ID: 1186731797

View in Genome Browser
Species Human (GRCh38)
Location X:12418226-12418248
Sequence ACAAGCTGTCTCTATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186731797_1186731802 11 Left 1186731797 X:12418226-12418248 CCATCACCATAGAGACAGCTTGT 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1186731802 X:12418260-12418282 TGCATGAAAGAGCAGAAATTGGG 0: 1
1: 0
2: 4
3: 27
4: 343
1186731797_1186731801 10 Left 1186731797 X:12418226-12418248 CCATCACCATAGAGACAGCTTGT 0: 1
1: 0
2: 0
3: 19
4: 151
Right 1186731801 X:12418259-12418281 GTGCATGAAAGAGCAGAAATTGG 0: 1
1: 0
2: 8
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186731797 Original CRISPR ACAAGCTGTCTCTATGGTGA TGG (reversed) Intronic
902611013 1:17597149-17597171 AGAAGCTGAATCCATGGTGAGGG - Intronic
903343138 1:22667363-22667385 AGCAGCTGTCGTTATGGTGATGG + Intergenic
904345566 1:29866516-29866538 ACAAGCTGTTCATATGCTGATGG + Intergenic
907965791 1:59328096-59328118 ACAAGCTGGCTCTCTTGTTAGGG - Intronic
909333381 1:74442804-74442826 ACAAACAGTCTCTATGGCCACGG + Intronic
910342432 1:86203189-86203211 ACAGGGTGTCTGTATGGAGAAGG - Intergenic
910640128 1:89451645-89451667 ACAAGCTGACTCTCTTGTTAGGG + Intergenic
911553862 1:99318370-99318392 GAAAGCTGTTTCTATGGTGAAGG - Intergenic
911832049 1:102562915-102562937 ACAAGCTGACTCTCTTCTGAGGG + Intergenic
912040250 1:105381362-105381384 ACAAGTTGTTTGTATGGAGAGGG - Intergenic
918694445 1:187526802-187526824 ACAGGCTGTCTCTATTATTAGGG + Intergenic
920571062 1:207018197-207018219 AGAAGCTTGCTCTATGGTCATGG + Intronic
921112994 1:212056464-212056486 TGAAGATGTATCTATGGTGATGG - Intronic
921733799 1:218603570-218603592 ATAAGATGTCTCTTTGGTAATGG - Intergenic
922192397 1:223331049-223331071 ACCAGCTGTCTCATGGGTGAGGG + Intronic
923065233 1:230511284-230511306 AGAAGCTGTCTCTTTGGGGCAGG + Intergenic
1062993269 10:1840790-1840812 ACCATCTGTGGCTATGGTGAAGG - Intergenic
1063084024 10:2798561-2798583 AGCAGGTGTTTCTATGGTGATGG + Intergenic
1065847048 10:29753688-29753710 GTAAGCTGTGTCTAAGGTGATGG + Intergenic
1065899618 10:30194006-30194028 ACAGGCTGTCTCTCTTGTTAGGG + Intergenic
1066215930 10:33287606-33287628 ACTAGCTATCTCAATAGTGATGG - Intronic
1067126061 10:43516549-43516571 ACAGGCTGTCTGCATGCTGAGGG + Intergenic
1069348204 10:67495079-67495101 ACAAGCTGTTGCTTTGGTTAGGG - Intronic
1070244942 10:74721919-74721941 ACAAGGTGTCCCCATGGTGAGGG - Intergenic
1072308388 10:94130545-94130567 ACCAGCTCTCTATCTGGTGAAGG + Intronic
1074201417 10:111239224-111239246 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
1075292847 10:121244942-121244964 ACCAGCTGTCTCTGTGGTTTCGG + Intergenic
1079132864 11:17758926-17758948 ACAGGCTGACTCTCTGGTTAAGG - Intronic
1082922972 11:58515936-58515958 ACAGGCTGACTCTATTGTTAGGG - Intergenic
1083074868 11:60026339-60026361 ACAGGATGTCCCTATGGAGAGGG - Intergenic
1086324107 11:85681098-85681120 ACAAGCTGTCTGGAGGGGGAGGG + Intronic
1091590870 12:1842386-1842408 ACGAGCTGCCTCCAGGGTGAGGG - Intronic
1092594830 12:9989819-9989841 ACAAGCTGACTCTCTTGTTAGGG + Intronic
1092599923 12:10049360-10049382 ACAAGCTGACTCTATTGTTAGGG - Intronic
1097453605 12:59767444-59767466 ACAAGCTGACTCTCTTGTTAGGG + Intronic
