ID: 1186738897

View in Genome Browser
Species Human (GRCh38)
Location X:12496417-12496439
Sequence TGTTAAATATACAGATTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 765
Summary {0: 2, 1: 2, 2: 14, 3: 124, 4: 623}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186738897_1186738901 13 Left 1186738897 X:12496417-12496439 CCTGGTAATCTGTATATTTAACA 0: 2
1: 2
2: 14
3: 124
4: 623
Right 1186738901 X:12496453-12496475 GCTTCTTTTCAGCTCAATTTGGG 0: 1
1: 1
2: 2
3: 17
4: 215
1186738897_1186738900 12 Left 1186738897 X:12496417-12496439 CCTGGTAATCTGTATATTTAACA 0: 2
1: 2
2: 14
3: 124
4: 623
Right 1186738900 X:12496452-12496474 TGCTTCTTTTCAGCTCAATTTGG 0: 1
1: 1
2: 0
3: 16
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186738897 Original CRISPR TGTTAAATATACAGATTACC AGG (reversed) Intronic
900335776 1:2162457-2162479 TGTTAAGTTCACACATTACCTGG + Intronic
900940751 1:5797112-5797134 TGCTAAATATGCAGATTCCCAGG + Intergenic
902165030 1:14563300-14563322 TGTTAAAAATGAAGATTCCCTGG + Intergenic
902440154 1:16424145-16424167 TGTTAAAAATAAATCTTACCAGG + Intronic
902491991 1:16789621-16789643 TGTTAAAAATACAGATTTCTGGG - Intronic
902836091 1:19047654-19047676 TATTACAAATACAGATTCCCAGG + Intergenic
902941658 1:19804404-19804426 TGTTAAAAATACAAATTCCTAGG - Intergenic
903392362 1:22973278-22973300 TGTGAAATATTCAGGTAACCTGG + Intergenic
903409144 1:23125947-23125969 TGTTAAAATTACAGATTCCTCGG + Intronic
903813510 1:26047525-26047547 TTTTATAAATACAGATTCCCAGG - Intergenic
903942235 1:26939728-26939750 TGTTAAAAATACAGATTGCCTGG + Intronic
904101688 1:28035171-28035193 TGATACATATTCAGACTACCTGG + Intronic
904109273 1:28112720-28112742 TGTTAGAAATACAGATTCCCGGG - Intergenic
904683610 1:32245626-32245648 TGGTAGAAATGCAGATTACCAGG + Intergenic
904981011 1:34501691-34501713 TGTTAACTATGCAAATTCCCAGG + Intergenic
906301077 1:44682098-44682120 AGTTAATTAAACAGATTCCCAGG - Intronic
906666561 1:47626233-47626255 TCTTAAAAATACAGATTCCCAGG - Intergenic
906687882 1:47774173-47774195 CGTTAAATAAACAGATTCTCAGG - Intronic
907719577 1:56959139-56959161 TGTTAAACAGACAGATAAACAGG - Intronic
907890018 1:58628022-58628044 TGTTAAAAATGCAGATTTCTGGG + Intergenic
908440334 1:64147319-64147341 AGTTAAATATAGAGATGACAAGG + Intronic
908655565 1:66384380-66384402 TGCTAAATATACAGAATCTCAGG - Intergenic
909184171 1:72464310-72464332 TGTTAAATAGTCAGATAACTGGG + Intergenic
909185692 1:72482472-72482494 TGTTAAATAAATAGATTCCTAGG + Intergenic
909465761 1:75972478-75972500 TGTTAAAAATACAAATTCCTAGG - Intergenic
910598147 1:89001937-89001959 TATTAAGTATAAAGATTCCCTGG - Intergenic
911040307 1:93585898-93585920 TTTTAAATATAAAAATTAGCTGG - Intronic
911558663 1:99377964-99377986 TTCTAAACATGCAGATTACCTGG + Intergenic
