 1
1: 1
2: 7
3: 128
4: 1144
Right 1186731515 X:12415414-12415436 TTTCTTTAGTTCTTAGTGTGAGG 0: 1
1: 0
2: 0
3: 38
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186731507 Original CRISPR ACTGGGGAGGAGAGGATGGA TGG (reversed) Intronic
900365775 1:2311394-2311416 TCTGGGGGGCAGAGGATGGGCGG + Intergenic
900535739 1:3176330-3176352 ACAGGGGATGAATGGATGGAGGG - Intronic
900727393 1:4225846-4225868 AGTTGGTAGGAGAGGATGCAAGG - Intergenic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900979076 1:6035913-6035935 ACTGAGAAGGAGTGGCTGGAGGG + Intronic
901197906 1:7450459-7450481 GCTGGAGGGGAGGGGATGGAAGG + Intronic
901746559 1:11377489-11377511 ACTGGGGAGGACAAGTTGGAAGG + Intergenic
901768391 1:11518172-11518194 CCTGGGGTTGGGAGGATGGAGGG + Intronic
901977697 1:13008436-13008458 ACTGGAGAGTGGAGGGTGGAAGG - Intronic
902004388 1:13220499-13220521 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902023611 1:13366237-13366259 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902091138 1:13904151-13904173 GCAAGGGAGCAGAGGATGGAGGG + Intergenic
902292606 1:15445225-15445247 CCTGGGAAGGTGAGGAAGGAGGG - Intronic
902592592 1:17485684-17485706 AATGGAGAGAAGAAGATGGATGG + Intergenic
902613790 1:17612778-17612800 GCTGGGGCGGAGAGGCGGGAGGG - Intronic
902771694 1:18648890-18648912 GCTGGAGAGCAGAGGATGCAAGG + Intronic
902835387 1:19043768-19043790 ACTGGGTGGGAGGGGGTGGAGGG + Intergenic
903093388 1:20944404-20944426 ACTCGGGAGGCCAAGATGGAAGG + Intronic
903173732 1:21568839-21568861 ATTGGGGAAGGGAGGCTGGAGGG + Intronic
903273645 1:22207662-22207684 ACTGGACAGGAGTGGAGGGAGGG - Intergenic
903335079 1:22619246-22619268 AGAGGGGAGAAGAGGATGGAGGG - Intergenic
903563755 1:24248801-24248823 AGAGGAGAGGAGAGGAAGGATGG + Intergenic
903596864 1:24502242-24502264 AGTGGGGAGGAGAGGAGGGGAGG + Intergenic
903941849 1:26937386-26937408 ACTCGGGAGGCTAAGATGGAAGG - Intronic
904322612 1:29707312-29707334 AGTGGGGAGGGAAGGAGGGAGGG + Intergenic
904322738 1:29707605-29707627 AGAGGGGAGGGGAGGAGGGAGGG + Intergenic
904325837 1:29727211-29727233 GCTGGGGAGGGGTGGAGGGAAGG + Intergenic
904325850 1:29727238-29727260 GCTGGGGAGGGGTGGAGGGAAGG + Intergenic
904376625 1:30086024-30086046 AATGGGGAGGGAAGGAGGGAGGG - Intergenic
904498453 1:30900808-30900830 ATGGGGGAGGGCAGGATGGATGG + Intronic
904560973 1:31397235-31397257 AATGAAGAGGAGAGAATGGAAGG + Intergenic
904562328 1:31407066-31407088 ACTGAGCAGGGGAGGATGAATGG + Intergenic
904677915 1:32209702-32209724 AGTGGGGAGGAATGGATGGGTGG - Intronic
904855848 1:33497711-33497733 ACTGAGGAGGAGGGAATGAATGG + Intergenic
904891059 1:33779913-33779935 AGGATGGAGGAGAGGATGGAAGG + Intronic
905003980 1:34695718-34695740 ACAGGGGCAGAGAGGAAGGAGGG - Intergenic
905222289 1:36456707-36456729 GCTGGGGTAGAGAGGAAGGAAGG + Intronic
905343215 1:37293365-37293387 ACTGGGGAGGAGAGGGTGGTGGG - Intergenic
905490616 1:38340664-38340686 AGTGGGGAGGTCAGGATGGGTGG + Intergenic
905790107 1:40785011-40785033 ACTGGGAAGTTGAGGGTGGAGGG - Intronic
906524830 1:46488052-46488074 AGTGGAGAGGAGGGGAGGGAAGG - Intergenic
906627649 1:47338412-47338434 ACTGGGAAGGAAAGATTGGAGGG + Intronic
906933104 1:50188809-50188831 CCTGGGGAAGAGTGGATGAAGGG + Intronic
907790132 1:57655383-57655405 ACTGGAGAGTGGAGGATGAATGG - Intronic
907935599 1:59039299-59039321 AGTGGGGAGATGAGGAGGGAAGG - Intergenic
908381064 1:63597157-63597179 ACTTGGGAGGGGAAGATGAAGGG + Intronic
908512611 1:64861361-64861383 CCTGTGGAGAAGAGGAGGGAGGG + Intronic
908793247 1:67803944-67803966 ACTGGAGAGGAGATGATGGTGGG + Intronic
909226916 1:73036919-73036941 ACTGGGGAGGAGAGTATTCAAGG + Intergenic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909741079 1:79030361-79030383 ACAGGGAGGGAGAGGAAGGAAGG - Intergenic
910455234 1:87390807-87390829 ACTAGGGAGGTTAAGATGGAAGG - Intergenic
910586962 1:88891133-88891155 GCGGGGGAGGAGAGGAGGGAGGG + Intronic
911563413 1:99434071-99434093 ACAGGTGAAGAGAGGATGGAAGG - Intergenic
912016903 1:105050169-105050191 GCTGGGGAGGGGAGGAGGGAAGG - Intergenic
912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG + Intergenic
912151202 1:106860777-106860799 AGAGGAGAGGAGAGGAGGGACGG + Intergenic
912188933 1:107315228-107315250 AATGGACAGAAGAGGATGGATGG - Intronic
912932644 1:113979012-113979034 GCTGGGGAGGTGAGGCTTGAAGG - Intergenic
913082276 1:115399726-115399748 ACTGCAGAGGAGAAGAGGGAGGG - Intergenic
913248628 1:116892626-116892648 AGTGGGGAGGAAAGGAGAGAGGG - Intergenic
913511651 1:119568063-119568085 CCTGGGGAGGAGATGAAGCAAGG + Intergenic
913515881 1:119605388-119605410 CCTGGGGAGGAGATGAAGCAAGG + Intergenic
914718942 1:150273346-150273368 ACTGGGGAACAAAGGAGGGAAGG - Intronic
914845134 1:151279623-151279645 ACTGGGGAGGCTGGGATGGAAGG - Intergenic
914942681 1:152036745-152036767 ACTGGGGAAGAAGGGATGGAAGG - Intronic
915316610 1:155032407-155032429 ACTGGGGAGGCTATGGTGGAAGG - Intronic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
915514739 1:156406237-156406259 AATGGGCAAGAGAGCATGGAAGG - Intronic
915573602 1:156760310-156760332 CCTGGGGAGGAGAGGACTCAGGG + Intronic
915626510 1:157117404-157117426 ACCAGGGAGAGGAGGATGGAAGG - Intergenic
916400261 1:164440027-164440049 AGAGGAGAGGAGAGGAGGGAGGG + Intergenic
916520950 1:165563141-165563163 ACAGGGGTGGGGAGGTTGGAAGG - Intronic
917156301 1:172003527-172003549 AGGGGGCAGGAGAGGAGGGAGGG - Intronic
917354612 1:174113293-174113315 ACTGGGGAGGGAAGGAAGGGAGG + Intergenic
917679570 1:177352213-177352235 ACTGGGGAGGGCAGGAGGCAGGG + Intergenic
917754332 1:178084243-178084265 ACTGGGGATTAGAGGAATGAGGG - Intergenic
917836712 1:178946894-178946916 ACTGTAGGGGAGAGGATGGGAGG + Intergenic
917955368 1:180091114-180091136 ACTTGGGAGGCTAGGATGGGAGG - Intronic
917979078 1:180258347-180258369 ACTGGGCAGTGGAGGAGGGAGGG + Intronic
918084496 1:181234122-181234144 ACTGGGGAGGAGAGAAAAGAGGG + Intergenic
918201607 1:182272529-182272551 ACTGGGGAGAACAGACTGGAAGG + Intergenic
918389632 1:184045202-184045224 GATGGGGAGGAGAAGAAGGAAGG + Intergenic
918561462 1:185872543-185872565 TGTTGGGGGGAGAGGATGGATGG + Intronic
918632920 1:186740269-186740291 ACTGAGAAAGAGAGTATGGATGG - Intergenic
918664718 1:187136159-187136181 ACATGGGAGGAGAAGAGGGAGGG + Intergenic
919013258 1:191992773-191992795 ACAGGGGAGAAGAGAATGAAGGG + Intergenic
919493688 1:198237435-198237457 ACTGAGAAGGAGAAGATGGTGGG - Intronic
919608431 1:199715290-199715312 ACTGGGGGGTGGAGGGTGGAAGG + Intergenic
919905717 1:202076963-202076985 GCTGGAGAGAAGAGGATGGTGGG + Intergenic
920198952 1:204247562-204247584 TCTGGGGAAGAGGGCATGGAGGG + Intronic
920276069 1:204805392-204805414 ACTGGGGAGGCCAAGATGGGAGG - Intergenic
920282198 1:204852685-204852707 AGCTGGTAGGAGAGGATGGAAGG - Intronic
920729546 1:208470129-208470151 ACTAGGAATGAGATGATGGAAGG - Intergenic
921151916 1:212409511-212409533 AAAGGGGATGAGAGGAAGGAAGG + Intronic
921169623 1:212534984-212535006 ACTTGGGAGGTGAGGTAGGAGGG - Intergenic
921184184 1:212655937-212655959 CCTGGTGAGGAGAGGTGGGATGG + Intergenic
921187748 1:212684709-212684731 GCTGGGGAGGAGAGGGTCCATGG - Intergenic
921262897 1:213399646-213399668 GCGGGGGAGGAGAGGGTGGGCGG - Intergenic
921559403 1:216639290-216639312 AATGGGGTGGAGAGGGTGAAGGG + Intronic
921956753 1:220993047-220993069 AATGAGGAGAACAGGATGGAGGG - Intergenic
922015679 1:221644273-221644295 ACTGGGGAGGACAAGAAGCAAGG - Intergenic
922117402 1:222627347-222627369 CCTGGGGAAGAGAGAATGAAGGG + Intronic
922168244 1:223133732-223133754 TTTGAGGAGGAGGGGATGGATGG + Intronic
922178202 1:223213496-223213518 ACAGGGGATGAGAAGATAGAAGG + Intergenic
922473241 1:225889202-225889224 AGTGGGGAGGGAAGGAGGGAGGG + Intronic
922501051 1:226097159-226097181 AGTGGAGAAAAGAGGATGGAAGG + Intergenic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
922621493 1:226991989-226992011 AGTGAGGAGGAGAGGAGGGGAGG + Exonic
922621515 1:226992056-226992078 AGTGGGGAGGAGAGGAGAGAAGG + Exonic
922697959 1:227741079-227741101 ATAGGGGAGGAGCTGATGGAAGG + Intronic
924250083 1:242123854-242123876 ACTGGGAAGGTGAGGGTGGGTGG + Intronic
924297066 1:242598372-242598394 GCGGGGGAGGAGTGGATGGGGGG + Intergenic
924527998 1:244868983-244869005 AGTGGGTAGGAGAGGAGAGAGGG + Intergenic
1062902795 10:1158437-1158459 AGAGGGGAGGAGAGGAAGGAAGG - Intergenic
1062957969 10:1552566-1552588 ACTGGGGACAGGAGGAGGGAGGG + Intronic
1062972471 10:1659742-1659764 ACACTGGAGGAGAGGAGGGAAGG - Intronic
1062972501 10:1659863-1659885 ACACTGGAGGAGAGGAGGGAAGG - Intronic
1062972531 10:1659984-1660006 ACAGTGGAGGAGAGGAAGGAAGG - Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1063920330 10:10926218-10926240 TCTGGGGAGGTGAGAATGAATGG + Intergenic
1064099505 10:12451323-12451345 GCTGGCCAGGAGGGGATGGAGGG - Intronic
1064452726 10:15457743-15457765 ACTGGGGATGACTGGATGGCTGG - Intergenic
1064534392 10:16343841-16343863 CCTGGGGAGGATGGGATGGGAGG - Intergenic
1064803585 10:19105163-19105185 GCTGGGGAGGATAGCATGGACGG - Intronic
1064982045 10:21174460-21174482 GCTGGGGAAGAGAAGAGGGAGGG - Intergenic
1064998157 10:21314431-21314453 AGAGGGGAGGAGAGGAAGGTTGG + Intergenic
1065547381 10:26835464-26835486 ACTTGGGAGGCTAAGATGGAAGG + Intronic
1065876917 10:30005186-30005208 GCTGGGGAGGATAGAAGGGAGGG - Intergenic
1066202861 10:33158873-33158895 ACTCGGGGGGAGAGGGTGGGAGG + Intergenic
1066303418 10:34116959-34116981 AATGGGAAGGCGAGGATGAAAGG + Intronic
1067012588 10:42728345-42728367 AGTGTGGAGAAGAGGGTGGAGGG + Intergenic
1067032745 10:42889277-42889299 ACTGGGGAGTGGAGGAGGGGTGG + Intergenic
1067267095 10:44755972-44755994 AGTGGGGAGGTGAGGGGGGATGG - Intergenic
1067310998 10:45113530-45113552 AGTGTGGAGAAGAGGGTGGAGGG - Intergenic
1067746546 10:48940621-48940643 ACTGTGGCAGAGGGGATGGATGG + Intronic
1067806311 10:49395636-49395658 ACTGCGGGGGACAGGAGGGAAGG + Intronic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068491450 10:57729740-57729762 ACTAGAGAGGGGAGGATGGAAGG - Intergenic
1069000203 10:63254647-63254669 ACTTGGGAGGCGGGGATGGGAGG - Intronic
1069273999 10:66566969-66566991 AGCGGGGAGAAGAGGATGGTAGG + Intronic
1069382127 10:67851939-67851961 GGTGGGGAGGAAAGGAAGGAAGG + Intergenic
1069493201 10:68879265-68879287 AATGGGAATGAGAGGATGGCGGG - Intronic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069619603 10:69828683-69828705 AGTGGGGAGGAGAGGATGGAAGG - Intronic
1069666326 10:70162501-70162523 GAAGGGGAGGAGGGGATGGAAGG + Intronic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1070139167 10:73724224-73724246 ACTGGGAAGGGGAGCAGGGAGGG + Intergenic
1070156405 10:73838261-73838283 AGTGGGGAGGAGAGTCTGGGAGG + Intronic
1070167386 10:73909081-73909103 ACGGGGGAGGAGGGGGCGGAAGG + Intergenic
1070789295 10:79180107-79180129 ACAAGGGAAGAGGGGATGGAAGG + Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1070885489 10:79893144-79893166 ACTGAGGAGGAGAGGCTAGCAGG - Intergenic
