ID: 1186732510

View in Genome Browser
Species Human (GRCh38)
Location X:12425208-12425230
Sequence AAGACTAAACAGGAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186732510 Original CRISPR AAGACTAAACAGGAGGAAGG TGG (reversed) Intronic
900032047 1:379284-379306 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
900052596 1:607470-607492 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
901449402 1:9326782-9326804 CAGACTAAACTGCAGGAATGAGG - Intronic
901590405 1:10336600-10336622 GAGACTACACAGGGGGAGGGAGG - Intronic
901748822 1:11393293-11393315 CATTCTAAACAGCAGGAAGGAGG - Intergenic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
905109836 1:35587263-35587285 GAGGCTAAGCAGGAGGATGGAGG + Intronic
905317294 1:37091297-37091319 CACACTTATCAGGAGGAAGGTGG + Intergenic
905343998 1:37299164-37299186 AAGACAGAACAGGAGGGAGGAGG - Intergenic
906616871 1:47239516-47239538 GAGACCAAAAAAGAGGAAGGAGG - Intergenic
906668560 1:47638686-47638708 AACACAAGCCAGGAGGAAGGAGG + Intergenic
906920945 1:50063876-50063898 AAGACCATACATGAGGAAAGAGG - Intronic
908387826 1:63659239-63659261 AAGACTTAACAGCAGGAGAGTGG + Intronic
908445360 1:64194752-64194774 AAGATCAAACAGGAAGAAGGAGG - Intergenic
908564787 1:65343206-65343228 TCCACTACACAGGAGGAAGGAGG - Intronic
910048305 1:82944506-82944528 CAAACAAAACTGGAGGAAGGTGG + Intergenic
911150362 1:94592346-94592368 AAGACTTAAAAGGAGAAAAGAGG + Intergenic
911377095 1:97064103-97064125 ATAACTGAACAGGAGAAAGGAGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912702023 1:111885162-111885184 GTGACTAAGGAGGAGGAAGGTGG + Intronic
912912885 1:113780529-113780551 AAACCTAAAAAAGAGGAAGGCGG + Intronic
913468376 1:119166287-119166309 AAGAAAAGACAGGAGGACGGAGG + Intergenic
913986957 1:143574393-143574415 AAAAATAAACAGGTAGAAGGTGG + Intergenic
915016155 1:152736103-152736125 AAGATTAAACAGCAGGAAAGAGG - Intergenic
915272715 1:154766654-154766676 AAAACAAAACAGTAGGAAAGTGG - Intronic
916513564 1:165495145-165495167 AAGACTTAAGAAGAGGTAGGAGG + Intergenic
917160458 1:172051583-172051605 AAATCTAAAGAGGATGAAGGGGG - Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920130827 1:203730600-203730622 AAGACTGGAAAGGAGCAAGGAGG - Intronic
920366708 1:205451598-205451620 GAGACAAAACAGGAGTGAGGGGG + Intronic
920861386 1:209710434-209710456 AAGACTTCATAGGAGGTAGGGGG - Intronic
920915113 1:210252781-210252803 GAGACTACCCAGGTGGAAGGCGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
922033100 1:221823447-221823469 AAGACTACACCATAGGAAGGAGG + Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
923766798 1:236899797-236899819 AAGACTACACAAGAGGAAATAGG + Exonic
923880900 1:238103173-238103195 GAGACTCAGCAGGGGGAAGGGGG - Intergenic
924948845 1:248864362-248864384 AAGACTAACAATGAGGAAAGGGG - Intergenic
1062840738 10:669299-669321 AAGACAAGACAGAAGCAAGGGGG + Intronic
1063460495 10:6212352-6212374 AAGACAAAACAGCAGGAAGGGGG - Intronic
1064101860 10:12471035-12471057 AAGACACAAAGGGAGGAAGGAGG - Intronic
1064915960 10:20458599-20458621 AAATTTAAACAGGAGCAAGGTGG + Intergenic
1064935264 10:20672244-20672266 AAGACAGCACAGGAGAAAGGAGG + Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065356963 10:24851637-24851659 AGGACTACTCGGGAGGAAGGAGG + Intronic
1065819547 10:29512797-29512819 CAGACTCAGCAGGAGGCAGGAGG - Exonic
1065953308 10:30671608-30671630 CAGACTCAGCAGGAGGCAGGAGG + Intergenic
1067819542 10:49516138-49516160 AATACTAAACATGAGGAATATGG - Exonic
1068895512 10:62195552-62195574 AAGACAAAAAGGAAGGAAGGAGG + Exonic
1069817277 10:71206411-71206433 AAAACAAAGCAGGAGGAAGGAGG + Intergenic