911968789 1:104403447-104403469 TGATAAATAAACAAATTAGCTGG - Intergenic
912087063 1:106020975-106020997 TGTTAAAAATTCAAATTCCCTGG - Intergenic
912346018 1:108963906-108963928 TGCTAAAAATACACATTAGCTGG - Intergenic
912924686 1:113903841-113903863 TATTAAAAATACAGATTCCTGGG + Intronic
913059210 1:115189169-115189191 GGTTAAATACACGGTTTACCAGG + Intergenic
915422945 1:155799639-155799661 TATTAAAGATACAGATTTCAGGG - Intronic
916000639 1:160612007-160612029 TGTTAAAAATAAAGATTCCTAGG - Intronic
916172011 1:162008673-162008695 TGTTAAAACTGCAGATTCCCAGG + Intronic
916203967 1:162297619-162297641 TGTTAAAGCTACAGATTATGGGG + Intronic
916734483 1:167595500-167595522 TGTTAAAAATGCAGAGTCCCAGG - Intergenic
916926524 1:169527171-169527193 TGTTAAAAATACAGACTCCTTGG + Intronic
917237981 1:172915364-172915386 TGTTAAAAGTTCAGATTGCCAGG + Intergenic
917398184 1:174616842-174616864 TGTTAAAAATGCAGACTGCCTGG + Intronic
917593527 1:176502920-176502942 GTTTAACTATACAGATTACTGGG - Intronic
917728509 1:177850686-177850708 TGTTAAAAATGCAGATTTCTGGG - Intergenic
918520349 1:185407986-185408008 TGTTAAACATACAGGTTTCTGGG + Intergenic
918611084 1:186493092-186493114 TGTTAAATATGCAGATTTCTGGG + Intergenic
918667447 1:187169368-187169390 TGTGAAATATGCAGGGTACCAGG + Intergenic
918970841 1:191417105-191417127 TGAAAAATTAACAGATTACCTGG - Intergenic
919159437 1:193809011-193809033 TTTTATATATATAAATTACCTGG - Intergenic
920009396 1:202856915-202856937 TGTTGAACATACAGATTACCAGG + Intergenic
920332662 1:205221620-205221642 AGTTATATATGCAGATTCCCAGG - Intergenic
920672692 1:208016610-208016632 AGTTAAATAAACAAATGACCAGG + Intergenic
921293612 1:213681494-213681516 TGTTAAATATATAGATGTTCTGG + Intergenic
921507207 1:215986570-215986592 TAGGAAATCTACAGATTACCAGG + Intronic
922349260 1:224722353-224722375 TGTTACAAATGCAGATTTCCAGG - Intronic
922360421 1:224816719-224816741 TGTTAAAAATGCAGATTCCAGGG + Intergenic
922526965 1:226311279-226311301 TGTTTAAAATGCAGATTATCAGG - Intergenic
922614616 1:226954460-226954482 TGTTAGAGATGCAGATTCCCGGG + Intronic
922968200 1:229710239-229710261 TGTTAAAAATACAAATTAGGGGG + Intergenic
923341784 1:233013842-233013864 TTTTAAATATCCTGATTCCCAGG - Intronic
923528455 1:234792916-234792938 TGTTAAAAATACAGATTTCTGGG + Intergenic
923557376 1:235011527-235011549 TGTTAAAAATACAGATTCCTGGG - Intergenic
924049452 1:240065702-240065724 TGTTAAATATGCAGAATCTCAGG - Intronic
924808368 1:247379606-247379628 TGTTAACTATTTAGATTAACTGG + Intergenic
1064814658 10:19245736-19245758 TGCTAAAAATACAGATTCCTAGG - Intronic
1065177125 10:23088731-23088753 TGTCAAATATGAAGACTACCTGG - Intergenic
1065315400 10:24458987-24459009 TGTTAGAAATACAGATTCCTCGG + Intronic