1071122592 10:82296925-82296947 AGAGGGGAGGAAAGGAGGGAGGG - Intronic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072268851 10:93756035-93756057 TCTGTGGAGGAGGGAATGGAGGG - Intergenic
1072349883 10:94546060-94546082 ACTGAGGAGGAAAGGAGGGTTGG + Intronic
1072439912 10:95445350-95445372 ACAGGGGAGGACTGGATGCAGGG - Intronic
1072454997 10:95567688-95567710 AGAGGGGAGGGGAGGAAGGAAGG + Intergenic
1072532181 10:96329932-96329954 CCTGGGGAGGATGGGAAGGATGG + Intronic
1072761618 10:98061467-98061489 AGTGGGGAGGAGATGCAGGAAGG - Intergenic
1073206915 10:101774467-101774489 GCTGGGGAGGAGTGTATGAAGGG + Intronic
1073506165 10:103994001-103994023 ACTAGGGAGGATAAGGTGGAAGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074546888 10:114408202-114408224 AATGGGGAAGAGAGGACTGATGG + Intergenic
1074786391 10:116845622-116845644 ACTGGGGAGCTGACGATGGGAGG - Intergenic
1074841724 10:117359305-117359327 ACTGGGGAGGCTGGGATGGTAGG + Intronic
1075207735 10:120461640-120461662 ACAGGGGATGAGAGGAGAGAAGG + Intronic
1075224936 10:120620517-120620539 GAAGGGGAGCAGAGGATGGAAGG - Intergenic
1075376385 10:121981122-121981144 GCAGGAGAGGAGAGGTTGGAAGG - Intergenic
1075520960 10:123143234-123143256 GCTGGGGAGCGGAGGAAGGATGG + Intergenic
1075623773 10:123947155-123947177 ACTGGGGAAGGGAGGAGGGCAGG + Intergenic
1075777014 10:124995724-124995746 ACTGAGGAGGAGAGGCGTGATGG - Intronic
1075918685 10:126191483-126191505 ACTGGGAAGGAGGAGCTGGATGG + Intronic
1075925877 10:126251672-126251694 GATGGGATGGAGAGGATGGATGG + Intronic
1076227664 10:128793167-128793189 GATGGGGTGGAGAGGAAGGAAGG + Intergenic
1076375391 10:129980196-129980218 AGAGGAGAGGAGAGGAAGGAAGG + Intergenic
1076429901 10:130394543-130394565 ACTTGGGAGGGGAGCATGCACGG - Intergenic
1076488532 10:130840347-130840369 AGTGGGGAGGAGGGGATGGTAGG - Intergenic
1076488547 10:130840386-130840408 GGTGGGGAGGAGGGGATGGTAGG - Intergenic
1076488557 10:130840408-130840430 GGTGGGGAGGAGGGGATGGTAGG - Intergenic
1077127235 11:946203-946225 GCTGGGGAGAAGAGAATGGGAGG - Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077869918 11:6253072-6253094 GAGGGGGAGCAGAGGATGGAGGG - Intergenic
1077908587 11:6555174-6555196 ATGAGGGAGGAGAGGAGGGATGG - Intronic
1077971600 11:7198129-7198151 CCTGGGGAGGGAAGGAGGGAAGG - Intergenic
1078090168 11:8260087-8260109 ACTGGGCAGGAGAGGAGGCTGGG - Intronic
1078305862 11:10185561-10185583 ACTGGGGAGGCTGAGATGGAAGG - Intronic
1078334918 11:10455734-10455756 TCAGAGGAGGAGGGGATGGAGGG + Intronic
1078463047 11:11530079-11530101 GTTGGGGAGGAGGGGATGGAGGG - Intronic
1078627429 11:12970454-12970476 ACTTGAGAGTGGAGGATGGAAGG + Intergenic
1078949728 11:16116940-16116962 ACTGGGTAGGGGAGGGGGGATGG - Intronic
1078993245 11:16670321-16670343 ATTGGGGAGGAGGGGGTTGAAGG - Intronic
1079169857 11:18082738-18082760 ACTTGGGAGGCAAAGATGGAAGG - Intronic
1079448600 11:20579830-20579852 TAAGGGCAGGAGAGGATGGATGG + Intergenic
1079837814 11:25356042-25356064 ACTTGGGAGGATAAGATGGGAGG + Intergenic
1079962043 11:26936406-26936428 ACTGGAGAGGAGAGGAGGTGGGG + Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081759863 11:45569671-45569693 TCTGGGGAGGAGGGGAAGGGAGG + Intergenic
1081853960 11:46292210-46292232 ACTAGGGAGGAGCCGAGGGAAGG + Intronic
1082076459 11:47979893-47979915 ACACGGGAGGAGAGGAGGGTGGG + Intergenic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1083079626 11:60077159-60077181 ACTGGGGAGCAGGGGACGGGAGG + Intergenic
1083179744 11:60977471-60977493 AGTGCCGAGGACAGGATGGAGGG - Intronic
1083262639 11:61531455-61531477 CCTGGGGGGGGGAAGATGGAAGG + Intronic
1083998666 11:66284387-66284409 GCTGGGAAAGAGAAGATGGAAGG - Intronic
1084170137 11:67397025-67397047 GCTGGAGAGGAGAGGATGCAGGG - Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084378229 11:68792937-68792959 ACTGGGGAGGCTAAGATGGGAGG + Intronic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1084579286 11:70012862-70012884 ACTGTGAATGAAAGGATGGATGG - Intergenic
1084775855 11:71374577-71374599 ACTGGGTAGGTTAGGATAGAGGG + Intergenic
1084937623 11:72595517-72595539 AGAGGGGAGGAGAGGGGGGAGGG - Intronic
1084979374 11:72821220-72821242 CCTGGTGTGGTGAGGATGGAAGG + Intronic
1086049905 11:82577557-82577579 ACTGGGGAAGCGGGGCTGGAGGG + Intergenic
1086121445 11:83308539-83308561 ACTAGGGAGGGTAGGATGGAAGG + Intergenic
1086935444 11:92741148-92741170 ACTGGGGAGGCTAAGGTGGAAGG - Intronic
1087905838 11:103696166-103696188 GCTGGGGAGGGGAGGGAGGAGGG - Intergenic
1088223323 11:107591620-107591642 AATTGGGAGGACAGGATAGAAGG - Intronic
1088391896 11:109323812-109323834 ACAGGGGAGGGAAGGAAGGAAGG - Intergenic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1089149531 11:116354142-116354164 AGGAGGCAGGAGAGGATGGAAGG - Intergenic
1089390115 11:118095867-118095889 AGTGGGCAGGACAGGCTGGAGGG + Intronic
1089714128 11:120339903-120339925 ACTGGGGAGTAAAAGATGAAGGG - Intronic
1089949754 11:122514695-122514717 TCTGCCGTGGAGAGGATGGATGG + Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1090077086 11:123586385-123586407 ACTTGGGATGAGAGGGTGGAAGG - Intronic
1090102278 11:123811967-123811989 ACTAGGGGGGAAAGGAGGGAGGG - Intergenic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090395359 11:126414929-126414951 GGTGGGGAAGAGAGGAAGGAAGG - Intronic
1090860962 11:130651916-130651938 TTTGGGGAGGAGAGGATAGTGGG + Intergenic
1091002693 11:131923838-131923860 ACTGGGGATGGGAGGAGGGTCGG - Intronic
1091391466 12:128786-128808 AATGTGGAGGTGAGGTTGGAAGG - Intronic
1091847198 12:3666418-3666440 ACTGGGGAGCTAAGGATGGGAGG + Intronic
1092096636 12:5848351-5848373 ACTGGGGAGGGGGGGAAGTAGGG - Intronic
1092214657 12:6672535-6672557 GCCGGAGAGGAGAGGAGGGAAGG + Intronic
1092236606 12:6814549-6814571 ACTGGGGAAGAGAGGATGAGGGG + Intronic
1092429605 12:8397889-8397911 ACTGGGGAGGCCGGGGTGGAAGG + Intergenic
1093675021 12:21928253-21928275 AGGGGAGGGGAGAGGATGGAAGG + Intronic
1093897656 12:24592928-24592950 GGTGGGGAGGAGAGAAGGGAGGG + Intergenic
1093963382 12:25300558-25300580 ACTGGGGAGAAGAGGGTGGGGGG - Intergenic
1094399613 12:30047851-30047873 ACTGGGGGAGAGAGGGTGGTTGG - Intergenic
1094724017 12:33093810-33093832 ACTGAGGAGGGGAGGAAGGAGGG - Intergenic
1094809442 12:34123556-34123578 ACTGGGGTGGGGAGGGGGGAGGG - Intergenic
1095945213 12:47749713-47749735 ACTGGGGTGGGGAGGAGGGAGGG + Intronic
1096093748 12:48920628-48920650 ACTGGGGAGGCTGAGATGGAAGG - Intronic
1096651703 12:53065079-53065101 ACTGGTAAAGAAAGGATGGAAGG + Exonic
1096672916 12:53210904-53210926 TCTGGGGAGTAAAGGGTGGAAGG + Exonic
1096712131 12:53465201-53465223 ACAGGGAGGGAGGGGATGGAAGG - Intronic
1096777747 12:53974304-53974326 AGTGGGGAGGAGGGGAGGGGTGG + Intronic
1097102291 12:56598270-56598292 ACAGGGGAGGAGAGGAAGCAGGG + Exonic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097125362 12:56770293-56770315 TCTGGGAAGGAGAGGAGAGAAGG - Intronic
1097179476 12:57163043-57163065 AGTGGGGAGGGGAGGATCCAGGG + Intronic
1097322624 12:58243421-58243443 AATGGGGAGGATGGGAGGGAGGG - Intergenic
1097588494 12:61544231-61544253 ACTGATGAAGAGATGATGGAGGG + Intergenic
1097981497 12:65741608-65741630 AGTGGAGAGGAGAGGAGGGGAGG + Intergenic
1098262536 12:68685519-68685541 ACGGGGGAGGAGAGGAGGTCAGG + Intergenic
1098863547 12:75736426-75736448 ACCAGGGAGGTGAGGCTGGATGG - Intergenic
1098911678 12:76215363-76215385 ACTGGGGATGAGATGCTGGTAGG - Intergenic
1100011309 12:89956950-89956972 AGAGGAGAGGAGAGGAAGGAAGG - Intergenic
1100040857 12:90315021-90315043 ATTGGGGAGAAGAGTATGTAGGG - Intergenic
1100356241 12:93833445-93833467 ACTTGGGAGGCCAGGGTGGAAGG - Intronic
1100484459 12:95011484-95011506 ACTTGGGAGGCTAGGATGGGAGG - Intergenic
1100534130 12:95490645-95490667 ACTTGGGAGGATAAGATGGGAGG - Intronic
1100601070 12:96111834-96111856 ACGAGGGAGGAAAGGAAGGAAGG - Intergenic
1100991840 12:100259786-100259808 TCTGGGGAGGAGGGAATGAAAGG + Intronic
1101713537 12:107290405-107290427 ACTGGGGAGGAGACTAAGGCAGG - Intergenic
1101799530 12:108008739-108008761 TCTGGGGAGGAGAGAGGGGAGGG - Intergenic
1101930254 12:109007927-109007949 ACTGGGGAGGATGAGATGGAAGG + Intronic
1102116903 12:110409749-110409771 CCTGGGGAGGAGAGGTCAGATGG + Intergenic
1102383679 12:112488584-112488606 TCTGGGGAAGAGAGGTTGAATGG + Intronic
1102391982 12:112556700-112556722 AGAGAGGAGGAGAGGATGAAGGG + Intergenic
1102462782 12:113110202-113110224 GCTGGGGAGGAGGGGGAGGAGGG + Intronic
1102553123 12:113706660-113706682 ACTGGGGGACAGAGGAGGGAGGG + Intergenic
1102753411 12:115316451-115316473 AAAGGAGAGGAGAGGAAGGAAGG + Intergenic
1102789843 12:115635925-115635947 AAGGGGGAGGGGAGGAGGGAGGG + Intergenic
1102853990 12:116277623-116277645 ACTGGGGAGGAGGGGGGGGTGGG - Intergenic
1103102367 12:118189756-118189778 GATGGGGAGGAGGGGAAGGAAGG + Intronic
1103345680 12:120248551-120248573 ACTGGGGAGGAGGGAAGAGAGGG - Intronic
1103597928 12:122035442-122035464 GCTGGGCAGGAGAGGCTGGCAGG - Intronic
1104400316 12:128470529-128470551 CCAGTGGAGGAGAGGATGTAAGG + Intronic
1104462796 12:128969303-128969325 ACAGGAGAGGAGGGGAGGGAGGG - Intronic
1104463324 12:128971730-128971752 AGGGGGGAAGGGAGGATGGAGGG - Intronic
1104483499 12:129129136-129129158 ACTAGGGAGGAGAAGGAGGAAGG - Intronic
1104610062 12:130220344-130220366 GCTGGGCTGGAGAGGAGGGAAGG + Intergenic
1104623091 12:130333022-130333044 ACTGGGAAGGAGAGGAGAAAAGG + Intergenic
1104703872 12:130928080-130928102 ACTGGGGAGGCTAAGGTGGAAGG + Intergenic
1104936876 12:132369506-132369528 ACTGCGGAAGAGAGTGTGGAAGG - Intergenic
1104963096 12:132497525-132497547 TCTGGGTAGGGGAGTATGGAGGG - Intronic
1105481945 13:20785856-20785878 ACGGGGGAGGAAAGGAGGGAGGG + Intronic
1105631271 13:22171244-22171266 ACTGGGGAAGAGAGGATTCTTGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105986824 13:25575696-25575718 CATGGGGAGGGGAGGAGGGATGG + Intronic
1106575299 13:30968850-30968872 ACAGGGGAGGAGAGGTCGGAAGG - Intronic
1106586583 13:31062243-31062265 ACAGGTGAGGAGAGGATGCAGGG + Intergenic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1107668568 13:42718385-42718407 AGTGGGGAGGATAGGGAGGAAGG + Intergenic
1108006361 13:45950714-45950736 TCAGGGGAGGAGAGGAGGAAGGG + Intergenic
1108238462 13:48434721-48434743 ACAGGGGTAGAGAGGCTGGAGGG - Intronic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109154882 13:58896375-58896397 GATGGGGAGGGAAGGATGGATGG + Intergenic
1109227532 13:59714424-59714446 ACTTGGGAGGTGAAGGTGGAAGG + Intronic
1109734588 13:66466184-66466206 GGAGGGGAGGAGAGGAGGGAGGG - Intronic
1110062069 13:71054861-71054883 ACTGACCAGGAGAGAATGGATGG - Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1111048455 13:82846891-82846913 AGAGGGGAGGAAAGGAAGGAAGG + Intergenic
1111260906 13:85738449-85738471 ACTGGAGGGGAGAGGGTGGGAGG + Intergenic
1111519837 13:89386219-89386241 ACTGGGGAGGCTAAGATGGGAGG - Intergenic
1111533824 13:89575713-89575735 ACTGAGGAGAGGAGGAAGGAGGG - Intergenic