1071154365 10:82672323-82672345 GAGACTGGAGAGGAGGAAGGGGG + Intronic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1072813049 10:98478389-98478411 AAGAGGAAACAGGGGGAATGGGG + Intronic
1073703245 10:105954157-105954179 AGGAAAGAACAGGAGGAAGGAGG + Intergenic
1073941225 10:108700550-108700572 AAAACAAAACAAGAAGAAGGTGG - Intergenic
1074013607 10:109509403-109509425 AAAGCTAATCAGGAGGAAGAGGG - Intergenic
1074519871 10:114209384-114209406 AGCACTAAACTGGAGTAAGGGGG - Intronic
1074934810 10:118167379-118167401 AAAGCCAAACAGGAGGAAGATGG - Intergenic
1076034127 10:127184784-127184806 CAGACTATCCATGAGGAAGGAGG - Intronic
1077003841 11:341120-341142 AAAAGGAAAGAGGAGGAAGGAGG + Intergenic
1077531316 11:3096963-3096985 AAGAGGAAAGAGGGGGAAGGTGG + Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079315710 11:19406352-19406374 AAGACTAAACAATACGAATGGGG + Intronic
1079490182 11:20980186-20980208 AAGACTACAAAGGAGGAAGGAGG + Intronic
1079709829 11:23667002-23667024 AACACTTAACAGGGGGAAGGAGG - Intergenic
1080878209 11:36295887-36295909 AAGACTAACAAAGAGGCAGGTGG + Intergenic
1081882800 11:46468383-46468405 AAGAAAAAAGAAGAGGAAGGAGG + Intronic
1082745451 11:56956237-56956259 AAGAATAAAAGGGAGGAAGAAGG + Intergenic
1082825099 11:57571782-57571804 GAGACTAACCCAGAGGAAGGGGG - Intergenic
1083133462 11:60648650-60648672 AAGACTAAAGGGGAGGAAGTTGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1085402789 11:76244555-76244577 CTGACTAACCAGGAGAAAGGAGG + Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086342374 11:85859113-85859135 AAAAATAAAAAGCAGGAAGGTGG + Intronic
1086856785 11:91874963-91874985 AAGACAAAAGAGGAGTAAGTTGG - Intergenic
1087630079 11:100639546-100639568 AAGAGTACAGGGGAGGAAGGAGG - Intergenic
1088779946 11:113124209-113124231 TAGACTGAGAAGGAGGAAGGAGG + Intronic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1088900763 11:114115330-114115352 AAAAAAAAAAAGGAGGAAGGAGG - Intronic
1089826045 11:121278831-121278853 GAGACAAAGAAGGAGGAAGGAGG - Intergenic
1091447482 12:552348-552370 CAGACTAGAGTGGAGGAAGGAGG - Intronic
1092558873 12:9588475-9588497 AAAACTAGAAAGGATGAAGGAGG - Intergenic
1092889382 12:12954548-12954570 ATGACTAACCAGCAGGAAGGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093384469 12:18534626-18534648 AAGACTATATAAAAGGAAGGTGG + Intronic
1093508369 12:19896592-19896614 AAGAAAGAAGAGGAGGAAGGAGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094443829 12:30508091-30508113 AAGAACAAAGAGGAGGATGGAGG - Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1095518888 12:43038329-43038351 AAGAAAGAACATGAGGAAGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097562999 12:61231963-61231985 AATACTAAACATGAGGAATACGG - Intergenic
1097625429 12:61994370-61994392 AAAAGGCAACAGGAGGAAGGAGG - Intronic
1098377416 12:69831961-69831983 AAGAATAAAGAGGAGGCTGGAGG + Intronic
1098605276 12:72382025-72382047 GAAACAAAACAGGAGCAAGGGGG + Intronic
1099417337 12:82407637-82407659 AAGAATAAGCAGGAGGAAACAGG + Intronic
1100762038 12:97818870-97818892 AAGACTAAAAAGAAAGAAAGTGG - Intergenic
1101475847 12:105047434-105047456 CAGTCTAAACAGGAAGAAGGAGG - Intronic
1101865063 12:108514783-108514805 AAGAGTAAAGAAGAAGAAGGCGG + Intergenic
1102138256 12:110593211-110593233 CTGACTAAACTGGAGGAGGGTGG + Intergenic
1102960264 12:117088213-117088235 AAGACTAAAGATGATGAAGGGGG + Intronic
1103861784 12:124021138-124021160 AAGCCTGATCTGGAGGAAGGAGG + Intronic
1104497087 12:129251059-129251081 AAGACTAAAGAAGAGAAAGCTGG + Intronic
1106642435 13:31598381-31598403 AAAACTGAACTGGAGGAAGTGGG - Intergenic