1066166749 10:32796912-32796934 TTTTAAATATACAGAATTCTAGG + Intronic
1067511736 10:46901196-46901218 TGTTCAAAATACAGATTCACTGG + Intergenic
1067650511 10:48150629-48150651 TGTTCAAAATACAGATTCACTGG - Intergenic
1067985351 10:51137419-51137441 TTTTAAAAATACAGATGCCCAGG - Intronic
1068198739 10:53754066-53754088 AGGCAAATATATAGATTACCAGG + Intergenic
1068508899 10:57938600-57938622 TGTTAAAAATACAGGGTCCCAGG + Intergenic
1068544702 10:58332856-58332878 TGTTAAAAATGCAGATTTCTAGG - Intergenic
1068729290 10:60338331-60338353 TGTTTAAAACACAGATTACTGGG + Intronic
1068800696 10:61137019-61137041 TTTTAAAAATACAGATTGCAGGG + Intergenic
1070393671 10:75992911-75992933 TTTTAAATATTCAGGTTACAGGG + Intronic
1070409600 10:76127443-76127465 TGGTAAACATACAGTTCACCTGG - Intronic
1070416247 10:76192209-76192231 TGTTAAATATGCAGATTCCTGGG + Intronic
1071215464 10:83395513-83395535 TGTTAAAGATACAAATTCCTGGG + Intergenic
1071679613 10:87691575-87691597 TGTTAAAAATACACATTCCCAGG - Intronic
1071696371 10:87878038-87878060 TTTTAAATATTCAGATTAAGAGG + Intronic
1071771322 10:88731758-88731780 TGTTAAATATGCAGATTACTGGG + Intronic
1071839245 10:89451910-89451932 TGTTACATCTACAGCTTAGCAGG + Intronic
1071855964 10:89624734-89624756 TGTTAAAAATACAGACTCCCAGG + Intronic
1071954042 10:90737331-90737353 TGTTAAACATGCAGATTCCTGGG - Intergenic
1072003889 10:91223405-91223427 TGTTAGAAATGCAGATTATCAGG + Intronic
1072023006 10:91423205-91423227 TGTTAAGAATACAGATTTCATGG + Intronic
1072258871 10:93647739-93647761 GGTTCAAAATACAGATTCCCAGG - Intronic
1072314539 10:94189360-94189382 TGTGAAATATTTAAATTACCTGG + Intronic
1072323801 10:94276497-94276519 TTTTATATAAACAGATGACCAGG - Intronic
1072447852 10:95515210-95515232 TGCTAAAGATGCAGATTCCCTGG - Intronic
1072484313 10:95840353-95840375 TCTTAGAAATACAGATTATCAGG - Intronic
1073117727 10:101101322-101101344 TGTTAAATACACAGCTTCCCAGG + Intronic
1073374068 10:103017800-103017822 TACTAAACATACAGATTAGCTGG + Intronic
1073555938 10:104451455-104451477 TATTAAACATACAGGTTCCCAGG + Intronic
1073584189 10:104692945-104692967 TGTTAAAAATGCAGATTCCCAGG - Intronic
1074079875 10:110159019-110159041 TTTTAAAAGTACAGATTCCCAGG - Intergenic
1074274446 10:111988127-111988149 TGTTAAAAATACACATTTCCAGG + Intergenic
1074417285 10:113278243-113278265 TGTTAGAAATACAAATTCCCAGG - Intergenic
1074585457 10:114764040-114764062 TTTTAAAAATATAGATTCCCAGG - Intergenic
1074644173 10:115425750-115425772 TTTTAAAAATACAGATTAATTGG + Intronic
1075224837 10:120619075-120619097 TGTAAGAAATACAGATTCCCAGG - Intergenic
1075262102 10:120971949-120971971 TGCTTAATATGCAGATTTCCTGG - Intergenic
1075720111 10:124579664-124579686 TGTTAAATATACATATTTCCAGG + Intronic
1075811797 10:125229527-125229549 TGTTACATATTCAGATTCCTGGG - Intergenic