1097536447 12:60876362-60876384 ACAAGCTGACTCTCTTGTTAGGG + Intergenic
1097769534 12:63566403-63566425 ACAAGGGATCTCTGTGGTGATGG - Intronic
1100516236 12:95330625-95330647 ACAGGCTGACTCTATTGTTAAGG - Intergenic
1104575314 12:129961488-129961510 GCAAGCTGTCTTGATGGAGACGG + Intergenic
1105264967 13:18807899-18807921 CCAGGCTGTCTCTTTGGTGCTGG + Intergenic
1105547691 13:21363331-21363353 ACAAGCTGACTCTCTTGTCAGGG + Intergenic
1107517945 13:41149941-41149963 ACAGGCTGCCTGTTTGGTGATGG + Intergenic
1109851238 13:68067077-68067099 ACATCCTGTTTCTATGGTGGGGG - Intergenic
1113098528 13:106691944-106691966 ACATGCTTTCTCCAAGGTGAAGG - Intergenic
1113514863 13:110886419-110886441 AGAGGCTGTATCTATGGAGATGG - Intronic
1114574875 14:23703146-23703168 GCAAGCTCCCACTATGGTGATGG + Intergenic
1115048346 14:29025721-29025743 AGAAGCTGTCTTTATCGTGGTGG + Intergenic
1115541450 14:34425087-34425109 ACAAGCTGATTTTATAGTGATGG - Intronic
1116102423 14:40457380-40457402 ACAAACTGTCTCTCTTGTTAGGG - Intergenic
1119198707 14:72737058-72737080 AGAAGCTGTCTCTGGTGTGATGG - Intronic
1125692771 15:41610168-41610190 AGAAGCTGTCTCTTTGCTGAAGG + Intergenic
1126688701 15:51270461-51270483 AGAAGCTGTTTTTAGGGTGAAGG - Intronic
1127206161 15:56721358-56721380 ACAGGCTGACTCTCTGGTTAAGG - Intronic
1129189517 15:73929158-73929180 AAAAGCTGCCTGTATGGAGAGGG - Intronic
1129876052 15:78976502-78976524 ACAAGCTTGCTCTATAGTGAGGG + Intronic
1130335939 15:82957508-82957530 ACAAGCTGTTTCCATGGTGGGGG - Intronic
1130617371 15:85424143-85424165 ACAAGCTGACTCTCTTGTTAGGG - Intronic
1131660169 15:94505608-94505630 CCAGGCTGTTTCTCTGGTGAAGG - Intergenic
1132891015 16:2204890-2204912 ACAGCCTGTCTCAAGGGTGAGGG + Intronic
1135392859 16:22108260-22108282 ATAACCTGTTTGTATGGTGATGG + Intronic
1137871414 16:51953936-51953958 ACACCCTGTCACCATGGTGAGGG + Intergenic
1143417865 17:6763015-6763037 ACCAAATGTCTCTATAGTGATGG - Intronic
1143902839 17:10187036-10187058 GCAAGCTGTATCTATGTAGATGG - Intronic
1145277666 17:21443823-21443845 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
1145315500 17:21729702-21729724 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
1145713935 17:27001638-27001660 ACAAGCTGACTCTTTTGTTAGGG - Intergenic
1150031543 17:61741884-61741906 ACAGGCTGACTCTCTTGTGATGG - Intronic
1155741267 18:29291121-29291143 ACAAGCTGACTCTCTTGTTAGGG + Intergenic
1155878337 18:31113840-31113862 AAAAACTGTCTCTAAGCTGATGG + Intergenic
1156164556 18:34402725-34402747 ATAGGCTGTCTCTGTGGTGGCGG - Intergenic
1157820958 18:50767999-50768021 TAAAGCTGTATCTATGGTGTTGG - Intergenic
1160022945 18:75194651-75194673 AGAAGCTGTTTCTATTGGGAAGG + Intergenic
1160218049 18:76951208-76951230 ACAGGCTGACTCTCTTGTGAGGG - Intronic
1160320514 18:77889022-77889044 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1162191596 19:8951267-8951289 AGAACCTGTCTCAATAGTGATGG + Exonic
1163598684 19:18234936-18234958 ACAACTTGGCTCAATGGTGAGGG + Intronic
1168596052 19:57678392-57678414 CCAAGGTGTCCCTATGGTGATGG + Exonic
928318018 2:30260723-30260745 ACAACCTGGCTCAATGGAGATGG + Intronic
929031213 2:37651589-37651611 CCATGCTGCCTCTTTGGTGAAGG - Intronic
929323257 2:40572553-40572575 ACAAGCTGACTCTTTTGTTAGGG + Intronic