1106688239 13:32085482-32085504 AACACTAAAGAGGTGGAAGCAGG - Intronic
1107406154 13:40115767-40115789 AAGAATAAACACGAGAAGGGTGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107430051 13:40332415-40332437 ATGACTGAACCTGAGGAAGGGGG + Intergenic
1107573312 13:41686907-41686929 AAGCCCAAACAGGATGAAGATGG - Intronic
1107918801 13:45182105-45182127 AAAACTAAACTGGTGGAAGCTGG - Intronic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108730727 13:53232742-53232764 ATGATTAAAAATGAGGAAGGAGG + Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109031835 13:57200168-57200190 CAGTCTAAAGAGGAGGGAGGAGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109969794 13:69753084-69753106 AAGGCAAAATGGGAGGAAGGAGG - Intronic
1110002591 13:70223866-70223888 TAGACAATACAGGAAGAAGGAGG - Intergenic
1110548875 13:76789705-76789727 GAGACAAAAGAGGAGAAAGGTGG - Intergenic
1110954968 13:81542756-81542778 AAGACCAAACAGAAGTAAGGGGG - Intergenic
1111456863 13:88495887-88495909 GAGAATAAATATGAGGAAGGTGG + Intergenic
1112689778 13:101879199-101879221 AAGACAAAACTGGAGGAAAAGGG - Intronic
1113248852 13:108428962-108428984 AAGTCTGTAGAGGAGGAAGGCGG - Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1115556505 14:34548593-34548615 AAAACAAAACAGAAGGCAGGAGG + Intergenic
1116716449 14:48432102-48432124 GAGCCCAAACAGGAGGAAGCTGG + Intergenic
1117667005 14:58066608-58066630 AAAAATAAACAGGGAGAAGGGGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119738907 14:77001198-77001220 ACAACGAAACAGGAGGGAGGAGG - Intergenic
1120751466 14:88202566-88202588 GAGACGAAAGAGGAGGACGGAGG - Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122638027 14:103139232-103139254 GAGACTCCGCAGGAGGAAGGAGG + Intergenic
1123628433 15:22243981-22244003 AGGACTAAAGAGGCAGAAGGGGG - Intergenic
1123707530 15:22960719-22960741 ATGCCTAAGCAGGAGGAGGGCGG - Intronic
1124158639 15:27250044-27250066 AAGAACAGACAGGAGGATGGAGG - Intronic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124647804 15:31452021-31452043 AACAATAAAAAGGAGGTAGGTGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124846207 15:33293421-33293443 AAGACAAAAGAGGAGAAAGTGGG - Intergenic
1125240224 15:37565628-37565650 TGGACTCAACAGGAGAAAGGAGG + Intergenic
1125592610 15:40864244-40864266 AACTCTAAAGAGGATGAAGGTGG + Intergenic
1127885332 15:63194083-63194105 AATACCTAACAGGAAGAAGGGGG - Intronic
1127933658 15:63615160-63615182 AGGACTAAGGAGGAGTAAGGAGG + Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128734706 15:70046687-70046709 GAGACGCAGCAGGAGGAAGGAGG + Intergenic
1129575640 15:76741478-76741500 AAGATTAATCTGGAGGGAGGAGG + Intronic
1129785079 15:78304529-78304551 AAGTCTCTACAGGAGGAGGGGGG - Intergenic
1129934333 15:79437177-79437199 AAGACTGAACAGTGGTAAGGAGG + Intronic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1135218559 16:20593561-20593583 GAGACTCAGAAGGAGGAAGGTGG - Intergenic
1135555706 16:23434777-23434799 AAAACTCACCAGGATGAAGGTGG + Intronic
1137005342 16:35270562-35270584 GAGACTTACCAGGAGAAAGGTGG - Intergenic
1137648030 16:50092985-50093007 AAGACTAAAATGAAGGCAGGAGG + Intronic
1137915304 16:52423746-52423768 AAGACAAAAGAGGAGGTAGTAGG + Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1139084557 16:63568693-63568715 AAGATGAAACAGAAGTAAGGTGG + Intergenic
1139191698 16:64871298-64871320 AAGATTAAAAAGTATGAAGGAGG + Intergenic
1140855050 16:78970744-78970766 ACGACTAATAAGGAAGAAGGAGG - Intronic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1141975504 16:87513350-87513372 AGGACTAAAGAGGCAGAAGGGGG + Intergenic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1144620965 17:16818286-16818308 TGGACTAATCAGGAGTAAGGAGG + Intergenic