1075942324 10:126401567-126401589 TGTTAAAAATGCAGATTCTCAGG + Intergenic
1075981724 10:126746166-126746188 TGTTAAAAATGCAGATTCCTGGG - Intergenic
1076193111 10:128496745-128496767 TGATAAATGTACAGATTAGCAGG - Intergenic
1077859961 11:6169299-6169321 TGTGAAATACAGAGATTTCCTGG - Intergenic
1078283008 11:9921376-9921398 TGTTAAATATACAAATTCCTGGG + Intronic
1078898945 11:15623475-15623497 TGCTAAAAATGCAGATCACCTGG + Intergenic
1079025401 11:16943901-16943923 TATTTAAAATACAGATTTCCAGG + Intronic
1079152840 11:17916511-17916533 TGCTAAAAATACAGATTTCCAGG - Intronic
1079794806 11:24788108-24788130 TGTTAAATTTACAGAATTTCAGG - Intronic
1080299191 11:30765423-30765445 TTTTAAATATACAGATACCTGGG + Intergenic
1081380279 11:42406626-42406648 TGTTAAAAATACACATTGCTGGG + Intergenic
1081521101 11:43881651-43881673 TGTTAAACACACAGATTCCTGGG + Intronic
1081740943 11:45440122-45440144 TGTTAAAGATACCGAGTCCCTGG + Intergenic
1081895887 11:46585965-46585987 TGCTAAAAATACAAATTAGCTGG - Intronic
1082075902 11:47975965-47975987 AGTTAAAAATACAGATTCCCTGG + Intergenic
1083457383 11:62788027-62788049 TGTTTATTAACCAGATTACCTGG - Intronic
1083694742 11:64435178-64435200 TGTTAAAGACACAGATTCCCTGG + Intergenic
1084699614 11:70777820-70777842 GCTTAAAAATACAGATTCCCAGG + Intronic
1084703659 11:70803536-70803558 TGTTAACTATTCAGATTCCCAGG + Intronic
1084703669 11:70803603-70803625 TGTTAAATGTGCAGATCTCCTGG - Intronic
1085158696 11:74321043-74321065 TGTTATAAATGCAGATTTCCTGG - Intergenic
1085742820 11:79091613-79091635 TGTTAAAAATACAGAATCACAGG + Intronic
1085789117 11:79481243-79481265 TGTTACATATACATATTGCCTGG - Intergenic
1086365595 11:86107114-86107136 TGTTAAAAATACAATTTCCCTGG - Intergenic
1086516137 11:87615448-87615470 TTTTAAAAATACAGATTCCTGGG - Intergenic
1086615158 11:88808361-88808383 TTTTAACTATACAGTTTACATGG - Intronic
1087174543 11:95084251-95084273 TGTTGAAAATAGAGATGACCTGG + Intergenic
1088221388 11:107573765-107573787 TGTTAAACATGCAGGTTACTGGG - Intergenic
1088439126 11:109848903-109848925 TGTTAGAAATGCAGATTTCCAGG - Intergenic
1090088924 11:123676717-123676739 TGTTGATTATACAAATCACCAGG + Intergenic
1090120097 11:124017329-124017351 TCTTAAATATCTAGATTACTTGG + Intergenic
1090641522 11:128733312-128733334 TGTTAAAAATGAAGATTCCCGGG - Intronic
1091129065 11:133128695-133128717 TGGAAAAGATACAGATTCCCAGG + Intronic
1091573191 12:1709170-1709192 TATTAAATATACAGATCATTAGG + Intronic
1091964363 12:4725514-4725536 TGTTAAAAATACAGAATCCCAGG - Intronic
1092189180 12:6505701-6505723 TGGTAAATATAAAAATTAGCCGG + Intronic
1092698733 12:11203045-11203067 TGCTAAAAATACAGATTATAGGG + Intergenic
1092813233 12:12290799-12290821 TGTTAGACATGCAGATTCCCAGG - Intergenic