930507217 2:52298567-52298589 ACAAGCTGTCTCTCTTATTAGGG + Intergenic
932855412 2:75228565-75228587 GCAAGCTGTCTTAATGGAGAAGG + Intergenic
934570850 2:95372484-95372506 ACAGTATGTCTATATGGTGATGG + Intronic
940485361 2:154289861-154289883 TCAGGCTGTCTCCTTGGTGAAGG - Intronic
942110357 2:172675874-172675896 ACAGGCTGACTCTCTTGTGAAGG + Intergenic
942432611 2:175929721-175929743 AAAAGCTGTCTCAATAGTGTGGG + Exonic
942607447 2:177707819-177707841 ACCAGCTCTCTCTCTGGGGAGGG + Intronic
947448747 2:230185447-230185469 ACAAGATGTGTCTATGATGACGG - Intronic
947963769 2:234261455-234261477 AAAAACTGGCTCTATGGTAATGG - Intergenic
948721166 2:239901086-239901108 ACAAGCTGACTCTCTGGTTAGGG + Intronic
1171323749 20:24271859-24271881 ACAGGCTGTCTCTTTTGTTAGGG - Intergenic
1173225705 20:41161442-41161464 ACAAGCTGTTCGTATGCTGATGG + Intronic
1175554679 20:59841238-59841260 ACAAGCAATCTCTAATGTGAAGG - Intronic
1175990216 20:62784988-62785010 AACAGCTGTCTCTATGCTGATGG - Intergenic
1177807988 21:25893928-25893950 ACAAGCTGACTCTCTTGTTAGGG + Intronic
1178182621 21:30180743-30180765 AATAGCTGTTTCTATGGGGATGG - Intergenic
1178481767 21:32985706-32985728 ACCAGCTTTCTCTACTGTGAAGG - Intergenic
1179127910 21:38608505-38608527 ACAACCTCTCTCTATAATGAAGG - Intronic
1179433425 21:41342262-41342284 ACAAGGAATCTCTAAGGTGACGG - Intronic
1181942925 22:26492712-26492734 AAAAGCTGCCTCTTTGGTGGTGG - Exonic
1182244605 22:28945890-28945912 ACAATCTGTCTCTTTGGTAATGG + Intronic
1182820573 22:33212227-33212249 ACAGGCTGCCTCTCTTGTGAGGG + Intronic
955512555 3:59696059-59696081 ACAAGGTGTCTTTATGCTGAGGG + Intergenic
961723014 3:128908511-128908533 ACCAGCTGCCTCTAGTGTGAGGG - Intronic
962331250 3:134480676-134480698 ACAAGCTGTCTGCTGGGTGATGG - Intronic
964284481 3:155102625-155102647 ACAAGCTGTCTTTATGGTTCTGG - Intronic
969210269 4:5681914-5681936 ACAGGCTGTCTATAGGGTGGTGG + Intronic
971386216 4:26142526-26142548 AAGAGCTGGCTCTATCGTGAAGG + Intergenic
972339228 4:38136812-38136834 CCAAGCTGTCCCTCTGGTGGTGG + Intronic
976364321 4:84215915-84215937 AAAATCTCTCTCTCTGGTGATGG - Intergenic
977368872 4:96108761-96108783 ACAAGCTGACTCTCTTGTTACGG + Intergenic
977592806 4:98845100-98845122 ACAAGATATCTGTATGCTGAGGG + Intergenic
978686252 4:111447753-111447775 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
979664081 4:123291621-123291643 ACCAGCTGTGTCTACAGTGATGG + Intronic
980812565 4:137901578-137901600 ACAGGCTGTCTCTCTGTTGTGGG - Intergenic
983557133 4:169068697-169068719 ACAAACTGGGTCAATGGTGAAGG + Intergenic
986406839 5:7434463-7434485 CAAAGCTGTCTCTAAGGTGAAGG - Intronic
986614311 5:9601085-9601107 AGATGCTGTCTCTTTGGAGATGG - Intergenic
987237995 5:15962806-15962828 ACAAGCTGACTCTCTTGTTAGGG + Intergenic
987990995 5:25212555-25212577 GCAAGTTGTGCCTATGGTGATGG - Intergenic
990537552 5:56737695-56737717 ACAACCTGTCTCAATGATGGGGG - Intergenic
991159885 5:63485992-63486014 ACAAATTGACTTTATGGTGATGG + Intergenic
991346257 5:65671845-65671867 ACAGCCTATCTCTATGGTGAGGG - Intronic
991413091 5:66364590-66364612 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
1001172470 5:169433445-169433467 CCAATCTGTCTCTCTGGGGATGG - Intergenic
1001875933 5:175200521-175200543 ACAGGCTGGCTCTCTGGTTAGGG + Intergenic