1146053700 17:29570789-29570811 GAGAATAAACAGGAGCAAAGGGG - Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1147572943 17:41582579-41582601 TGGACTAATCAGGAGTAAGGAGG + Intronic
1148135579 17:45289764-45289786 AAAACCAACCAGGAGGAAGTGGG + Intronic
1148582170 17:48751837-48751859 AAAACTAAACAGAAAGAAAGGGG - Intergenic
1149114166 17:53071732-53071754 AAGAAGAAAAAGGAGGGAGGAGG + Intergenic
1150423613 17:65058955-65058977 AAGAAGAAGAAGGAGGAAGGAGG + Intergenic
1152147468 17:78576995-78577017 AGGACTCCACAGGAGGAAGCTGG + Intronic
1152947607 17:83206430-83206452 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1153818708 18:8813536-8813558 AAGACTAAACTGGAAAGAGGAGG + Intronic
1155338274 18:24787453-24787475 AACACTAATCAGGAGGAAGCTGG - Intergenic
1156727638 18:40148420-40148442 AAGACTAGACTAGAGGAAGCAGG - Intergenic
1157777397 18:50406385-50406407 GAGACTCACCAGGAGAAAGGTGG + Intergenic
1159622014 18:70649860-70649882 AAGCCAAAACAGGAGGGAGCGGG - Intronic
1160162984 18:76489932-76489954 AAAACTAACCAAGAGGAATGGGG - Intronic
1161839991 19:6674254-6674276 AATCCCAAACAGGAGAAAGGGGG + Intergenic
1162062591 19:8105972-8105994 ATGACAAAAGAGGAGGCAGGGGG + Intronic
1162648229 19:12065260-12065282 AAGTTTTAACAGGAGAAAGGGGG - Intronic
1162897983 19:13776766-13776788 AAGAGGAAACAGGAGTGAGGAGG - Intronic
1163433932 19:17283949-17283971 AAGACTAACCAGGAGCAATCTGG - Exonic
1163592962 19:18204603-18204625 AAGAATAAACAGGAGTCAAGAGG + Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166144411 19:40824247-40824269 AAGACTAAGCAGGTGGAGGCGGG + Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1168231769 19:55037115-55037137 AAGGCTAAGCAGGAAGAAGATGG - Intronic
1168487866 19:56779799-56779821 AAGACTAAAAAGGGGGCATGAGG + Intronic
925304002 2:2836359-2836381 AGGACAAAACAGGAGGCAGCTGG + Intergenic
925304031 2:2836491-2836513 AGGACAAAACAGGAGGCAGCTGG + Intergenic
925378699 2:3408219-3408241 AACACTAAAGAGGAGGGAAGCGG + Intronic
926574842 2:14568882-14568904 AAGCCAAAAAAGGAAGAAGGGGG + Intergenic
927616421 2:24601601-24601623 AAAAAAAAAAAGGAGGAAGGAGG - Intronic
928102623 2:28448309-28448331 AAGTTTCAACAAGAGGAAGGAGG - Intergenic
928614257 2:33020771-33020793 AATACTCATAAGGAGGAAGGTGG - Intronic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
930302247 2:49631342-49631364 AAGACTGAAGGGGAGAAAGGGGG - Intergenic
931330073 2:61271673-61271695 AAGAAGAAAGAGGAGAAAGGAGG + Intronic
931431221 2:62210466-62210488 AAGATTAAAAAGGAGGACAGTGG + Intronic
932593230 2:73079610-73079632 AACACTGTCCAGGAGGAAGGGGG - Intronic
932888347 2:75568185-75568207 AAGATTAAAGAGAAGGAAAGAGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933700118 2:85249002-85249024 AAAAAAAAACAGGAGGAAGTAGG + Intronic
933835579 2:86242874-86242896 AAGAGTAAGTGGGAGGAAGGTGG + Intronic
934212160 2:89990319-89990341 ATGACTAAAAAGGAAGCAGGTGG - Intergenic
934516434 2:94990922-94990944 CAGATTTAACAGGAGAAAGGAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935849743 2:107205460-107205482 AAGACTAAGCAGGAGGATTTGGG + Intergenic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
937059206 2:118969133-118969155 AACACAAGCCAGGAGGAAGGAGG - Intronic
937193158 2:120124019-120124041 AAGAATAAAGAAGAGGAAAGGGG + Intronic
937229313 2:120388319-120388341 AAGGATAATGAGGAGGAAGGAGG + Intergenic
937675871 2:124589558-124589580 AAGTCGAAAAAGGAGGCAGGAGG - Intronic
939046457 2:137256022-137256044 AAAAAAAAACAGGAAGAAGGGGG - Intronic
940830829 2:158463466-158463488 AAGGCTAGAAAAGAGGAAGGGGG + Intronic