1112376628 13:98848321-98848343 AGTTTGGACGAGAGGATGGAAGG + Intronic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441487 13:99427315-99427337 AGGAGGGAGAAGAGGATGGAAGG + Intergenic
1112470027 13:99679719-99679741 AATGGGAAGGAGAGGGTGGGGGG + Intronic
1113049647 13:106196252-106196274 ACTGGGAAGGATAGGAAGGAGGG + Intergenic
1113093138 13:106635851-106635873 ACGAGGGAGCAGAGGCTGGACGG - Intergenic
1113294687 13:108946136-108946158 AATGGGGAGGAGGGAAGGGATGG - Intronic
1113677714 13:112218816-112218838 AGAGGAGAGGAGAGGAAGGAAGG + Intergenic
1113784439 13:112995013-112995035 ACAGGACAGGAGGGGATGGAGGG - Intronic
1114258536 14:21021974-21021996 ACTGGGGAGGAGGAAAGGGAGGG - Intronic
1114277240 14:21157933-21157955 ACTGGGGTGGAGTGGTGGGATGG + Intergenic
1114511161 14:23262322-23262344 AAGGTGGATGAGAGGATGGAGGG + Intronic
1114650940 14:24284340-24284362 ACTGGGCAGGGCAGGGTGGACGG - Intergenic
1114773570 14:25455993-25456015 CCTGGGGAGGAAAGGAAGGAAGG - Intergenic
1114822065 14:26032613-26032635 TGTGGGGATGAGAGGATGGGAGG - Intergenic
1115119105 14:29918618-29918640 ATTGGGGAGGAGAGGACTGAAGG - Intronic
1115238293 14:31229724-31229746 ACTGGGGAGGAGCAGAGGGGTGG - Intergenic
1115399682 14:32941779-32941801 ACTGTGGAAGATAGGAAGGAAGG + Intronic
1115426826 14:33270158-33270180 ACTAGGAAGGAGAGGGTGGTAGG - Intronic
1115663586 14:35522682-35522704 ACTGGGGAGGCTAAGGTGGAAGG + Intergenic
1115773209 14:36687753-36687775 AGTGGCCAGGAGAGGATGAACGG - Intronic
1115835130 14:37393846-37393868 ACTTGGGAGGAGGGGTGGGAGGG - Intronic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1116323692 14:43502854-43502876 ACTGGAGAGGAGCGGAGGGGAGG + Intergenic
1116496959 14:45572674-45572696 ACTTGAGAGGGGAGGATGGGAGG - Intergenic
1116754288 14:48926284-48926306 ACTAGGGATGATGGGATGGAAGG + Intergenic
1116948648 14:50858836-50858858 ACTGGGGAGGCCAAGGTGGAAGG + Intronic
1116962074 14:50977103-50977125 ACAGCGGAGGAGAGGTTGAAAGG + Exonic
1117061396 14:51967184-51967206 AATGGGGAGGGGTGGAAGGAGGG - Exonic
1117067657 14:52026412-52026434 ACTGGGGATGAGAGAATGGTGGG - Intronic
1117402772 14:55372614-55372636 ACTGGGGAAGAAAGGAAGGGAGG - Intronic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1119395487 14:74323249-74323271 TCTGGGGAGTAGAGGTTTGAAGG + Intronic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119773919 14:77237048-77237070 ATTAGGGGTGAGAGGATGGAGGG - Intronic
1119780780 14:77275596-77275618 TGTGGGGAGGAGAGGAAGGGAGG + Exonic
1119780790 14:77275665-77275687 GCAGGGAAGGAGAGGAGGGATGG - Exonic
1119894490 14:78208444-78208466 AAGGGGGAGGAGAGGTGGGAAGG - Intergenic
1120854861 14:89203524-89203546 TCTGGGAAGGAGGGCATGGAGGG + Intronic
1121096647 14:91222064-91222086 ACAGGGCAGGAGAGGAGGAATGG - Intronic
1121102209 14:91257594-91257616 ACTGGAGATCAGAGGATGGGAGG + Intergenic
1121447591 14:93988425-93988447 AGATGGGAGGAGAGGATGGGAGG + Intergenic
1121736529 14:96221789-96221811 ACTGGAGAGGAGAGAGAGGAAGG + Intronic
1121854440 14:97253944-97253966 CCTGGGGAGGAGAGGAGAGTTGG + Intergenic
1121892665 14:97610062-97610084 AGTGGGGAGGAAAGGATAGGGGG - Intergenic
1121912792 14:97807120-97807142 ATTGGGGAGCAGAGGAGGAAAGG + Intergenic
1122263853 14:100537818-100537840 GCTGGGGAGGAGAGGAGGTGCGG + Exonic
1122799839 14:104224000-104224022 ACAAGAGAGGAGAGGAGGGAGGG - Intergenic
1124001935 15:25767323-25767345 ACCAGGAAGCAGAGGATGGATGG + Intronic
1124516431 15:30370590-30370612 ACTGGGCAGGGAAGGTTGGAAGG - Intronic
1124627867 15:31319549-31319571 AAAGGGGAGGAAAGGAGGGAAGG - Intergenic
1124726487 15:32160141-32160163 ACTGGGCAGGGAAGGTTGGAAGG + Intronic
1124957053 15:34366739-34366761 ACTGAGTAGGTGGGGATGGAGGG - Intronic
1125361713 15:38871536-38871558 ACTGGGGAGGCTAAGGTGGAAGG - Intergenic
1125416354 15:39457710-39457732 AGCAGGGAGGAGCGGATGGAGGG - Intergenic
1125516152 15:40322565-40322587 AATGGGGAGGAGAGAAGGCAGGG + Intergenic
1125520925 15:40347466-40347488 ACTGGGCAGCAGCGGCTGGAAGG + Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1125722869 15:41853483-41853505 GCTGGGGAGCAGGGGAGGGAGGG + Intronic
1126672339 15:51127750-51127772 GCTGTGGGGGAGAGGATAGAGGG + Intergenic
1127256400 15:57297264-57297286 GCTGGGGAAGAAAGGTTGGATGG + Intronic
1127401823 15:58594676-58594698 ACTGGGGAGGGAGGGATGGAGGG + Exonic
1127426725 15:58865323-58865345 ACGGGGGAGGGGAGGAGGCAGGG + Intronic
1128365292 15:66995719-66995741 AGTGGGAAGGAGAGGAGAGAAGG - Intergenic
1128372116 15:67048092-67048114 GCTGGGGATGAGAAGAGGGAGGG - Intergenic
1128707875 15:69850835-69850857 AGGGGTGAGGAGAGGATGGGAGG - Intergenic
1129461558 15:75702505-75702527 ACGTGGGAGGAAAGGAGGGAGGG + Intronic
1129908544 15:79207148-79207170 CCTGGAGTGGAGAGGAGGGAAGG - Intergenic
1129963382 15:79710381-79710403 ACATGGTAGGAGAGGATGCATGG + Intergenic
1130028381 15:80289770-80289792 ACTAGGGAGGAGAAGCAGGAGGG + Intergenic
1130146183 15:81275349-81275371 ACGGGGGAGGAGGGGGGGGAGGG + Intronic
1130744464 15:86636049-86636071 ACTGAGGAGGAGATGATTTAGGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1130908682 15:88256803-88256825 ACGAGGGAGGGGAGGAGGGAGGG - Intergenic
1131273289 15:90959828-90959850 GATGGGGAGGAGAGTTTGGATGG + Intronic
1131429871 15:92378215-92378237 AATGGGCAGGAGAGGAGGCAGGG - Intergenic
1132567953 16:631753-631775 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132567977 16:631841-631863 AGTGGATAGGAGAGGATGGAAGG - Intronic
1132567994 16:631913-631935 AGTGGATAGGAGAGGATGGAAGG - Intronic
1132568009 16:631985-632007 GGATGGGAGGAGAGGATGGAAGG - Intronic
1132568047 16:632122-632144 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132568055 16:632148-632170 GGGTGGGAGGAGAGGATGGAAGG - Intronic
1132708706 16:1257168-1257190 ACTGTGGAGGCCAGGATGGATGG + Intronic
1132929138 16:2449788-2449810 CCAGGGGTGGAGGGGATGGAGGG - Intronic
1133073428 16:3262045-3262067 ACGGAGGAGGAGTGGATGGAGGG + Intergenic
1133117916 16:3588845-3588867 ACTGTGGAGGGGAGTCTGGAAGG + Intronic
1133263992 16:4572151-4572173 ACTGGGGTAGAAAGCATGGAGGG - Intronic
1133440241 16:5815342-5815364 ACAGGGGATGGGAGGATAGAAGG - Intergenic
1133456115 16:5943905-5943927 ACAGAGGAGGAGTGGATGGATGG - Intergenic
1133517278 16:6521525-6521547 AGAGGAGAGGAGAGGAAGGAGGG - Intronic
1133740253 16:8645900-8645922 ACTGTGGCAGAGAGGCTGGATGG - Intronic
1134096428 16:11421765-11421787 ACCAGGGAGGAGGGGATGGGAGG + Intronic
1134124915 16:11610032-11610054 ACTAGGGTGGGGAGGATTGAAGG - Intronic
1134242455 16:12515994-12516016 GCAGGGGAGGGGAGGATGGCAGG + Intronic
1135110925 16:19690315-19690337 AGTGGGGAGGGAAGGAGGGAGGG + Intronic
1135302858 16:21345803-21345825 AGGGGGGAGGGGAGGAGGGAGGG - Intergenic
1135318103 16:21468320-21468342 AGTGGGGGGGAGAGGGCGGAGGG + Intergenic
1135634118 16:24059556-24059578 ACTGGGGAGGCTAAGGTGGAAGG + Intronic
1136075065 16:27811613-27811635 AATTGGGAGCTGAGGATGGATGG - Intronic
1136171773 16:28494382-28494404 ACTGGGGAGGGGGAGAGGGAGGG - Intronic
1136413394 16:30090141-30090163 TCAGGGGAGGAGAGGAGGGTGGG - Intronic
1136671449 16:31862255-31862277 ACTGGAGAGTAGAAGATGGGGGG - Intergenic
1137366537 16:47864388-47864410 ATTGGAAAGGAGAGGAAGGAAGG + Intergenic
1137551648 16:49441543-49441565 TCCGGGGAGGGCAGGATGGAGGG - Intergenic
1137715755 16:50597292-50597314 ACTGGGGAGGACAGGTTTGGGGG + Intronic
1137736845 16:50731059-50731081 ACTTGGGAGGCTGGGATGGAAGG + Intronic
1137943055 16:52707842-52707864 ACTTGGGGGGAGGGGAAGGAAGG - Intergenic
1138622685 16:58224418-58224440 ACTGGCGAGGAGTGGATGGGAGG + Intergenic
1138639192 16:58369445-58369467 ACTCGGGAGGCTAAGATGGAAGG - Intronic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1138828571 16:60351387-60351409 GATGGGGAGGGGAGGATGGGGGG + Intergenic
1138944483 16:61831273-61831295 ACTGGGGAGTAGAAGATTAAGGG + Intronic
1139141780 16:64272807-64272829 ACTGTGGAAGGAAGGATGGATGG + Intergenic
1139278534 16:65750054-65750076 AGAGGGAAGGAGAGGAGGGAAGG + Intergenic
1139278542 16:65750096-65750118 AGAGGGAAGGAGAGGAGGGAAGG + Intergenic
1139472675 16:67186693-67186715 AGTGGGGAGGAGAGGAAGGAGGG - Intronic
1139968138 16:70756830-70756852 ACTCAGGAGGAAAGGATGGTAGG - Intronic
1139972317 16:70783775-70783797 CCAGGGGAGAAGGGGATGGATGG + Intronic
1140126089 16:72120091-72120113 TGTGGGAAGGAGAGGAAGGACGG + Intronic
1140204476 16:72922303-72922325 GATGGTTAGGAGAGGATGGAGGG - Intronic
1140250171 16:73288208-73288230 GCTGGGGTGGAGAGGTGGGAAGG + Intergenic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1140972386 16:80025666-80025688 AAGGGTGGGGAGAGGATGGAAGG + Intergenic
1141136307 16:81467993-81468015 ACTGGGGAGGCTGGGATGGGAGG - Intronic
1141179351 16:81742031-81742053 GCTGGGAAGGGGAGGAGGGAGGG - Intronic
1141413527 16:83852914-83852936 ACTGGGGAGGAGAGGTGAGAAGG - Intergenic
1141815850 16:86408829-86408851 AGTAGGGAGGTGAGGCTGGAGGG - Intergenic
1141979903 16:87543604-87543626 ACTGGGCAGGAGAGGGCCGAGGG + Intergenic
1142030672 16:87836867-87836889 AGGAGGGAGGAGAGGAGGGAAGG + Intronic
1142090853 16:88208460-88208482 TAAGGGGAGGAGAGGAGGGAGGG + Intergenic
1142305136 16:89280469-89280491 ACGGGGCAGGAGAGGCGGGAGGG + Exonic
1142475013 17:183505-183527 ACTGAGGAGGAGGGGAAGGAGGG + Intergenic
1142605530 17:1079026-1079048 CGTGGCGAGGAGAGGAGGGAAGG + Intronic
1142836472 17:2591645-2591667 ACTGGGGAGGATGAGATGGGAGG - Intergenic
1143023410 17:3928132-3928154 AGTGGAGAGGACAGGATGGCAGG - Intronic
1143234672 17:5388929-5388951 GCAGGGGAGGAGACGCTGGATGG + Exonic
1143340077 17:6203892-6203914 AGTGAGTAGGAGAGAATGGACGG - Intergenic
1143398518 17:6623776-6623798 ACTGGGGACGAAGGGATGGAAGG - Intronic
1143550424 17:7627309-7627331 GCTGGGGAGGAAATGAGGGATGG - Intronic
1143754965 17:9060182-9060204 GCTGAGGAGGAGAGGAGGGGTGG - Intronic
1145019233 17:19416647-19416669 GCTGGGGATGACAGGAAGGAAGG + Exonic
1145816156 17:27796550-27796572 ACTGGGGAGCTGAGGAAGGCTGG + Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1146332220 17:31937083-31937105 AGGGAGGAGGAGAGGAGGGAAGG - Exonic
1146582024 17:34046896-34046918 ATTGGGAGGGAGAGGATTGAAGG - Intronic
1146604481 17:34246522-34246544 ACTGGGGAGGAAAGGAAGCCAGG + Intergenic
1146688406 17:34856856-34856878 ATGGGGGTGGGGAGGATGGAGGG + Intergenic
1147192547 17:38746551-38746573 TCTGGGGACCAGAGGCTGGAGGG + Intronic
1147413248 17:40269400-40269422 ACTTGGGAGGCTAGGATGGGAGG + Intronic
1147598525 17:41732200-41732222 GGTGGGGAGGAGAGGATAGCGGG - Intronic
1147674117 17:42193126-42193148 CCTGGGGTAGAGAGGATGTAAGG + Intronic
1147905814 17:43822407-43822429 ACTGTTGAGCAGAGAATGGAAGG - Intronic
1148201432 17:45752528-45752550 ACTGAAAAGGAGAGAATGGAAGG - Intergenic
1148743190 17:49904391-49904413 ACTGGGGAGGGAAGGGAGGACGG - Intergenic
1149494276 17:57107125-57107147 ACTTGGGGGCTGAGGATGGATGG + Exonic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1149631448 17:58128198-58128220 GCTGGGGAGGCTAGGGTGGAAGG - Intergenic
1149642169 17:58210098-58210120 ACCAGGGAGGAGAGGTTTGAGGG + Intronic
1149642618 17:58213746-58213768 ACAGGTGAGGAGAGGAAGAAAGG - Exonic