1004057809 6:12158693-12158715 ACAACCTGTCTCCTTGGGGAGGG - Intronic
1004926622 6:20421974-20421996 ACAGGCTGACTCTTTGGTTAGGG - Intronic
1006012924 6:31057444-31057466 ACAAACTGTCTCTTTGGTGCAGG - Intergenic
1008808981 6:55469195-55469217 AGAAGCTGTCTCTATCTTGTAGG - Intronic
1009542387 6:64978184-64978206 ACAAGCTGACACTCTGGTTAGGG + Intronic
1010022830 6:71181102-71181124 ACAAGCTATTTTTATGCTGAGGG + Intergenic
1011753273 6:90474444-90474466 ACAAACTGTCACGATGGTGAAGG + Intergenic
1011908468 6:92403995-92404017 ACAAGCTGACTCTCTTGTTAGGG - Intergenic
1012304582 6:97637237-97637259 ACAGGCTGACTCTCTTGTGAAGG + Intergenic
1016928433 6:149378066-149378088 ACAAGATATCTTTATGGTGAAGG + Exonic
1019173587 6:170148390-170148412 AGAAGCTGTCTCAGTGGGGAAGG - Intergenic
1021472171 7:21016255-21016277 ACAGGCTGACTCTTTAGTGAGGG - Intergenic
1022367371 7:29736398-29736420 ACAAGGGATCTCTGTGGTGATGG + Intergenic
1022928814 7:35087502-35087524 ACAAGGGATCTCTGTGGTGATGG - Intergenic
1023668602 7:42552701-42552723 ACCAGCTTTCTCTATGATCATGG + Intergenic
1025254812 7:57376963-57376985 CCAAGTAGTCTCTATGGGGAAGG + Intergenic
1029533471 7:101141149-101141171 ACAAGCCTCCTCTGTGGTGAGGG - Intergenic
1029824923 7:103181177-103181199 ACAAGGGATCTCTATGGTGATGG - Intergenic
1030013201 7:105191548-105191570 ACACTCTATCTCTATGGGGAAGG + Intronic
1030912522 7:115269547-115269569 ACAAGCTGTCCCAATAGAGATGG + Intergenic
1032153988 7:129453422-129453444 ACAGGGGGTCTCTATAGTGAGGG - Intronic
1034455137 7:151166204-151166226 ACACCCTGCCTCTATGGAGAGGG + Intronic
1035036115 7:155895520-155895542 ACAGGCTGACTCTCTTGTGAGGG + Intergenic
1035066898 7:156112137-156112159 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1035092325 7:156323991-156324013 ACAGGCTGACTCTCTTGTGAGGG - Intergenic
1035167029 7:156997338-156997360 ACAGGCTGACTCTCTTGTGAGGG - Intronic
1035327268 7:158073277-158073299 ACAGGCTGTCTCTGAGCTGAGGG - Intronic
1036116788 8:5967726-5967748 AGACTCTGTCTCTATGGTTATGG - Intergenic
1042852043 8:73226215-73226237 ACAAGATTTTTTTATGGTGATGG + Intergenic
1044153054 8:88805396-88805418 ATAAGCAGTCTAGATGGTGAGGG - Intergenic
1045941975 8:107749843-107749865 ACAAGCTGTGGCTAAGTTGAAGG - Intergenic
1046048519 8:108991481-108991503 ATAAGCTCTCTATATGGTGCTGG - Intergenic
1047078351 8:121431080-121431102 TCAAGCTGTCTATTTGGTGGAGG - Intergenic
1050444874 9:5710229-5710251 TCAAGCAATCTCTATGTTGATGG - Intronic
1057984549 9:99698543-99698565 ACAGGCTGACTCTATTGTTAGGG + Intergenic
1058650853 9:107174660-107174682 ACAGGCAGCCTCTGTGGTGAGGG + Intergenic
1059408416 9:114116694-114116716 ACATGCTGTCCCTATGCTGGGGG + Intergenic
1062305068 9:135901227-135901249 ACAAGCTGAATCTATGGAGCTGG - Intronic
1186731797 X:12418226-12418248 ACAAGCTGTCTCTATGGTGATGG - Intronic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1192397951 X:70802991-70803013 ACAAGTTGTCTAGATTGTGAGGG + Intronic
1194716766 X:97295657-97295679 ACAATCTGACTCTATAGTTAAGG + Intronic
1194872389 X:99147696-99147718 TCAAGATGTATCTATGGTGTCGG - Intergenic
1198847052 X:140923495-140923517 AGAAACTGTCAGTATGGTGAAGG + Intergenic
1199814987 X:151389199-151389221 CCAAGCTGTGTGTGTGGTGAAGG + Intergenic