944320800 2:198339571-198339593 AAGTCTGCACAGGATGAAGGAGG - Intronic
944478626 2:200132030-200132052 AAGAATAATCAGGGGAAAGGAGG + Intergenic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
946100206 2:217314123-217314145 AAGTCAGAACAAGAGGAAGGGGG - Intronic
946109744 2:217404128-217404150 GAGACTCAACTGGAGGAGGGAGG - Intronic
947013666 2:225593404-225593426 AAGTCTCAGAAGGAGGAAGGGGG - Intronic
947760956 2:232603460-232603482 AGGAGGAAAGAGGAGGAAGGAGG + Intergenic
948752372 2:240140061-240140083 AAGCCTGTGCAGGAGGAAGGAGG - Exonic
1170177910 20:13493397-13493419 AAGACAAAGCAGGGGGAAGAAGG + Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1172418116 20:34788617-34788639 AAGCCTAAATATGAGGTAGGAGG - Intronic
1172873938 20:38152859-38152881 GAGGCCAAGCAGGAGGAAGGGGG + Intronic
1173077256 20:39831211-39831233 AAGACTATACTGGAAGAGGGTGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173260774 20:41432998-41433020 AAGACTCAACAGCAGAATGGTGG + Intronic
1174308333 20:49631196-49631218 AAAACCAAACAGAAGGAACGAGG - Intergenic
1174855222 20:54038279-54038301 GAGAATAAACAGGAGTAAGCAGG - Intronic
1175167078 20:57051957-57051979 AAGACTCAATAGGACGAAGAAGG + Intergenic
1175461628 20:59155952-59155974 AAGACTAAAGAGGAAGAAGTAGG + Intergenic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1179981415 21:44897802-44897824 AGGACTGAGCTGGAGGAAGGAGG - Intronic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1181174491 22:21028006-21028028 AGGACTACACAGGAAGAGGGTGG - Exonic
1181565137 22:23731956-23731978 AATTTTAAACAGGAGGAATGAGG + Intergenic
1184195083 22:42922244-42922266 AAGCCCAAAGGGGAGGAAGGAGG - Intronic
1184245891 22:43235551-43235573 AAGAGGAAACAGGCGGTAGGTGG + Intronic
949573046 3:5311822-5311844 AAGACTGAAAAGCAGGAAGCGGG - Intergenic
949651502 3:6165070-6165092 AAAACTAGAAAGGTGGAAGGAGG + Intergenic
949961894 3:9319110-9319132 AAGATTAAACAGGAGAATGCAGG - Intronic
950505209 3:13390377-13390399 ATGGCAAATCAGGAGGAAGGCGG + Intronic
951543870 3:23806723-23806745 AAGCCGAAACAGGGGGACGGAGG - Intronic
952498278 3:33935244-33935266 AAGATTAAAGTGGAGTAAGGAGG - Intergenic
952797107 3:37249586-37249608 AAGACAAAACAGGAAGAATAAGG - Intronic
953824727 3:46241194-46241216 AAGACAAAGAAAGAGGAAGGAGG - Intronic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
954118704 3:48482233-48482255 AAGACTAACCACGAAAAAGGAGG + Intronic
955351917 3:58199948-58199970 AGAACTCAAGAGGAGGAAGGGGG + Intronic
955736904 3:62048340-62048362 AAGACTCAACAGCAAGTAGGAGG - Intronic
956223624 3:66931684-66931706 AAGAAGAAAAAGGAAGAAGGTGG - Intergenic
956234125 3:67048649-67048671 AGGACAAAACAGGAAGAAGGTGG - Intergenic
957163715 3:76643575-76643597 AAGTCTAACCAGGAAAAAGGAGG + Intronic
958122048 3:89303465-89303487 AAGAAAATAAAGGAGGAAGGAGG + Intronic
959034673 3:101346995-101347017 AGGAAGAAAGAGGAGGAAGGAGG + Intronic
961672864 3:128547638-128547660 CAGTCTCAACAGGAGCAAGGCGG + Intergenic
961755912 3:129127286-129127308 AAAGCAAAACAGGAGGGAGGTGG + Intronic
962101456 3:132347003-132347025 AAGAGGAAACATGAGGAAAGTGG - Intronic
962102365 3:132356313-132356335 AAGCCTAAAAAGAAGGGAGGAGG + Intronic
962189829 3:133298819-133298841 AATATTAAACAGTAGAAAGGTGG - Intronic
962200162 3:133394423-133394445 AAGAGAAAACAGGGAGAAGGAGG - Intronic
962865937 3:139448080-139448102 AAGAAGAGAAAGGAGGAAGGAGG - Intergenic
963079582 3:141378482-141378504 AAGACAACACTGGGGGAAGGTGG + Intronic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963754895 3:149224558-149224580 AAAAATAAACAGGAGGGAGAAGG + Intergenic