1150141636 17:62734925-62734947 TCTGGGGAGGTGAGGATTGGTGG + Intronic
1150225179 17:63520772-63520794 GATGGGGAGGACAGGAAGGAGGG + Intronic
1150508114 17:65719914-65719936 GGTGTGGAGGAGAGGTTGGAAGG + Intronic
1150680369 17:67279665-67279687 AGTGGGGAGGAGGGGGTGCAGGG + Intergenic
1150859469 17:68786392-68786414 GGAGGGGAGGAGAGGAAGGAAGG - Intergenic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151347564 17:73511534-73511556 TCTGGGGAGGAGGAGAGGGAAGG + Intronic
1151654625 17:75490169-75490191 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1151674892 17:75592313-75592335 ACTGGGCAGGGGTGGATAGAAGG - Intergenic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1152239588 17:79154489-79154511 AGTGGGGAAGGGTGGATGGAGGG + Intronic
1152400809 17:80065164-80065186 AGAGGGGAGGAGAGGGAGGAGGG - Intronic
1152576012 17:81141204-81141226 ACTTGGGAGGCCAAGATGGATGG + Intronic
1152622679 17:81373055-81373077 AATGGGGAGGGGAGGAGAGATGG - Intergenic
1152753719 17:82078227-82078249 ACTGGGGACCAGAGGACAGAGGG + Intergenic
1152793814 17:82296912-82296934 AGGGGGGTGGAGAGGAGGGAGGG - Intergenic
1153162995 18:2229716-2229738 ACTCGGGGGGAAAGGATGGGAGG + Intergenic
1153364118 18:4234942-4234964 ACAAGGGAGGGGAGGAAGGAAGG - Intronic
1153824059 18:8858536-8858558 ACTGGGGAGGAAGGAATGGTGGG + Intergenic
1154033346 18:10773516-10773538 CCTGGGGAGGAGAAGCTTGAGGG - Exonic
1154218270 18:12431535-12431557 ACGGGGGCGGAGAGGCTGGAGGG - Exonic
1154306590 18:13234856-13234878 ATTTGGGAGGAGAGAATGGAAGG - Intronic
1154402024 18:14048447-14048469 ACTTGAGAGGAGAGGGTGGGAGG - Intergenic
1154954822 18:21242893-21242915 GGTGGCGGGGAGAGGATGGATGG + Intronic
1155614579 18:27706423-27706445 ACTGGGGTGGGGAGGTTGGGAGG - Intergenic
1155749679 18:29405878-29405900 TTTGGGGAAGAGAGGTTGGAAGG + Intergenic
1156257431 18:35411118-35411140 AATGAGGAGGAGGAGATGGAAGG + Intergenic
1156353680 18:36322787-36322809 AATGGGGAGGAGAAGGTAGAGGG - Intronic
1156545193 18:37957221-37957243 AATGGGAAGGAGAGGAAGGCAGG - Intergenic
1156644263 18:39140880-39140902 ACTTGGGAGGTGAGCATGCACGG - Intergenic
1156921942 18:42532683-42532705 GCTGGGGAGGAGACTTTGGAGGG + Intergenic
1156971143 18:43158081-43158103 ACAGGGAAGGAGAGGATGTTAGG + Intergenic
1157298782 18:46464775-46464797 ACTGGGGAGGAGAGAGAGCAAGG - Intergenic
1157445418 18:47742971-47742993 ACAGGGGAGGAGATGGAGGAAGG + Intergenic
1157475370 18:48020650-48020672 AGAAGGGAGGACAGGATGGAGGG - Intergenic
1157475410 18:48020769-48020791 AGAAGGGAGGAGAGGAGGGAGGG - Intergenic
1157475432 18:48020844-48020866 AGAAGGGAGGAGAGGAGGGAGGG - Intergenic
1157475494 18:48021064-48021086 AGAAGGGAGGAGAGGAGGGAGGG - Intergenic
1157475517 18:48021138-48021160 AGAAGGGAGGAGAGGAAGGAGGG - Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158480060 18:57814241-57814263 GCTGAAGAGGAGAGGAAGGAGGG - Intergenic
1159384865 18:67710359-67710381 AGTGAGGTGGAGAGGCTGGAGGG - Intergenic
1159481317 18:68994511-68994533 ACGGGGGAGGAGGGGGTGGCAGG - Intronic
1160133020 18:76246495-76246517 ACAGCTGAGGAGAGAATGGAAGG - Intergenic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160394019 18:78559016-78559038 GCTGGGGAGGAGGGGGTGGGAGG - Intergenic
1160442232 18:78901719-78901741 ACTGGGGAGGAGGGGCAGGCTGG - Intergenic
1160673375 19:376828-376850 ACGGGGGGGGAGAGGCTGGGTGG - Intergenic
1160774944 19:851056-851078 ACAGACGAGGAGAGGATGGAAGG + Intronic
1160807472 19:998751-998773 ACTGGGGAGGGACGGAGGGAGGG - Intergenic
1160826305 19:1082085-1082107 CCTGGGGAGGACAGGGTGGGCGG + Intronic
1160954075 19:1681899-1681921 ACTGGGGAGGCTGAGATGGAAGG + Intergenic
1161022211 19:2015722-2015744 GCGGGGGAGGGGAGGAGGGAAGG + Exonic
1161079262 19:2302545-2302567 GCTGGGGAGGGGAGGCAGGAAGG - Intronic
1161330122 19:3682966-3682988 GAGGGGGAGGAGAGGAGGGAGGG - Intronic
1161599175 19:5170440-5170462 CCAGGGGAAGAGAGGAAGGAGGG + Intronic
1161848526 19:6726269-6726291 TCTGGGAATGAGAGGAAGGAAGG - Intronic
1162363154 19:10231374-10231396 AAAGGGGAGGAGAGGAGGGCGGG - Intergenic
1162844778 19:13383921-13383943 ACTTGGGAGGACAAGGTGGAAGG - Intronic
1163463396 19:17452700-17452722 AGTGGGGAGGTGGGGATGGGGGG + Intronic
1163540923 19:17909693-17909715 TCTGGGGAGAATAGGATGTAGGG - Intergenic
1163654631 19:18538550-18538572 ACTGAGGAGGGAATGATGGAGGG - Intronic
1163687143 19:18718149-18718171 GCTGGGGAGGAGAGGAGGGGAGG - Intronic
1163730479 19:18946538-18946560 CTTGGGGAGGAGAGCATTGAAGG - Intergenic
1164202586 19:23030882-23030904 TCTGGGGAGGAGAGGTCAGATGG + Intergenic
1164323929 19:24176130-24176152 ACTGTGGTGGAGAGGGGGGAAGG - Intergenic
1164550271 19:29204957-29204979 AGTGGAGAGGAGATAATGGATGG + Intergenic
1164556404 19:29256038-29256060 ACTGAGGAGGGGATGAAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164696297 19:30247084-30247106 ACTGGGGAAGAGAGGTTGGGAGG - Intronic
1165031101 19:32998827-32998849 TGAGGGGAGGAGAGGAAGGAGGG + Intronic
1165176132 19:33931185-33931207 ACAGGGGACGAGAGAATGGCAGG + Intergenic
1165240402 19:34462214-34462236 ATTAGGGAGGAGGGGATTGAGGG + Intronic
1165271335 19:34710308-34710330 ACTTGGGAGGCTAAGATGGATGG + Intergenic
1165320001 19:35079432-35079454 GGTGGGGAGGAGAGGAGGGCAGG - Intergenic
1165414051 19:35680399-35680421 ACTGGGGAGGCTGAGATGGAAGG + Intergenic
1165467097 19:35981427-35981449 ACTTGGGAGGCAAGGATGGGAGG - Intergenic
1165667738 19:37648243-37648265 GCTGGGAAGGTGGGGATGGAGGG - Intronic
1165893751 19:39129720-39129742 ACAGGAGAAGAAAGGATGGAAGG + Intronic
1166012625 19:39954091-39954113 ACTTGGGAGGCTAAGATGGAAGG - Intergenic
1166102238 19:40577527-40577549 AAAGGGGGGCAGAGGATGGATGG - Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166336256 19:42109488-42109510 AATGAGGAAGGGAGGATGGATGG + Intronic
1166571395 19:43799108-43799130 TCTGGGGGTGAGAGGAAGGAGGG - Intronic
1166693390 19:44838069-44838091 ACAGAGGATCAGAGGATGGAGGG + Intergenic
1166808617 19:45501736-45501758 ACTGGGGAGGACAGGCTGCTGGG - Intronic
1166887279 19:45969781-45969803 ACTTGGGTGAAGAGGTTGGACGG - Intronic
1167284147 19:48589302-48589324 ACTGGGAAGGGGAGGAGGGAGGG + Intronic
1167419365 19:49394175-49394197 GCTGGAGAGGAGAGGAGGAAAGG + Intronic
1167448819 19:49555649-49555671 ACAGGGCAGGCGAGGATGCAGGG - Intergenic
1167686339 19:50959066-50959088 GCTGGGCAGGAGAGGAGGGGAGG + Exonic
1168063982 19:53909258-53909280 ACTGCGGAGGAGGGGAGGGGCGG - Intergenic
1168103053 19:54151300-54151322 GCTGGTGAGGACAGGATAGAGGG + Intronic
1168409125 19:56127609-56127631 ACGTGGAAGGAGAGGACGGAAGG + Intergenic
925073182 2:987487-987509 AGAGGAGAGGTGAGGATGGAAGG + Intronic
925281403 2:2687877-2687899 ACAGGGGAGGAGAGGCTGCCAGG - Intergenic
925450859 2:3968298-3968320 AGGGGAGAGGAGAGGAGGGAAGG + Intergenic
925459764 2:4050266-4050288 ACTGGGGACCAGAGAATGGGTGG + Intergenic
925565140 2:5244347-5244369 AAGGGGCAGGAAAGGATGGAGGG - Intergenic
925610162 2:5695967-5695989 GCCGGGGAGGGGCGGATGGAGGG + Exonic
925611567 2:5706368-5706390 ACTGGGGTGGAGAAGCTGGGAGG + Intergenic
925642234 2:5996729-5996751 ACTCTGGAGGATAAGATGGAAGG + Intergenic
926020198 2:9487940-9487962 ACTTGGGAGGCGAAGATGGGAGG - Intronic
926063375 2:9819076-9819098 ACTGGGGAGGGGAGGCGGGCGGG - Intergenic
926230831 2:11002670-11002692 GGTGAGGAGGAGAGGAGGGAAGG + Intergenic
926268586 2:11347130-11347152 ACTGGGGAGTAGAGGACAGCAGG - Intronic
926320581 2:11746330-11746352 ACTGGGGGAGTGAGGACGGAGGG - Intronic
926761902 2:16285467-16285489 GCCTGGGAGGAGAGGGTGGAGGG + Intergenic
926850174 2:17187950-17187972 ACTGAGGATGGAAGGATGGATGG + Intergenic
926904098 2:17789963-17789985 AGTGGGGAGAAAATGATGGATGG - Intronic
927209343 2:20629285-20629307 ACCAGGGAGGAGAGGATTGAGGG - Intronic
927371734 2:22363372-22363394 AGAGGAGAGGAGAGGATGGGAGG + Intergenic
927422970 2:22952324-22952346 ACTGTGGAGGAGAGAATGAATGG + Intergenic
927488467 2:23505048-23505070 AGAGGGGAGGAGAGGATTTAAGG - Intronic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927886418 2:26721391-26721413 TTGGGGGAGGAGAGGAGGGAGGG - Intronic
928367818 2:30716222-30716244 ACAGAGGAGGGGAGGGTGGACGG - Intergenic
928974007 2:37064393-37064415 ACTGGGGAGGATGGGTTGGAAGG - Intronic
929051191 2:37838355-37838377 ACCAGGGAGGAGAGGATAGCTGG + Intergenic
929078441 2:38097720-38097742 GCTGGGAAGGAGAGGCTGGGTGG - Intronic
929114610 2:38433758-38433780 ACTGGTGAGTAGAGGATGAATGG - Intergenic
929127182 2:38532754-38532776 GCTGTGGAGAAGAGGATGGGAGG - Intergenic
929241640 2:39659591-39659613 ACTTGAGTGGGGAGGATGGAAGG - Intergenic
929272867 2:39992657-39992679 AAAGGGGAGGAAAGGAAGGAAGG + Intergenic
929504904 2:42520877-42520899 ACTGGGGTGGAGAGGCTAGGTGG - Intronic
929526360 2:42706960-42706982 GCTGGGGAGGGGAAGAGGGAGGG - Intronic
929676135 2:43931890-43931912 ACTGAGAAGGAAAGGAAGGAGGG - Intronic
929747779 2:44676683-44676705 ACTGGCATGGAGAGGACGGAAGG + Intronic
929765380 2:44839687-44839709 CCAGGGGAGGAGAAAATGGAAGG - Intergenic
929868556 2:45738436-45738458 ACAGTGGAGGAGAGGAGGAAGGG - Intronic
929872511 2:45771109-45771131 ACTGGGGAGTAGAGAATGCAGGG + Intronic
929967072 2:46543533-46543555 ACTTGGGAGAAGGGGGTGGACGG + Intronic
930191438 2:48463910-48463932 AGTGGAGAGGAGAGGAGGAATGG + Intronic
930258954 2:49123033-49123055 AATGTGGAGGAAAGGAAGGAAGG - Intronic
930399764 2:50868387-50868409 ACTGGGAAGGGTGGGATGGAGGG + Intronic
930422761 2:51175134-51175156 ACTGGTGGGGAAGGGATGGATGG - Intergenic
930886328 2:56331220-56331242 ACTGGGGAGGATAGGAGGGTGGG + Intronic
931248638 2:60511202-60511224 ACTGGGGAGGGCAGGAGAGAAGG + Intronic
931256426 2:60577936-60577958 AGAGGGGAGGAAAGGATAGAGGG + Intergenic
931642897 2:64396955-64396977 GATGGTGAGGAGAGGATTGAGGG - Intergenic
932748397 2:74354492-74354514 AATGGGGAGGAGGGGGAGGATGG + Intronic
932851613 2:75193072-75193094 AGTAGGGGAGAGAGGATGGAGGG - Intronic
932911496 2:75810650-75810672 GGTGGGGAGGAGAGGAGGGAGGG - Intergenic
933730216 2:85450635-85450657 ACTTGGCAGGAGACCATGGATGG - Intergenic
933776331 2:85773418-85773440 CCTGGGGAGGAAAGGAGAGAAGG + Intronic
934577884 2:95414497-95414519 ACAGGGGACGGGAGAATGGAGGG - Exonic
934601555 2:95662205-95662227 ACAGGGGACGGGAGAATGGAGGG + Intergenic
934854224 2:97718911-97718933 GCTGGGTTGGAGAAGATGGAGGG + Intronic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935231528 2:101102044-101102066 AGTGGAGAGGAGGGGAGGGAAGG + Intronic
935236951 2:101147384-101147406 ACTATGGAGGACAGTATGGAGGG - Intronic
935349420 2:102140927-102140949 ACTGGGTAGGAGTGGCTGAACGG + Intronic
936992095 2:118377174-118377196 AAAGGGGAGGTGAGGATGGGAGG - Intergenic
937111243 2:119368157-119368179 AAGGGAGAGGAGAGGATTGAGGG - Intronic
937147787 2:119662085-119662107 ACTGGGGAGGGTAAGATGGAAGG + Intronic
937253890 2:120541273-120541295 CCTGGGCAGGACAGGAGGGATGG - Intergenic
937265438 2:120612202-120612224 CCTGGAGAGGAGAGGGTGCACGG - Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937337094 2:121068878-121068900 ACTGGGGAGAGGAGGAGGGAGGG - Intergenic