964373626 3:156028237-156028259 AAGACTTAACTTGAGAAAGGTGG - Intergenic
964473557 3:157078536-157078558 AAGATTCATCATGAGGAAGGGGG + Intergenic
965014811 3:163143463-163143485 TAGCCTAAACAAGAGGAATGAGG - Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967637984 3:191827379-191827401 AAGACTATAGAAGAAGAAGGAGG + Intergenic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968451618 4:678667-678689 AAGACCAAGAAGAAGGAAGGGGG + Exonic
969545930 4:7827768-7827790 AAATCTTAAGAGGAGGAAGGCGG + Intronic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970512230 4:16792797-16792819 AAGCTTTAACAAGAGGAAGGAGG + Intronic
971141032 4:23924864-23924886 TACACCAAACAGGAGAAAGGTGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971655249 4:29336003-29336025 TAGAAGAAAAAGGAGGAAGGAGG - Intergenic
972691121 4:41399309-41399331 AAGAATAGAGAGGATGAAGGGGG + Intronic
973252583 4:48075732-48075754 AAGACAAGACCGGAGGATGGTGG + Intronic
973319126 4:48792338-48792360 AAGAGGAAAGAGGAGGCAGGAGG + Intergenic
975167394 4:71192675-71192697 AAAACTTAACAGAAGGAAGAGGG - Intronic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
975687097 4:76927684-76927706 AACAATAAAAAGGAGAAAGGAGG - Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977536775 4:98262334-98262356 CAGATTAGACAGGAGGAAGCTGG - Intronic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
979929502 4:126612859-126612881 ATGATTAAATAGGAGCAAGGAGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980271330 4:130587837-130587859 TATACTAAACAGGTGGGAGGGGG - Intergenic
980579214 4:134728048-134728070 AAGAGTAAAAATGAGGAAAGTGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
984038331 4:174697072-174697094 AAGACTACACATGAGAAAAGAGG + Intronic
984162612 4:176272600-176272622 GAGACTCGAAAGGAGGAAGGTGG - Intronic
985103334 4:186479103-186479125 ATCACTAAACAGCAGGATGGGGG + Intronic
987396619 5:17430593-17430615 AACTCTAAACGGGAGAAAGGGGG + Intergenic
988276648 5:29089631-29089653 AAGAACAAAAAGGAAGAAGGAGG - Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988718732 5:33854698-33854720 AAGACAAAAAGGGAGGGAGGGGG + Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993156347 5:84229488-84229510 AAGATTAAAAAGGAGGAAAATGG - Intronic
994550616 5:101230858-101230880 AACACTGGACAGGAGGGAGGTGG - Intergenic
995533529 5:113113783-113113805 GAGACAAAACAGCAGGAGGGAGG + Intronic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996174103 5:120333288-120333310 AACAATAAAAAGGAGGAAGAAGG - Intergenic
996742040 5:126808578-126808600 AAGACGAAAGAGGAAGGAGGAGG + Intronic
997419950 5:133758382-133758404 AAGAATAAACATAAGGAAAGTGG + Intergenic
997962837 5:138335584-138335606 AAGACTAAAAAGGGGGCAGCAGG + Intronic
998374270 5:141680953-141680975 CAGCCTAGATAGGAGGAAGGAGG + Intronic
999905233 5:156134110-156134132 AAGAATAAACAAGTTGAAGGGGG - Intronic
1000420883 5:161036644-161036666 AAGACTAGATATGAGGAAAGAGG - Intergenic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001108407 5:168875306-168875328 AAGAAGAAAGAGGAGGAAGGAGG + Intronic
1002741773 5:181439584-181439606 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1003315854 6:5011353-5011375 GAGACACAGCAGGAGGAAGGAGG + Intergenic
1004007414 6:11649881-11649903 TAGACGAAACAGCAGGAAGTAGG + Intergenic
1004785131 6:18960135-18960157 AAGAATAAAGTGCAGGAAGGGGG + Intergenic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1006002824 6:30979231-30979253 AAGACTAAATAGGACCCAGGAGG + Intergenic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1007124823 6:39417164-39417186 AGGACTAAGGAGGAGGAAGGTGG - Intronic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008318089 6:50071884-50071906 AAGAGTAGACTAGAGGAAGGAGG + Intergenic