937814035 2:126231569-126231591 AACAGGAAGGAGAGGATGGAGGG - Intergenic
937818057 2:126275542-126275564 TCAGGGGAGGAGAGGAGGGATGG - Intergenic
937831065 2:126424200-126424222 ACTTGAGAGTAGAGGATGGGAGG + Intergenic
937955301 2:127418754-127418776 AGTGGGGTGGGGAGAATGGAGGG - Intronic
938771021 2:134500816-134500838 ACTGGGGAGGGGAGGGGGAAGGG + Intronic
938945622 2:136209411-136209433 ATTAGGGAGGAGAAGATGAAAGG + Intergenic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939351018 2:141037369-141037391 AATAGGAAGGAGAGGATGGAGGG + Intronic
939360905 2:141171340-141171362 ACTGGGGTGGGGAAGAGGGAAGG - Intronic
939729511 2:145764717-145764739 AAGGTTGAGGAGAGGATGGATGG - Intergenic
939733851 2:145819319-145819341 AAAGGGAAGGAGGGGATGGAGGG - Intergenic
939831626 2:147079559-147079581 ACAGAGGTGGAGAAGATGGAAGG + Intergenic
940801009 2:158132337-158132359 TCAGGGGAGGAGTGGATGGAAGG + Intronic
941462327 2:165786285-165786307 ACTGGGGAGACGAGAAAGGAGGG + Intronic
941641449 2:167993304-167993326 ACAGGGGAGGAGAAGATTGTTGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942140342 2:172971251-172971273 ACTTGGAAGGAGTGGTTGGAAGG - Intronic
943090766 2:183372234-183372256 GCTGGAGACAAGAGGATGGAGGG - Intergenic
943237402 2:185339836-185339858 TCAGGGGATGAGAGGTTGGAGGG - Intergenic
944174505 2:196815071-196815093 ACTCGGGAGGCTAGGGTGGAAGG - Intergenic
944539075 2:200739739-200739761 ACTGGTGAGGAGAAGGTGGCAGG + Intergenic
945068407 2:205966722-205966744 TCTGGAGGGGAGAGGCTGGAGGG + Intergenic
946034605 2:216731785-216731807 AGTTTGGAGGAGATGATGGAAGG - Intergenic
946248838 2:218401133-218401155 ACGGGGGTGGAGAGGATGGAGGG + Intronic
946386114 2:219385561-219385583 AGTGGGGAGGAGAGGAGGAATGG - Intronic
946433326 2:219636926-219636948 CCTGGGGAGGACAGCATGGGAGG + Intronic
946461350 2:219871635-219871657 ACAGGGTGGGAGATGATGGATGG + Intergenic
946558771 2:220889527-220889549 AGTGAGGAGGAGGGGCTGGAGGG - Intergenic
947090413 2:226504006-226504028 TCTGGGAAGGAGTGGAGGGAGGG + Intergenic
947679832 2:232020386-232020408 GATGGAGAGGAGTGGATGGATGG + Intronic
948035782 2:234857429-234857451 AGAGGGGAGGAGAGGTTGGGGGG + Intergenic
948125248 2:235560347-235560369 CATGGGGAGGTGAGGAGGGAGGG - Intronic
948628657 2:239286517-239286539 ACTGGGAAGGAAGGGAAGGAAGG + Intronic
948811142 2:240479030-240479052 ACTGGGAATGAGAGGAAGGAGGG - Intergenic
948815863 2:240510129-240510151 ATTGGGGAGGAGGGCAGGGAGGG - Intronic
948815886 2:240510186-240510208 ACTAGGGAGGAGGGCAGGGAGGG - Intronic
949057279 2:241934930-241934952 ACAGGGCAGGAGAGGGTGGTTGG + Intergenic
1169196632 20:3686579-3686601 TCTGGGGAAGAGAGGGTGTAGGG - Intergenic
1169250501 20:4057312-4057334 ACTAGGGATGAGAGGTGGGAGGG - Intergenic
1169324072 20:4661163-4661185 ACTGGGGAGGGAGGGAGGGAGGG + Intergenic
1169406779 20:5327769-5327791 AATGGTGAGGAGAGGAGGGAAGG - Intergenic
1169951416 20:11048494-11048516 ACTGGGGAAGAAAGGAAAGAAGG - Intergenic
1170212363 20:13858123-13858145 GCAGGGGAGGACAGGATGGCAGG + Intronic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170580610 20:17696981-17697003 AATGGGGAGGAGAATGTGGAAGG + Intronic
1170603468 20:17859238-17859260 GCTGGGGAGGAGATGAAGGCAGG + Intergenic
1170658165 20:18309924-18309946 ACAGAGAAGGAGAGGATGTAGGG + Intronic
1170876367 20:20253978-20254000 AATGGAGAGGAGAGGAGGGGAGG - Intronic
1171263607 20:23752830-23752852 CCAGGAGAGGAGAGGGTGGAAGG + Intergenic
1171472004 20:25379594-25379616 AGGGGAGAGGAGAAGATGGACGG - Intronic
1172278588 20:33694667-33694689 GCTTGGGAGGAGAGAATGGGAGG - Intergenic
1172468098 20:35172025-35172047 TCTGGGCAGAGGAGGATGGAAGG - Intergenic
1172618231 20:36303994-36304016 TATGGGGAGGAGGGGAAGGAAGG - Intergenic
1172620762 20:36316807-36316829 GCTGGGGAGGAGAGGAGTGACGG - Intronic
1172629018 20:36365972-36365994 ATTGGAGGGGAGAGGGTGGAGGG + Intronic
1172706512 20:36886234-36886256 ACTGGGGAGGCTAAGGTGGAAGG - Intronic
1172896552 20:38304369-38304391 TCAGGGGTGGAGAGGAGGGAAGG - Intronic
1172969452 20:38862792-38862814 AGTGGGCAGGAGAGCAGGGAAGG - Intronic
1173334399 20:42101119-42101141 GCTGGGGAGGGGAAGCTGGAAGG + Intronic
1173370054 20:42427163-42427185 ATGGGGGAGAAGAGGAGGGATGG - Intronic
1173426925 20:42951311-42951333 ATGGGGGATGAGTGGATGGATGG + Intronic
1173635541 20:44553780-44553802 ACGGGTGAGGGGAGGAAGGAAGG + Intronic
1173790772 20:45826565-45826587 AAAGAGGAGGAGAGGAAGGAGGG - Intronic
1173961488 20:47075849-47075871 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1174164577 20:48575705-48575727 AGAGGGGAGGAGGGGAGGGAGGG + Intergenic
1174253278 20:49235127-49235149 TCTGGGGCAGAGAGGATAGAAGG + Intronic
1174568371 20:51483594-51483616 GGTGGGGGGGAGAGGGTGGAAGG - Intronic
1175160171 20:57002502-57002524 AGTGGACAGGAGAGGAAGGAAGG - Intergenic
1175241314 20:57551463-57551485 ACTGGGGAGGGGAAGAAGCAAGG + Intergenic
1175278575 20:57788004-57788026 GGTGGAGAGGAGGGGATGGAGGG + Intergenic
1175676385 20:60949839-60949861 AGAGGAGAGGAGAGGAGGGAGGG + Intergenic
1175771341 20:61626511-61626533 AAGGGGTTGGAGAGGATGGACGG + Intronic
1175874059 20:62221100-62221122 ACGGGGGAGGAGAGGAGAGGTGG + Intergenic
1175891619 20:62318328-62318350 ACGAGGGAGGGGAGGACGGAGGG + Intronic
1175908253 20:62392325-62392347 ACTGGAGAGGAGAGGCTGGCAGG + Intronic
1175981820 20:62742584-62742606 TCTGGGGAGCAGAGGACGGAAGG - Intronic
1176287491 21:5026024-5026046 CATGGGGAGGAGCGGCTGGATGG - Intronic
1176293643 21:5059289-5059311 AATGAGGAGGAGGGGAAGGAGGG + Intergenic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1177477075 21:21637245-21637267 ACTGGGGAGGGTAGGAGGAAGGG - Intergenic
1178278194 21:31257990-31258012 ACTTGGAAGGAGAGGAGGGGAGG - Intronic
1178317274 21:31577116-31577138 ACTGGGTTGGACAGGATGGGTGG + Intergenic
1178474712 21:32927532-32927554 ACTTGGGAGGCTGGGATGGAAGG + Intergenic
1178591892 21:33917905-33917927 ACTGGGGAGGCTAAGGTGGAAGG - Intergenic
1179084855 21:38207602-38207624 AGTGGGGAGGGGAGGGAGGAAGG - Intronic
1179125904 21:38590322-38590344 AATGGGGAGGAGAGCAGGAAAGG + Intronic
1179560042 21:42209988-42210010 ACTCGGGAGGGCAGGATGTAGGG + Intronic
1179715837 21:43287786-43287808 ACTGGGAAGGGAAGGATGGTAGG - Intergenic
1179863617 21:44204359-44204381 AATGAGGAGGAGGGGAAGGAGGG - Intergenic
1179869690 21:44237451-44237473 CATGGGGAGGAGCGGCTGGATGG + Intronic
1179920780 21:44506250-44506272 CCTGGGGAGGAAAGGATCCAGGG - Intronic
1180182200 21:46123120-46123142 ACTGGGGAGGGGACGCTGGAAGG - Intronic
1180185155 21:46135740-46135762 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185166 21:46135767-46135789 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185183 21:46135807-46135829 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185194 21:46135834-46135856 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181528317 22:23502381-23502403 ATGGGGGATGAGAGGATGGAGGG - Intergenic
1181639127 22:24187658-24187680 ACTGGGGAAGAGGGGCTCGAAGG - Exonic
1181808783 22:25391127-25391149 ACTGGGGAGGCGCTGATGCAAGG + Intronic
1181877262 22:25949347-25949369 GATGAGGAGGAGTGGATGGATGG + Intronic
1182257260 22:29048263-29048285 GGTGGGGAGGAGAGTAGGGAAGG + Intronic
1182289251 22:29266019-29266041 ACAGGGGAGGGGAGGAAGGAGGG - Intronic
1182384467 22:29925139-29925161 ACTGGGGAGGATAAGGTGGGAGG - Intronic
1182438346 22:30345859-30345881 TCAGGGGAGGCCAGGATGGAGGG + Intronic
1182552030 22:31105833-31105855 ACTGGGGCGGGGAGGGGGGAAGG - Intronic
1183202498 22:36395377-36395399 GCTGGGGAGGACAGGATGGCTGG - Intergenic
1183231675 22:36586188-36586210 GCTGGGGAGGCCAAGATGGATGG - Intronic
1183266785 22:36832290-36832312 AAAGGCGAGGAGAAGATGGATGG + Intergenic
1183292323 22:37010405-37010427 CCTGGGGAGCAGTGGAGGGAGGG - Intergenic
1183328425 22:37206713-37206735 GATGGGGAGGAGAGCAGGGAGGG - Exonic
1183345801 22:37307046-37307068 ACTGAGGAGGTGGGGGTGGAGGG + Intronic
1183376953 22:37471017-37471039 ACTGGGGAGTAGGGGCTGGCCGG - Intronic
1183476094 22:38036593-38036615 ACCGGGGAGGAGTGGCTGCAAGG + Intronic
1184172050 22:42765641-42765663 TCAGGGGTGGAGAGGAGGGACGG - Intergenic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184290928 22:43497793-43497815 CCTGGGGGAGGGAGGATGGAGGG + Intronic
1184835711 22:47019829-47019851 AAGAGAGAGGAGAGGATGGAGGG - Intronic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1184835743 22:47019955-47019977 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184835752 22:47019980-47020002 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184838844 22:47040631-47040653 GCTGGGGAGGTGAGGATGCAGGG + Intronic
1184912417 22:47545000-47545022 GCTGGGGAGGAGAAGAGGAAGGG + Intergenic
1184929234 22:47668611-47668633 ACTGCCCAGGAGAGGATGAAGGG + Intergenic
1185154580 22:49185512-49185534 ACTGATGATGAGTGGATGGATGG - Intergenic
1185272887 22:49936771-49936793 ACTGGAGGGGTGTGGATGGAGGG - Intergenic
1185355501 22:50367169-50367191 ACAGGGGAGCAGAGGATGCCTGG + Intronic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
949943671 3:9173691-9173713 AATGGGGAGGAGAGGTGGGCAGG - Intronic
949992844 3:9593126-9593148 ACTCGGGAGGATAGGGTGGGAGG + Intergenic
950196890 3:11015637-11015659 GAAGGGGAGGAGAGGAGGGATGG - Intronic
950491069 3:13305410-13305432 ACAGTGGATGAGAGGATGGGAGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
951072155 3:18342402-18342424 AATGGGAAGGATAGGAGGGAGGG + Intronic
951078582 3:18425372-18425394 AGGGGGGAGGAGAGGAGGAAGGG + Intronic
951164449 3:19467951-19467973 GGTGGGGAGGAGGGGAGGGAGGG - Intronic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
951859490 3:27236146-27236168 ACTGGAGGGTGGAGGATGGAAGG + Intronic
952177326 3:30879277-30879299 ACTGGGGAGCCAAGGAAGGATGG - Intronic
952305433 3:32141940-32141962 ACTAGAGAGGAGAGAAAGGAGGG - Intronic
952436006 3:33273065-33273087 GCTGGGGAGTAGAGGATGCTAGG + Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
953208391 3:40852342-40852364 GCAATGGAGGAGAGGATGGATGG + Intergenic
953273885 3:41475942-41475964 AGAAGGGAGGAAAGGATGGAGGG + Intronic
954302098 3:49705512-49705534 ACTGGGGAGTTGGGGAGGGAAGG - Exonic
954324841 3:49857931-49857953 ACTGGGGAGGAGCCCCTGGAAGG - Intergenic
955611054 3:60757935-60757957 ACAGGCGAGGAAAGGGTGGAGGG - Intronic
955915717 3:63906037-63906059 ACTTGGGAGGAGAGGAGGACAGG + Intronic
955952586 3:64257366-64257388 ACTGGGGATGGGAGTATGAAAGG + Intronic
956017973 3:64904397-64904419 ACTGGGGAGTAGAGGAATCAGGG + Intergenic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
956642612 3:71429093-71429115 GCTGGGGACGAGAAGGTGGATGG + Intronic
957222217 3:77398688-77398710 ACTAGGGAGGATGAGATGGAAGG - Intronic
957614314 3:82507993-82508015 ACTGGAGGGTGGAGGATGGAAGG - Intergenic
957719638 3:83977543-83977565 ACTGGGTAGGAGAGGAGTGGTGG - Intergenic
959260858 3:104077721-104077743 AGTGGGGAGGAGGGGAGGGGAGG + Intergenic
959733523 3:109631246-109631268 ACTGGGGAAGAGATGTTGGTTGG - Intergenic