1008415691 6:51237428-51237450 ATGACTAAACATTAGGAAAGGGG + Intergenic
1009890944 6:69681136-69681158 AACACTAAACATGGGGGAGGGGG + Intronic
1009907284 6:69885218-69885240 AAGCCAAATCAGGAGGAAAGTGG + Intronic
1009961477 6:70527891-70527913 AAGATTAAAAAGGAGCAAAGGGG + Intronic
1011523418 6:88236587-88236609 AAGACATAACAGCAGGAAGAGGG + Intergenic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014894784 6:126888700-126888722 AAGATACAACATGAGGAAGGGGG - Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1015882554 6:137883608-137883630 AAGAGAAAACAAGAGGGAGGAGG + Intergenic
1017064978 6:150520084-150520106 CACTCTAAGCAGGAGGAAGGAGG + Intergenic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1017837811 6:158195184-158195206 ATGACTTAACTGGAGGCAGGAGG + Exonic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1018239294 6:161756595-161756617 AAGAAAAAAGAGGAGGTAGGGGG - Intronic
1019246913 6:170715341-170715363 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1022029270 7:26477544-26477566 GAGACTGCAGAGGAGGAAGGAGG + Intergenic
1022148734 7:27576150-27576172 AAGACAAGACATGAGGGAGGAGG + Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022821138 7:33961991-33962013 AAGACTAAATAGGAGAAACTAGG + Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1024827141 7:53404016-53404038 GTGAGTAAACAGGAAGAAGGTGG + Intergenic
1025757911 7:64362684-64362706 AAAACGAAACAAGGGGAAGGTGG + Intergenic
1026944481 7:74307056-74307078 AATAGTGAACAGGAAGAAGGGGG - Intronic
1030241672 7:107332836-107332858 AACACTGAAAAGAAGGAAGGAGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032666727 7:134044166-134044188 AAAACAAAATGGGAGGAAGGTGG - Intronic
1033395023 7:140965296-140965318 AAGACTGAAAAAGGGGAAGGGGG + Intergenic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1034033131 7:147789707-147789729 AAGAAAAAGCAGGCGGAAGGAGG + Intronic
1034380269 7:150686293-150686315 AAGACTCAACATGAGGGAGGAGG + Intronic
1034844998 7:154436322-154436344 AAGAGTATACAGGAAGGAGGTGG - Intronic
1035501228 8:92612-92634 GAGACTCAAGAGGAGGAAGAGGG - Intergenic
1035664778 8:1373036-1373058 AAGAAACAACAGGAGGAACGTGG - Intergenic
1037340949 8:17844293-17844315 AAGCCCAAACACCAGGAAGGTGG - Intergenic
1037390500 8:18387182-18387204 AAACCTAAGCAGGAAGAAGGCGG - Intergenic
1037420037 8:18692454-18692476 AAGAATGAACAGGAGAAAAGAGG + Intronic
1039931000 8:41989031-41989053 AATAGAAAACAGGAGGAAAGTGG + Intronic
1040108532 8:43554552-43554574 GAGACTCACCAGGAGAAAGGTGG - Intergenic
1040522713 8:48192328-48192350 CAGGCTAAACATGTGGAAGGAGG + Intergenic
1041584246 8:59497171-59497193 AATACTAGAAAGAAGGAAGGAGG + Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041928656 8:63264570-63264592 CAGACTACAAAGCAGGAAGGAGG - Intergenic
1042100567 8:65271513-65271535 AAGATGAAAAAGGAGGACGGGGG + Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042746770 8:72116896-72116918 AATACTAAACAGAAGAAAGCAGG - Intronic
1042889336 8:73589972-73589994 AAGAAGAAAGAGGAGGGAGGAGG + Intronic
1043648541 8:82557028-82557050 AAAGATAAACAGGATGAAGGAGG - Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1045130538 8:99147060-99147082 AATTTTAATCAGGAGGAAGGGGG + Intronic
1045159204 8:99518573-99518595 AAGGCAAAATAGTAGGAAGGTGG - Intronic
1045225578 8:100241773-100241795 AAAACAAAAAAGGGGGAAGGGGG - Exonic
1045433811 8:102139220-102139242 AAAACAAAACAGGTGGAAGAAGG - Intergenic
1045734296 8:105277010-105277032 GAGACAAAACTGGAGGATGGTGG - Intronic