960170568 3:114455758-114455780 ACCCGGGAGAGGAGGATGGATGG - Intronic
961723914 3:128913393-128913415 ACTCTTGAGGAGAGGATGAATGG + Intronic
961754100 3:129116938-129116960 ACTGAGGTGGGGAGGAGGGAGGG + Intronic
962089701 3:132230374-132230396 ACTGGGGAGGAGAGGGTGGGAGG - Intronic
962113526 3:132476040-132476062 ACTGGGGAGGCGAAGGTGGAAGG - Intronic
962316862 3:134364478-134364500 TCTGGGGAGGAGAAGCTGCAAGG - Intronic
962346795 3:134624677-134624699 AGAAGGGAGGAGAGGATGGGAGG - Intronic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
962988050 3:140553749-140553771 AATGGGCAGGAGAGGAAGGGAGG - Intronic
963344891 3:144083677-144083699 ACTAGGGAGGTGACAATGGAAGG - Intergenic
963464543 3:145662921-145662943 ACTAGAGGGGAGAGGATGGAAGG - Intergenic
963749288 3:149159151-149159173 ACTGCAGATGAGAAGATGGAAGG - Intronic
963801831 3:149683844-149683866 GCTGGGGTGGAGATTATGGATGG + Intronic
963840455 3:150099619-150099641 AAGGCTGAGGAGAGGATGGAAGG + Intergenic
963949601 3:151184617-151184639 ACTGAGGATGAGAGGATGTTGGG - Intronic
964246572 3:154660606-154660628 ACTTGGGAGTAGAGGATAAAAGG + Intergenic
964386094 3:156149614-156149636 GCAGGGGATGAGAGGAGGGAGGG - Intronic
964518674 3:157540956-157540978 ATTGGGGAGGAGAGGCTGCATGG - Intergenic
964633560 3:158837609-158837631 ATTGGGGAGGATGGGATGTATGG + Intergenic
964677799 3:159303175-159303197 ACTGGGGAAGACATCATGGAGGG + Intronic
964993144 3:162840561-162840583 ACTGGGGCTCAGAGGGTGGAGGG - Intergenic
965370487 3:167856051-167856073 ACTAGGGAGCAGAGGCTGCAGGG - Intergenic
965373883 3:167897602-167897624 GGAGGGGAGGAGAGGAGGGAGGG + Intergenic
965373897 3:167897626-167897648 AGGGGGGAGGGGAGGAGGGAGGG + Intergenic
965373911 3:167897650-167897672 AGGGGGGAGGGGAGGAGGGAGGG + Intergenic
966233702 3:177676877-177676899 AGTGGGGAGTGGAGGAGGGAAGG - Intergenic
966399526 3:179534445-179534467 AATTGGGAGGAGAGTGTGGAAGG + Intergenic
966886323 3:184379854-184379876 ACCGGGCAGGGGAGGAGGGAGGG - Intronic
966984207 3:185164821-185164843 ACTGGAGAAGTGAGGAGGGAGGG - Intergenic
966989637 3:185216604-185216626 ACTGGAGAGGGGAGGAACGATGG - Intronic
967142104 3:186570074-186570096 ACTTGGGAGGAGGGGAGGGGTGG + Intronic
967227225 3:187303521-187303543 AAAGAGGAGGAGAGGAGGGAGGG - Intergenic
967542998 3:190691016-190691038 ACTTGGGAGGACAGAATGGGAGG + Intergenic
967712367 3:192723948-192723970 GGAGGGGAGGAGAGGAAGGAGGG + Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967838982 3:193988951-193988973 AGAGGGGAGGAGAGGATCTATGG + Intergenic
968251299 3:197217780-197217802 ACAGGGAAGGACAGGAGGGAGGG + Intronic
968356005 3:198107971-198107993 ACTGGGGAGGGAGGGAAGGAAGG + Intergenic
968356082 3:198108303-198108325 ACTGGGGAGGGAGGGAGGGACGG + Intergenic
968427734 4:534604-534626 ACCAGGCAGGAGAGCATGGAGGG - Intronic
968740891 4:2331145-2331167 GCTGGGGAGGAAGGGAGGGAGGG + Intronic
968938332 4:3624973-3624995 ACTGGGGAGGAGCAGCTGGGAGG + Intergenic
969057962 4:4413833-4413855 ACTGGGGCGCTGGGGATGGAGGG + Intronic
969931638 4:10636602-10636624 AGAGGGGAGGGGAGGAGGGAAGG + Intronic
970224542 4:13844054-13844076 AATGAGGAAGAGAGGAAGGAAGG - Intergenic
970279354 4:14436915-14436937 TCTGAGGAGGAGAGGAAGAAGGG + Intergenic
970310973 4:14782149-14782171 ACTGAGTAGGTGAGGAAGGAAGG + Intergenic
970361734 4:15316093-15316115 ATGGGGGAGGAGAGTATGGCTGG - Intergenic
970548818 4:17157988-17158010 ACTTGGGAGAAAAGGGTGGAAGG - Intergenic
970578587 4:17452200-17452222 ACTGTGGAGAAGAGTATGGAGGG - Intergenic
971044188 4:22786793-22786815 AATGGGAAGGAGAAGATGTAAGG + Intergenic
971328510 4:25663627-25663649 GGTGGGGAGGAGAGGTAGGAAGG + Intronic
972370775 4:38421159-38421181 AGTGGGGAGGGAAGGAAGGAAGG + Intergenic
972915979 4:43880418-43880440 ACGAGGGAGGAGAGGAAAGAAGG + Intergenic
973333324 4:48931631-48931653 ACTGTGGAGGAGAGGCAGCAAGG - Intergenic
975578748 4:75888331-75888353 ACTGGGAGGAAGAGGAGGGAAGG + Intronic
976818939 4:89182837-89182859 CCTGGAGATGAGGGGATGGATGG - Intergenic
978056654 4:104277412-104277434 ACTGGAGGGGAGGGGAGGGAAGG + Intergenic
978345374 4:107762155-107762177 CCGGGGGAGGAGGAGATGGAAGG + Intergenic
978633082 4:110769639-110769661 AATGGGGAGTAGTGGCTGGAAGG + Intergenic
978883631 4:113739942-113739964 AATGGAGTGAAGAGGATGGAAGG - Intronic
979446308 4:120816434-120816456 ACTGGTGAGGAGTCGTTGGAGGG - Exonic
979759895 4:124389441-124389463 GCTGTGCAAGAGAGGATGGAAGG + Intergenic
979768247 4:124489572-124489594 GCTGGGGAGGGGAAAATGGAAGG + Intergenic
979865010 4:125743581-125743603 ACTGGGGTGGAGGTGATGGAAGG - Intergenic
980290240 4:130840638-130840660 TCAGGGGAGAGGAGGATGGAAGG + Intergenic
980455007 4:133028032-133028054 ACTGGAGAGGGGAGGGTGGGAGG + Intergenic
980470964 4:133250935-133250957 GATGGAGAGGAAAGGATGGAGGG + Intergenic
981330518 4:143503328-143503350 AGTAGGGATGAGAGGATGGAGGG - Intergenic
981520741 4:145659958-145659980 ACTGGGGAGGGGAGAGTGGAAGG - Exonic
981917090 4:150046375-150046397 ACTTGGGAGAAGGGTATGGAGGG - Intergenic
982245817 4:153349317-153349339 AATGTGGAAGAGAAGATGGAAGG - Intronic
982600045 4:157437670-157437692 ACTGGAGGGGAGAGGTTGGGAGG - Intergenic
982672104 4:158333363-158333385 CATGGGTAGGAGATGATGGAAGG - Intronic
982815904 4:159884166-159884188 ACTGGGGATGGCAGGATGGGGGG - Intergenic
983113513 4:163782591-163782613 ACTGGGAGGGAGAGGTTGCAGGG + Intronic
983174745 4:164575219-164575241 ACTAGAGAGGGGAGGGTGGAAGG + Intergenic
983852827 4:172604164-172604186 ACTGGAGAAGAGAAGATCGATGG + Intronic
983867617 4:172787675-172787697 ACTGAGGAGGAGACCATGGGAGG + Intronic
984298536 4:177885471-177885493 ACTGGGGGTGAGAGGGTGGCAGG - Intronic
984560705 4:181265523-181265545 AGTGGGGAGAAGAGTATGGCCGG + Intergenic
984617541 4:181915656-181915678 AGAGGGGAGGGGAGGACGGAAGG + Intergenic
984822175 4:183891599-183891621 ACTTGGGAGGAAAGGGTGGGAGG + Intronic
984930535 4:184843529-184843551 AATGGGCAGGAGAGAAGGGAGGG - Intergenic
985163813 4:187071509-187071531 AGAGAGGAGGAGAGGAAGGAAGG - Intergenic
985272017 4:188202717-188202739 ACTGGGGTGGAGCGGTGGGATGG + Intergenic
985274914 4:188228998-188229020 ACTGAGGAGGAGAGGAGGCTTGG - Intergenic
985278994 4:188268793-188268815 ACTTGGAGGAAGAGGATGGAAGG + Intergenic
985370765 4:189283261-189283283 ACTTGGGAGGTTAAGATGGAAGG + Intergenic
985504788 5:272467-272489 ACAGGCCAGGAGAGGAAGGAAGG + Intronic
985743327 5:1633128-1633150 ACAGGCCAGGAGAGGAAGGAAGG - Intergenic
985890244 5:2709866-2709888 GCTGGAGAGGAGGTGATGGAGGG - Intergenic
985894243 5:2739545-2739567 ACCGGGGAGGAGAGGAAGGCTGG + Intergenic
986006243 5:3671527-3671549 GCTGGGAGAGAGAGGATGGAAGG + Intergenic
986302200 5:6486551-6486573 ACTGGGGAAGAGAGAAAGAAAGG - Intronic
986690001 5:10306447-10306469 AGCGGGGAGGAGAGGAGAGAAGG + Intronic
986690238 5:10307884-10307906 AGTGGGGAGGAGACGAGAGAAGG + Exonic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
988680613 5:33480968-33480990 AGAGGGGGGGTGAGGATGGAGGG - Intergenic
988818373 5:34856492-34856514 ACTTGGGAGGAGAGAAGGAAAGG + Intronic
989806864 5:45619360-45619382 ACTGGGGAAGAGAGAATACACGG + Intronic
990194932 5:53303911-53303933 ACTGGGAAGTAGAAGATGGAGGG - Intergenic
990215008 5:53521168-53521190 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
990325794 5:54674102-54674124 AGTGGGGAGAAGAGGAAGGGTGG + Intergenic
990480653 5:56207089-56207111 GAAGGGGAGGAGAGGATAGAAGG - Intronic
990626130 5:57613336-57613358 AGTTTGGAGGAAAGGATGGAAGG + Intergenic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991045482 5:62218403-62218425 AGTGGGGAGGAGAGGATAACAGG - Intergenic
991380355 5:66016542-66016564 AGTGGGGAGGAAAGAATGAAGGG - Intronic
991408093 5:66321055-66321077 AGTGGGGAGGGGAGGATGAGGGG + Intergenic
991433594 5:66573394-66573416 AGGAGGGAGGAGAGGAAGGAGGG + Intergenic
991707332 5:69370049-69370071 TCTGGGGATGAGAAGATTGAGGG + Exonic
991924370 5:71689895-71689917 ACTTGGGAGGAAAGAAGGGAAGG + Intergenic
992611978 5:78515817-78515839 ATTGGGGAGGGGAGGCTGAAGGG + Intronic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
993776239 5:92001111-92001133 TCTGGGGAAGAGAGGGTTGATGG - Intergenic
995025924 5:107422607-107422629 ACTGGATAGGAGAGGGAGGAGGG + Intronic
995237084 5:109841294-109841316 ACTTGGGAGGAAGGGTTGGAGGG - Intronic
995883296 5:116866354-116866376 AATGGGTAGAATAGGATGGATGG + Intergenic
996603769 5:125296727-125296749 AGTGTGGAGGAGGGGATGGAGGG + Intergenic
997124917 5:131216391-131216413 ACTTGGGAGGCGGAGATGGAAGG + Intergenic
997234376 5:132264237-132264259 ACTGGGGAAGGAAGGAAGGAAGG - Intronic
997499144 5:134357748-134357770 AATGGGAAGGAGAGGAAGGATGG - Intronic
997854192 5:137358469-137358491 GGAGGGGAGGGGAGGATGGAAGG + Intronic
997887524 5:137643880-137643902 GCTGGGGAAGGGAGGAGGGAGGG - Intronic
997977951 5:138451168-138451190 ACTGGGGCGGGGAGGTAGGAAGG + Intergenic
998358537 5:141563136-141563158 ACTCTGCTGGAGAGGATGGATGG - Intronic
998374031 5:141679901-141679923 AGTGGGGAGGAGAGCATGAGGGG - Intronic
998427175 5:142039022-142039044 AGAGGGGAGGAAAGGAAGGAAGG - Intergenic
998469189 5:142370137-142370159 ACTGGGGAGGCTAAGATGGGAGG - Intergenic
998851501 5:146355281-146355303 ACTGGGGAGGAGCGGTTGGCGGG - Intergenic
999157893 5:149471607-149471629 ACTAGAGAGAAGAGGAGGGAGGG + Intergenic
999243061 5:150138654-150138676 GGTGGGGAGCAGAGGCTGGAGGG - Intronic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999254901 5:150204800-150204822 ACAGGGGAGGGGAGGAGGAATGG - Intronic
999834951 5:155359707-155359729 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
1000070840 5:157739619-157739641 ACAGGGAAGGAAGGGATGGATGG + Exonic
1000846344 5:166285588-166285610 ACTGAGGAGGATGGGATGGAAGG - Intergenic
1000990739 5:167908633-167908655 AGAGGGGAAGAGAGGAGGGAAGG - Intronic
1001022954 5:168199037-168199059 AGTGGGGAGGAGATGATGATTGG - Exonic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001951912 5:175822255-175822277 ACTTGAGAGAAAAGGATGGAAGG - Intronic
1002310006 5:178308696-178308718 ACTGGGGAGGAGACCAAGGCAGG - Intronic
1002791436 6:440688-440710 GATGGGTGGGAGAGGATGGAAGG - Intergenic
1002819135 6:707414-707436 ACTGGGGGGAAGAGGCTGCAGGG + Intergenic
1002855703 6:1036058-1036080 AAAGAGGAGGAGAGGAGGGAAGG + Intergenic
1003393231 6:5731357-5731379 ACAGAGGAGGAGAGTCTGGAGGG - Intronic
1003441730 6:6149050-6149072 ACTGAGGAGGAGAACATGAAGGG + Intronic
1003443437 6:6164331-6164353 ACTGGAGTGGGGAGGATGGGAGG + Intronic
1003443505 6:6164779-6164801 ACAGAGGAGAAAAGGATGGAGGG - Intronic
1003510968 6:6780027-6780049 ACTGGGAAGAAGAGAAAGGAGGG + Intergenic
1003523950 6:6882998-6883020 AGGGGGGAAGAGAGGAAGGAAGG + Intergenic
1003567882 6:7235996-7236018 GCTGGAGAGGAGTGGAAGGAAGG - Intronic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1004204858 6:13583095-13583117 ACTGGGGAGGATGGGGTGGGAGG + Intronic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004764069 6:18704643-18704665 ATGGTGGAGGGGAGGATGGAGGG - Intergenic
1004919982 6:20367228-20367250 ATTGAGGAGAAGAGGAGGGAGGG + Intergenic