1045804467 8:106141356-106141378 AAGAATAAACAAGAGCAAGAGGG - Intergenic
1046953611 8:120041491-120041513 AAGAGTTAACAGGAAGCAGGAGG - Intronic
1048235249 8:132683492-132683514 AAGACCAAAAAGGAAGAGGGAGG - Intergenic
1049041398 8:140114652-140114674 AAGACAAAGAAGGAGGAAAGAGG + Intronic
1049101145 8:140579964-140579986 AAGACGAACAAGGAGGAAGAGGG + Intronic
1049605873 8:143528963-143528985 AATACAAAACATGAGGCAGGAGG + Intronic
1051761288 9:20467748-20467770 AAGACTAAATACGAAGAAAGAGG + Intronic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1053063017 9:35045912-35045934 AAGCCAAACCAGGGGGAAGGTGG + Exonic
1054764914 9:69035514-69035536 AATTCTAAACAGGAGGAACTTGG - Exonic
1054831286 9:69627937-69627959 AAGCATACACAGGAGGAGGGAGG - Intronic
1054880212 9:70136634-70136656 ATGAAAAAAAAGGAGGAAGGGGG + Intronic
1055699091 9:78921761-78921783 AAGGCTGAGGAGGAGGAAGGAGG + Intergenic
1055989509 9:82090577-82090599 AGGAAAAAACAGGAAGAAGGAGG - Intergenic
1056045924 9:82715808-82715830 AAAACTACACAGAAGGAAAGAGG - Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1057952902 9:99384340-99384362 AAGACCAAATAGGAAGAAAGTGG + Intergenic
1057999732 9:99852745-99852767 AAGACTGAGAAGGAGGAAGGAGG + Intronic
1058483160 9:105417396-105417418 AAGACCAAGCAGGAGGGAGGAGG - Intronic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058838702 9:108884109-108884131 AAGACTAACCAAGAGAAAGCTGG + Intronic
1059107491 9:111524367-111524389 AAGAGGAAACAAGAGTAAGGTGG + Intergenic
1059677464 9:116553119-116553141 AAGAAGAAAGAGGAGGAAGGGGG - Intronic
1059775079 9:117466109-117466131 AAGAATAGAGAGGAAGAAGGAGG + Intergenic
1060790216 9:126480901-126480923 AAGACTAAGTGGGAGGAAAGAGG - Intronic
1061499537 9:130993977-130993999 TAGCCTAAACAGGAGCAGGGAGG - Intergenic
1061910426 9:133719489-133719511 AAGATTCAAGAGGAGGCAGGAGG - Intronic
1062129653 9:134885603-134885625 CAGACTCCACAGGATGAAGGAGG - Intronic
1203607684 Un_KI270748v1:70800-70822 GAGACTCAAGAGGAGGAAGAGGG + Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1186410713 X:9342600-9342622 AAGACTAAGAGGGAGGAGGGAGG - Intergenic
1186643782 X:11484502-11484524 AAGAGAAAAAAGGAAGAAGGAGG + Intronic
1186732510 X:12425208-12425230 AAGACTAAACAGGAGGAAGGTGG - Intronic
1187310182 X:18134291-18134313 AAGACTAAAGAGCAGGAATGAGG + Intergenic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1187901215 X:24028270-24028292 AAGCAAAAACAGGAGGGAGGAGG - Intergenic
1188980699 X:36724499-36724521 AAGAGTAAGCAGGAGGTATGTGG + Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189892475 X:45618715-45618737 ATTACTAAACAGGATGAAAGAGG - Intergenic
1190287557 X:48971292-48971314 AAGACTAAATAAGAGGAAGGGGG + Exonic
1190584334 X:51922899-51922921 AACATGAAAGAGGAGGAAGGAGG + Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191628867 X:63299642-63299664 AAAACTAAACAAGAAGAAAGTGG - Intergenic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1192564861 X:72155196-72155218 AAGATTAGACAGGAGGCAGCTGG + Intergenic
1192564942 X:72155751-72155773 AAGATTAGACAGGAGGCAGCTGG + Intergenic
1193543670 X:82801330-82801352 AAGACTTCACACGAGGAATGGGG - Intergenic
1194847734 X:98832528-98832550 AAGAAGAAAAAGGAGGAAGGAGG - Intergenic
1196308614 X:114134213-114134235 AAGACTAAATAAGAGGAAATAGG - Intergenic
1197464773 X:126789702-126789724 AAGACTAAAGTGTAGAAAGGAGG - Intergenic
1197532266 X:127644231-127644253 AAGAATAAAGGGGAGGGAGGAGG + Intergenic
1198466351 X:136908129-136908151 AAGACTAAAGAAAAGGGAGGTGG - Intergenic
1201643471 Y:16202491-16202513 GAGACTCACCAGGAGAAAGGTGG + Intergenic
1201659344 Y:16382830-16382852 GAGACTCACCAGGAGAAAGGTGG - Intergenic