1005004068 6:21270497-21270519 ACTGGGGAGGAGAGAAAGGGAGG - Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005198128 6:23312779-23312801 AGTGGGGAGGAGAGGGTGCAAGG - Intergenic
1005472925 6:26179818-26179840 ACTGGGGAGGCTAAGATGGGAGG + Intergenic
1005513970 6:26537271-26537293 ATTGGGGCAGAGAGGATGCAGGG + Intergenic
1005889101 6:30121775-30121797 ACTGGGGTTGTGGGGATGGAAGG - Intergenic
1006091356 6:31630896-31630918 ACGGGAAAGGAGAGGCTGGATGG + Intronic
1006249425 6:32768737-32768759 ATTGGGGAGGATGGGAAGGAGGG - Intergenic
1006340155 6:33442514-33442536 ACAGGAGAGGAGAGGAGGGCGGG - Intronic
1006384689 6:33723841-33723863 ACAGGGGAGGGGAGGAGAGATGG - Intronic
1006625300 6:35393223-35393245 AGTGGGCAGGAGCGGAGGGAGGG + Intronic
1006739406 6:36296692-36296714 AGGGGGGTGGAGAGGCTGGACGG + Intronic
1006941529 6:37754934-37754956 AGGGGGCAGGAGAGGATGGGAGG - Intergenic
1007063193 6:38962967-38962989 ACTGGGGAGAAAAGGTTTGAGGG + Intronic
1007230241 6:40343143-40343165 GCTGGGGAGGAGAGGTTGGGTGG + Intergenic
1007280801 6:40710806-40710828 ATTGGAGAGGGCAGGATGGAGGG - Intergenic
1007459923 6:42010431-42010453 AGTTGGAAGGAGAGGAGGGAGGG + Intronic
1007589193 6:43011344-43011366 AGTAGGGAGCAGAGTATGGAGGG - Exonic
1007593718 6:43038734-43038756 AGTGGAGAGAAGAGGATGGAGGG + Intronic
1007715130 6:43851354-43851376 CCTGGGGAGTTGAGGATGGGTGG - Intergenic
1007730488 6:43942552-43942574 ACTAGGCAGGTGAGGATAGAGGG - Intergenic
1007760173 6:44128527-44128549 AGTGGGGAGGAGAGGTCAGAGGG + Intronic
1008540038 6:52538395-52538417 ACGGGGGATGGGAGGATGGAGGG + Intronic
1009545427 6:65013754-65013776 ACTTGGGAGGCTAAGATGGAAGG + Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009658784 6:66581968-66581990 TCTGTGGAGGAGAGGAAAGATGG + Intergenic
1009748890 6:67857171-67857193 ACTGGGCTGGAGAGGAAAGAAGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010083291 6:71887430-71887452 ACTGGGGTGCAGAGGAGGGATGG + Intronic
1010401283 6:75449318-75449340 ACTTGGGGGGAAAGGATGGGAGG + Intronic
1010418270 6:75641102-75641124 GTAGGGGAGGAGAGGATGGAGGG - Intronic
1010443378 6:75924962-75924984 ACTGGGGAGGGGAGGGAGGAGGG + Intronic
1010522250 6:76852052-76852074 ACTGGAGAGGGGAGGCTGAAGGG + Intergenic
1011256508 6:85427177-85427199 ACTAGGGAGCACAGGATGGCAGG + Intergenic
1011557684 6:88587161-88587183 ACTGATGAGAAGAGGAGGGAAGG - Intergenic
1011632331 6:89339533-89339555 AGTGGGGAGGGGAGGGGGGAAGG + Intronic
1012547177 6:100433139-100433161 ACTGGTTTGGAGAGTATGGATGG - Intronic
1012655661 6:101816773-101816795 CCTGGGTAGGGAAGGATGGAGGG - Intronic
1012840004 6:104318117-104318139 AATCTGGAGGAGAGGAGGGAAGG - Intergenic
1013082107 6:106821877-106821899 AGTGGGGAGGGGAGGTTGGGGGG + Intergenic
1013463783 6:110399931-110399953 AGCGGGGAGGAGAGGACCGAGGG - Intronic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014957277 6:127636378-127636400 ACTAGACAGGAGAGGCTGGAGGG - Intergenic
1015230136 6:130905525-130905547 ACTTGGGAGGCTAGGATGGGAGG - Intronic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1016402354 6:143694163-143694185 AGTGGGGAGGGAAGGAAGGAGGG + Intronic
1016447401 6:144148191-144148213 AGTGGGGAGTAGAGCATGTAGGG - Intergenic
1016618123 6:146076686-146076708 ATTGGAGTGGAGAGGTTGGATGG + Intronic
1017245851 6:152223667-152223689 AGAGGGGAGGAGAGGAAGGCAGG + Intronic
1017247510 6:152242301-152242323 ACTGGTCAGGAGAAGATGGCAGG - Exonic
1017625008 6:156339139-156339161 AATGGGAAGTAGAGGAGGGAAGG + Intergenic
1017637339 6:156456152-156456174 AGAGGGGAGGAGGGGAGGGAGGG - Intergenic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1017971521 6:159315907-159315929 AGCGGGGCGGAGAGGAGGGAAGG - Intergenic
1017982462 6:159412919-159412941 ACAGGGGAAGAGAGTAAGGAAGG - Intergenic
1018172875 6:161155427-161155449 AACGGGGAGGAGAGGAGAGAGGG - Intronic
1018345958 6:162899561-162899583 AGAGGTGAAGAGAGGATGGAAGG - Intronic
1018978319 6:168582462-168582484 GCTGGGCAGGAGAGGATTAAAGG + Intronic
1018992857 6:168687212-168687234 ACTGGGGAGGAGAGCACAGCAGG - Intergenic
1019088310 6:169502135-169502157 TCTGGTGAGGAGATGAGGGAGGG + Intronic
1019142882 6:169959457-169959479 ATCGGGGAGGGGAGGAAGGAGGG - Intergenic
1019628644 7:2034756-2034778 ACAGGGGAGGAAAGGAGAGAAGG + Intronic
1020049527 7:5072540-5072562 ACTGGGGGCGGGGGGATGGACGG + Intronic
1020770343 7:12384333-12384355 TCTGGGGTTGAGAGGAGGGAGGG + Intronic
1020956663 7:14747299-14747321 ACTGGGGAGGATGAGGTGGAAGG - Intronic
1021439390 7:20660858-20660880 AATGGAGAGGAGGGGATGGAAGG - Intronic
1021738527 7:23662485-23662507 ACTGGGGAGGTGGGGTAGGATGG - Intergenic
1021887944 7:25158257-25158279 ACTTGGGAGGTGAAGGTGGAAGG + Intronic
1021926950 7:25543142-25543164 GCTGGCGAGGAGGGGATAGAAGG - Intergenic
1022651965 7:32285738-32285760 ACTGGGGAGAAGAGAAGAGAGGG + Intronic
1023095347 7:36654607-36654629 GCAGGGATGGAGAGGATGGATGG - Intronic
1023308130 7:38853004-38853026 AGTGGAGAGGAAAGAATGGATGG - Intronic
1023425881 7:40035782-40035804 ACTGGGGATGGGGGGATGGGGGG - Intronic
1023864503 7:44232397-44232419 AGAGGGGAGCAGAGGAGGGAGGG + Intronic
1023901407 7:44483496-44483518 AGTGGGGAGTATAGGGTGGAAGG - Intronic
1024241251 7:47438359-47438381 ACTGGGGAAGAGGGGAAGGATGG + Intronic
1024256817 7:47545683-47545705 ACTGGGGAGGTGTGAAAGGACGG - Intronic
1024287814 7:47774435-47774457 AGTGGGTAGAAGTGGATGGATGG - Intronic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1024980757 7:55155808-55155830 CCTGGGGAAGAGAGCATGAAAGG - Exonic
1025038283 7:55616340-55616362 AGTGGGGAAGAGAGGATAGGGGG - Intergenic
1025170679 7:56753876-56753898 ACTGGAGAGGAAGGGATGGATGG + Intergenic
1025701205 7:63821823-63821845 ACTGGAGAGGAAGGGATGGATGG - Intergenic
1025974152 7:66356459-66356481 TCTGGGGAGGGGAGGTTGGCTGG - Intronic
1026104177 7:67407932-67407954 ACAGGGGAGGGGAGGAGAGAGGG - Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1026337069 7:69403513-69403535 ACTGGGGAGGCTGAGATGGAAGG + Intergenic
1026464518 7:70642718-70642740 ACTGAGGAGGATGGAATGGAAGG - Intronic
1027965608 7:85002127-85002149 ACTAGAGGGGAAAGGATGGAAGG - Intronic
1028134240 7:87209331-87209353 ACTGGGGAGAAGAGGTTGAGAGG + Intronic
1028480316 7:91297438-91297460 ACTGGAGAGCAGAGGAGGGGTGG - Intergenic
1028488436 7:91385195-91385217 ACTGGGGAGAGGAGGAGGAAGGG - Intergenic
1028591717 7:92503906-92503928 GCTAGGGAGGTGAGGTTGGAGGG - Intronic
1029155771 7:98516942-98516964 ACTGGGGAGGCTAAGATGGGAGG - Intergenic
1029813801 7:103074575-103074597 ATTGGGGAGGAGTGGAGGGAAGG - Intronic
1030263968 7:107597265-107597287 TCTGGGGAGGAAGGGAGGGAAGG - Intronic
1030651028 7:112116162-112116184 GCTGGGGAGAGGAGGGTGGAGGG - Intronic
1030655531 7:112163267-112163289 AATGGGGAGGGGAGGGAGGAGGG - Intronic
1030964285 7:115970395-115970417 ATTGGGGAGGAGAGAATGAGAGG + Intronic
1031019374 7:116610476-116610498 AATGGGGAGGAGATGATTGATGG - Intergenic
1031151543 7:118059883-118059905 ACAGGGGAGCAGGGGAGGGATGG - Intergenic
1031779825 7:125947142-125947164 ACTTGGGTGGAGAGCATGAACGG + Intergenic
1032286220 7:130540083-130540105 ACTGGGTTGGAAAGGAGGGAAGG + Intronic
1032441032 7:131943288-131943310 TCTGGGGAGGAGCTGATGGGGGG + Intergenic
1032456208 7:132075328-132075350 GCTGGGCAGGAGAGGAGGAAAGG - Intergenic
1033277917 7:139986514-139986536 ACTTGGGGGGAGAGGTGGGAAGG - Intronic
1033433146 7:141307454-141307476 ACTGAGGAGGAAAGCATGTAGGG - Intronic
1033605645 7:142926377-142926399 ACAGGAGAGGGGATGATGGACGG + Intronic
1033615360 7:143009134-143009156 AGTGGGGAGGAAAAGAAGGATGG + Intergenic
1034025965 7:147704480-147704502 ACTGGGGAGCTCAGGATGGGTGG - Intronic
1034082524 7:148292800-148292822 GTTGGGGTGGAGGGGATGGATGG - Intronic
1034190229 7:149208010-149208032 GCTGGGGTGGAAAGGGTGGAAGG + Intronic
1034200990 7:149282725-149282747 AGTGGAGTGGAGTGGATGGATGG + Exonic
1034263759 7:149772140-149772162 GTGGGGGAGGAGAGGAGGGAGGG - Intronic
1034285480 7:149880783-149880805 TCTGGGGAGGGGAGCAGGGAAGG + Intergenic
1034427221 7:151020357-151020379 ACAGGGGAGGAGGGGAAAGAAGG + Intronic
1034507040 7:151500873-151500895 ACTGGGGAGGATGAGGTGGAAGG + Intronic
1034637274 7:152577227-152577249 ACTGGGGAGGCCAGGGTGGGAGG + Intergenic
1034653732 7:152712773-152712795 AGGGGGGAGGAGAGGAAGGGAGG - Intergenic
1034677271 7:152900867-152900889 ACTGGGGAGGGGTGGAGAGAGGG + Intergenic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035058546 7:156052421-156052443 ACTGGGGTTGTGAGGCTGGAGGG - Intergenic
1035142791 7:156780843-156780865 ACTGGGGAGGTGGGGGTGAAGGG - Intronic
1035642868 8:1197329-1197351 ACTGAGCAGAAGAGGAGGGAGGG - Intergenic
1035724790 8:1817700-1817722 ACTGGGGACGGCAGGAGGGAGGG + Intergenic
1035971900 8:4258377-4258399 AGGAGGGAGGGGAGGATGGAAGG + Intronic
1036242231 8:7090832-7090854 ACTGGGGAGGCCAGGGAGGAAGG - Intergenic
1036307003 8:7610200-7610222 ACTGGGGAGGCCGGGGTGGAAGG - Intergenic
1036308059 8:7616328-7616350 ACTGGGGAGGCCGGGGTGGAAGG - Intergenic
1036358915 8:8064329-8064351 ACTGGGGAGGCCGGGGTGGAAGG - Intergenic
1036387528 8:8295166-8295188 ACTTGGGAGGCCAAGATGGAGGG + Intergenic
1036743495 8:11388245-11388267 ACTGAGGAGGAGAGAAAGGCAGG - Intergenic
1036830509 8:12016298-12016320 ACTGGGGAGGCCAGGGCGGAAGG + Intergenic
1036892043 8:12602623-12602645 ACTGGGGAGGCCGGGGTGGAAGG + Intergenic
1036927195 8:12918552-12918574 GCAGGGGAAGAGAGGATAGAAGG + Intergenic
1036962923 8:13265689-13265711 AGAGGAGAGGAGAGGAAGGAAGG - Intronic
1037085761 8:14847689-14847711 GGAGGGGAGGAGAGGAGGGAGGG + Intronic
1037463285 8:19134885-19134907 GCTGGGGAAGAGAGGAGGAAAGG - Intergenic
1037486301 8:19350590-19350612 ACTCGGGAGGCGAGGGTGGGAGG - Intronic
1037493425 8:19417414-19417436 ACTTGGGGAGAGAGGATGAAAGG + Intronic
1037524863 8:19714914-19714936 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037624274 8:20593834-20593856 TCGGGGGAGTTGAGGATGGATGG + Intergenic
1037717488 8:21412339-21412361 CCTGGGGAGGAGAACATGGCTGG - Intergenic
1038029263 8:23622821-23622843 ATTGGGGAGGAGAGGAGAAAGGG + Intergenic
1038057252 8:23872193-23872215 ACTGGGGAGGCCAAGATGGGAGG - Intergenic
1038136201 8:24789019-24789041 AATGGGGAGGTGATGATTGAAGG - Intergenic
1038158288 8:25011962-25011984 ACTAGGAAGGGGAGGCTGGAGGG - Intergenic
1038190779 8:25318458-25318480 AGTGGAGAGGAGAGAAGGGAAGG - Intronic
1038442660 8:27582861-27582883 ACGGGGGAGGCCAAGATGGAAGG - Intergenic
1038727417 8:30094216-30094238 ACTGGGGATGGAGGGATGGAGGG + Intergenic
1038953532 8:32443041-32443063 ACTTGGGAGGCTAAGATGGAAGG - Intronic
1038991452 8:32872713-32872735 ACTGGGAAGGGGAGGAGTGAGGG - Intergenic
1040392179 8:46959656-46959678 ATTTGGGGGGAGAGGAGGGAAGG + Intergenic
1040985533 8:53290296-53290318 ACTGGGGAAGAAAGAAAGGAAGG - Intergenic
1041403354 8:57468299-57468321 ACAGAGGAGGAGAGAAAGGAGGG + Intergenic
1041605285 8:59774792-59774814 ACTGGAAAGGATAGGATGAAGGG - Intergenic
1042046873 8:64663136-64663158 TCTAGCAAGGAGAGGATGGAGGG - Intronic
1042100571 8:65271529-65271551 ACGGGGGAGGAGAGGAGGAGAGG + Intergenic
1042272148 8:66965555-66965577 ACTTGGGAGGCTAGGGTGGAAGG - Intronic
1042301684 8:67289443-67289465 ACTTGGGAGGCTAAGATGGAAGG + Intronic
1042372223 8:68005111-68005133 CCTGGGGAGGACAGGGTTGAAGG - Intronic
1042651349 8:71045575-71045597 CCCGGGGAGAAGAGGATGGGAGG + Intergenic
1042828640 8:73003440-73003462 ACGGGGAAGGAAAGGAGGGAGGG + Intergenic
1042939156 8:74089931-74089953 AGTGGGGAGGACAGGATGGTTGG + Intergenic
1042958820 8:74280602-74280624 ACTGAGGAGGAAAGGAAAGACGG + Intronic
1043587863 8:81790602-81790624 ACTGGGGAGGAGAGGAAGCTAGG - Intergenic
1044505333 8:93010103-93010125 ACTGGGGAGAGTAGGAGGGATGG + Intronic
1044584869 8:93859832-93859854 ACTGGGGAGGAGGACTTGGAAGG + Intronic
1044734976 8:95269521-95269543 ACGGGAGAGGAGAGAATGAAGGG - Intergenic
1044899814 8:96932165-96932187 ACTTGGGAAGAAAGGAAGGAAGG + Intronic
1045018016 8:98015643-98015665 ACTGGGCTGGAGAGTAGGGAGGG - Intronic
1045054866 8:98360158-98360180 AATGGGGAGAAAAGGATGAAAGG - Intergenic
1045231357 8:100309991-100310013 ACCGGGGCGGAGACGACGGAGGG + Intronic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1046514994 8:115247515-115247537 ACTGTGGAGCAGAGGAGAGAAGG - Intergenic
1046872605 8:119220436-119220458 ACTGGGGAGGAAAGGGTGGATGG - Intronic
1046922503 8:119747646-119747668 ACTGGGGAGAAAAGGAAGGCGGG - Intronic
1046975151 8:120266639-120266661 TCTGAGGATGAGACGATGGATGG + Intronic
1047233720 8:123020057-123020079 GCTGGGGAGAAGTGAATGGATGG - Intronic
1048439230 8:134447734-134447756 ACTGAGAAGGAGAGGATGGTGGG + Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049764892 8:144350587-144350609 ACTGGGGCAGGGAGGAGGGAGGG - Intergenic
1049966272 9:783052-783074 ACTGGGGAGGGGAGAAGGAAAGG + Intergenic
1049966380 9:784148-784170 ACTGGGGAGGGGAGAAGGAAAGG - Intergenic
1050125469 9:2352674-2352696 AGAGGAGAGGAGAGGAGGGAAGG + Intergenic
1050190424 9:3019512-3019534 ACTGAGGAGGAGAGGAGGATAGG - Intergenic
1050299947 9:4248035-4248057 AGTGGGTAGGAGAGGAGTGAAGG - Intronic
1050495275 9:6234424-6234446 ACTGGGGATGAGGGGAAGCAGGG - Intronic
1050623720 9:7481504-7481526 AATGGGGTGCAAAGGATGGATGG + Intergenic
1050801353 9:9618493-9618515 ACTGCAGAGGAGAGGACAGATGG + Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051411270 9:16791991-16792013 ACTTGGGAGGTGAAGGTGGAGGG + Intronic
1051476465 9:17514199-17514221 ACTGGGGAGGCTAAGATGGGAGG + Intergenic
1052282774 9:26752239-26752261 ACCGGAGAGGAAAGAATGGAGGG + Intergenic
1052854284 9:33397503-33397525 ACCAGGGAGGAGTAGATGGAGGG - Intronic
1053274861 9:36775683-36775705 AGTGGGCAGGAGAGGTTGGTGGG - Intergenic
1053329353 9:37188913-37188935 AGAGGGGAGGAGAGAAGGGAGGG - Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053382466 9:37660157-37660179 GCTGGGGAGGAGAGGCGGGGAGG + Intronic
1053462483 9:38281326-38281348 ACTGGGGATGTGAGGCTGGGGGG + Intergenic
1053853093 9:42309583-42309605 GATGGTGAGGAGAGGATAGATGG + Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055299860 9:74871786-74871808 ACTCGGGAGGTGAGGGTGGGAGG - Intronic
1055482577 9:76724363-76724385 ACTGGGGAGGCTGGGATGGGAGG + Intronic
1056107651 9:83362918-83362940 AGTAGGGAGGAAAGGAAGGAAGG - Intronic
1056137746 9:83646576-83646598 AGAGGGGAGGGGAGGAGGGAGGG + Intergenic
1056163162 9:83918338-83918360 ACAGGGAGGGAGAGGAGGGAGGG + Intronic
1056252689 9:84766307-84766329 CCTGGGGAGGAGAGCAGAGAGGG + Intronic
1056363604 9:85882308-85882330 CCTGGGGAGGAGAGGTCAGATGG - Intergenic
1056368646 9:85932207-85932229 GCTGGGGATGAGTGGATAGAGGG - Intergenic
1056444732 9:86654920-86654942 ACTGGGGAGGAGAGATTGGAGGG - Intergenic
1056656029 9:88509741-88509763 ACTGGGGTGAAGAGGATCGAGGG + Intergenic
1056834638 9:89944611-89944633 ACAGGGGAGGGGAGGAGGAAGGG + Intergenic
1057226717 9:93296632-93296654 AAAGGTGAGGGGAGGATGGAAGG - Intronic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1057723683 9:97553718-97553740 ATTTGGGAAGAGAGGATAGAGGG + Intronic
1057726679 9:97573011-97573033 ACTGAGGATGAGAGAAGGGATGG + Intronic
1058040179 9:100294205-100294227 ACTGGGGAGAGGAAGACGGATGG + Intronic
1058091163 9:100807249-100807271 AGTAGGGGAGAGAGGATGGAGGG + Intergenic
1058771250 9:108234523-108234545 ACTTGGGAGGAAAGGTGGGAAGG + Intergenic
1058944228 9:109841688-109841710 AGGGAAGAGGAGAGGATGGAGGG + Intronic
1058998912 9:110327780-110327802 ATTGGGGGGTGGAGGATGGAGGG + Intronic
1059129625 9:111732763-111732785 AGTGAGGAGGAGAGGTGGGATGG + Intronic
1059434223 9:114266672-114266694 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1059450198 9:114366737-114366759 AGAGGAGAGGAGAGGAGGGAAGG + Intronic
1059450215 9:114366949-114366971 ACTGGGGCAGAGAGGAAGTAAGG - Intronic
1060208507 9:121696678-121696700 ACTGGGGACCAGAGTAGGGAAGG - Intronic
1060304364 9:122397683-122397705 ACTGAGGAGGGTAGGAAGGATGG + Intergenic
1060437529 9:123607060-123607082 ACTGTGTAGGGGAGGCTGGAAGG + Intronic
1060437799 9:123610025-123610047 ACTGGGGAGGAGATGCTTGCTGG - Intronic
1060477718 9:123998748-123998770 AATGGGGAGGGAAGGAGGGAGGG + Intergenic
1060816720 9:126639023-126639045 AAGGGGGAGGAGAGGAGGAAAGG + Intronic
1060818411 9:126647929-126647951 CCTGGGGACAGGAGGATGGAGGG - Intronic
1061064271 9:128267677-128267699 GCTCGGGAGGAAAGGATGGTGGG - Intronic
1061083259 9:128384905-128384927 ACTGGGGAGGTAGGGAGGGAAGG - Intronic
1061094117 9:128444547-128444569 AGTGGGGAGAAGAGTAGGGAAGG - Intergenic
1061477161 9:130875793-130875815 AGAGGGGAGGAAAGGAAGGAAGG - Intronic
1061650454 9:132044136-132044158 AATAGGGAGGGGAGGAGGGAAGG + Intronic
1061753073 9:132794142-132794164 ACTGGGGAAGAAAGGCTGAAGGG - Intronic
1061765546 9:132878889-132878911 ACTTGGGAGGCGAGGGTGGGTGG - Exonic
1061895173 9:133643355-133643377 GCTGGGGAGGGGAGGGTGGGCGG + Intronic
1062026647 9:134343728-134343750 GCTGGGGACGGGCGGATGGAGGG - Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062303608 9:135889585-135889607 GCTGGTGAGGAGAGGCTGGAGGG + Intronic
1185511620 X:668215-668237 AAAGGGGAGGAGAGGGAGGAGGG - Intergenic
1185726593 X:2426701-2426723 AGTGAAGAGGAAAGGATGGAAGG - Intronic
1185765140 X:2719272-2719294 ACCTGGGAGGAGAGGATGATGGG + Intronic
1185950916 X:4432906-4432928 GCTAGTGAGGAGAGGGTGGACGG + Intergenic
1186447536 X:9644386-9644408 CCAGAGGAGGAGAGGATGAAAGG + Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1186889400 X:13945408-13945430 ACTGGCTAGGAGAGGAGGGCTGG + Intergenic
1187262663 X:17701616-17701638 ACTGGGAAGGACTGGAAGGAAGG + Intronic
1187591325 X:20720579-20720601 AGAGGAGAGGAGAGGAGGGAAGG - Intergenic
1187735545 X:22300197-22300219 TCAGGGAAGGAGAGGATGAAAGG - Intergenic
1187832896 X:23400740-23400762 GCTGGGCAGAAGATGATGGAAGG - Exonic
1188175664 X:26985727-26985749 ACTGGGGAAAATAGGAAGGAAGG + Intergenic
1188624710 X:32269213-32269235 ACTTGGGAGGGGAGCATGCACGG - Intronic
1188639313 X:32479430-32479452 ACTGGGGGGAAGAGGAAGGTTGG - Intronic
1188761176 X:34032071-34032093 ACTAGGGGGGAAAGGAAGGAGGG - Intergenic
1189230255 X:39446511-39446533 ACTGAGATGGAGAGGATGAACGG - Intergenic
1190079799 X:47347364-47347386 AGTGGGGAGGGAAGGAAGGAAGG - Intergenic
1190248827 X:48707401-48707423 GCCAGGGAGGAGAGGAGGGAAGG - Intronic
1190286202 X:48962813-48962835 ACAAGGGTGGAGAAGATGGAAGG + Intronic
1190362392 X:49661573-49661595 ATTGGGAAGTAGAGGAGGGAGGG + Intergenic
1190385368 X:49878956-49878978 AGAGGGGAGGAGACGATGAAGGG + Intergenic
1190427193 X:50345011-50345033 TTTGGGGAGGAGAGGAAGGCAGG - Intronic
1190787560 X:53666519-53666541 AATGTGGAGGATAGAATGGATGG - Intronic
1192639406 X:72847827-72847849 ACTGGGGAGGCTGGGAGGGAAGG + Intronic
1192642305 X:72872978-72873000 ACTGGGGAGGCTGGGAGGGAAGG - Intronic
1192696970 X:73427263-73427285 ACTTGAGATGAGAGGATGGGAGG + Intergenic
1192880653 X:75279795-75279817 ACTTGGGAGGAAAGGGTGGGAGG - Intronic
1192945187 X:75958713-75958735 ACTGGGGGGTGGAGGGTGGAAGG - Intergenic
1193427913 X:81362426-81362448 AGTGAGGAGGAGTGGAGGGAGGG + Intergenic
1193803752 X:85969928-85969950 ACTGGGGAGAACAGGAGGGAGGG + Intronic
1193925766 X:87482090-87482112 AACGGAGAGGAGAGGTTGGAGGG + Intergenic
1194125423 X:90010648-90010670 ACTGGGGAAGAGGGGGTGGAAGG - Intergenic
1195067470 X:101250592-101250614 ACTGGGGAGTGGGGGAGGGAAGG + Intronic
1195100136 X:101547663-101547685 ACTGGGAAGGAGAGGAAATAGGG - Intergenic
1195169655 X:102253913-102253935 GGTGGGGAGGAGGGGATGGGAGG - Intergenic
1195189202 X:102433186-102433208 GGTGGGGAGGAGGGGATGGGAGG + Intronic
1195205053 X:102590311-102590333 ACAGGGAAGGATAGGAAGGAAGG + Intergenic
1195385866 X:104313238-104313260 GCTGGGGAGGAAAGGAAGGAGGG - Intergenic
1195694517 X:107656868-107656890 ACTTGGGAGGCTAAGATGGAAGG + Intergenic
1195758449 X:108221997-108222019 ATTGGAGAGGAGAGGAGAGAGGG - Intronic
1195917733 X:109952360-109952382 TTTGGGCAGGAGAGGAAGGAGGG - Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196051734 X:111312956-111312978 ACTGAGGAGGAAAGGGTGGGAGG - Intronic
1196738357 X:119000896-119000918 AAGGAGGAGGAGAGGAGGGAGGG - Intronic
1196752628 X:119131396-119131418 ACTAGAGGGGAGAGGATGGGAGG + Intronic
1196892620 X:120305860-120305882 ACTGGGGAAGACAGGATGGATGG - Intronic
1197424894 X:126283642-126283664 ACTGGAGGGTAGAGGATGGGAGG - Intergenic
1197637105 X:128927760-128927782 AATGGTGAAGAGAGAATGGAAGG - Intergenic
1197709581 X:129655692-129655714 AGTGGGGAGGAGCTGATGGGCGG - Intergenic
1198713970 X:139536303-139536325 AGAGGAGAGGAGAGGAAGGAGGG + Intronic
1198895187 X:141446297-141446319 ACTTGAGGGTAGAGGATGGAAGG - Intergenic
1198963821 X:142207632-142207654 AGTGGGCAGGAGTGGGTGGAAGG - Intergenic
1199260999 X:145774843-145774865 ACTGGAGAGAAGAGGAAGAAAGG - Intergenic
1199303824 X:146244295-146244317 ACTGGAGAGGATAGGAAAGACGG + Intergenic
1199582299 X:149372524-149372546 AATAGGGAGGAGAGGCTGAAAGG + Intergenic
1199596527 X:149510333-149510355 ACTGGAAAGAAGAGGAAGGAAGG - Intronic
1199661496 X:150054846-150054868 ACTGGGGAGTGGGGGATTGAGGG + Intergenic
1199946041 X:152668870-152668892 GCTGGGGATGTGAGGCTGGAAGG + Intergenic
1199953642 X:152725355-152725377 AAGGGGGAAGAGAGGAGGGAGGG + Intergenic
1199956038 X:152743095-152743117 AAGGGGGAAGAGAGGAGGGAGGG - Intergenic
1200094199 X:153649707-153649729 CTTGGGGAGGACAGGAGGGAAGG - Intronic
1200253106 X:154564277-154564299 AGAGGGAAGGGGAGGATGGAGGG - Intronic
1200264661 X:154640138-154640160 AGAGGGAAGGGGAGGATGGAGGG + Intergenic
1200334861 X:155339826-155339848 GCAGGGGAGGCGAGGAGGGAAGG - Intergenic
1200351605 X:155501395-155501417 GCAGGGGAGGCGAGGAGGGAAGG + Intronic
1200361917 X:155616186-155616208 AGTGGGGAGGAAAGCAAGGAAGG - Intronic
1200772980 Y:7144422-7144444 ACTAGAGGGGAGAGGAAGGAAGG + Intergenic
1200908551 Y:8510998-8511020 GGAGGGAAGGAGAGGATGGAAGG - Intergenic
1201109918 Y:10791669-10791691 ACTGGAGAGGAGTGGAGTGAAGG - Intergenic
1201158764 Y:11153535-11153557 AGTGGGGAGGGGGAGATGGATGG + Intergenic
1202029292 Y:20554825-20554847 ACTGGGGACTAAAGGATGGCTGG - Intergenic