1092840666 12:12538074-12538096 TGTTAAATATGCAAATTCACAGG - Intronic
1093513605 12:19958318-19958340 TATTAAATGTACAGATCAGCCGG + Intergenic
1094399846 12:30050725-30050747 TGTTAGATACACAGATTCCCAGG + Intergenic
1095749041 12:45690910-45690932 TGTTAAATATATAAATCAACAGG - Intergenic
1096813501 12:54186638-54186660 TGTTTAAAATACAGATTCCCAGG - Intronic
1097286418 12:57880766-57880788 TATTAAAAATACAGATTATTGGG + Intergenic
1098608424 12:72423491-72423513 TGTTAAAAATGCAGATTTCTAGG - Intronic
1099346358 12:81505120-81505142 TGTCAAAAATACTGATTACTGGG - Intronic
1099481662 12:83174446-83174468 TGTTAAATATATGGATGATCAGG + Intergenic
1099665527 12:85623719-85623741 TGTTTATAATACAGTTTACCAGG + Intergenic
1101006833 12:100409530-100409552 TGTTAAATATACAGTTTTGTGGG + Intronic
1101578427 12:106019445-106019467 TGTTAAAAATAAAAATTCCCAGG - Intergenic
1101755421 12:107617479-107617501 TGTTAAAAATGCAGATTCCCAGG + Intronic
1101760295 12:107652655-107652677 TGTTAAAAATATAGATTTCTGGG - Intronic
1102352611 12:112205270-112205292 TATTAAAAATACAAATTAGCTGG + Intronic
1102367015 12:112346319-112346341 TGTTAAACATGCAGATTCCCAGG - Intronic
1103055264 12:117814811-117814833 TGTTTAAGATACAAATTTCCAGG + Intronic
1103140029 12:118540452-118540474 GGTTATATATACACATTCCCAGG + Intergenic
1103159736 12:118719112-118719134 TGTTAAAAATACAGAATCTCAGG + Intergenic
1104068626 12:125326495-125326517 TGTTTACTATACAGGTTGCCAGG - Intronic
1104400758 12:128474206-128474228 TCTTAAAAATGCAGATTCCCAGG - Intronic
1104934681 12:132358132-132358154 TGGTTAAAATACAGATTCCCAGG - Intergenic
1104951206 12:132441317-132441339 TGTTAAACATGCAGATTCCCTGG + Intergenic
1105248750 13:18676329-18676351 TTTTAAATTTACACATCACCAGG - Intergenic
1105660428 13:22488118-22488140 TGTTTAAAATACAGATTCCTTGG + Intergenic
1106385879 13:29285491-29285513 GGAAATATATACAGATTACCTGG + Intronic
1106463859 13:29995587-29995609 TTTTAAAAATACAGATTCCTGGG + Intergenic
1106549601 13:30759834-30759856 TATTAAAGATACAGATTCCTGGG + Intronic
1107041463 13:35952663-35952685 TGTACTATAAACAGATTACCTGG - Intronic
1107419654 13:40234547-40234569 TGGTAACTATACAGATTAGATGG - Intergenic
1107481912 13:40792225-40792247 TATTAAATATCCAAATTGCCAGG - Intronic
1107841874 13:44466466-44466488 TTTTAAAAATACAGATTCCTTGG + Intronic
1107946122 13:45418778-45418800 TTGAAAATATACAGATTAGCCGG + Intergenic
1108103715 13:46985957-46985979 TGTTAAAAATGCAGATGCCCAGG - Intergenic
1108190455 13:47933103-47933125 TGTTAAGCATACAGATTCCTAGG - Intergenic
1108299061 13:49055663-49055685 TTTTAAATCTACATATAACCTGG + Intronic
1108760842 13:53562497-53562519 TGCTGAATCTACAGATTAACTGG + Intergenic
1109497224 13:63188695-63188717 TGTTTAATATACAAATTATCTGG - Intergenic
1110055957 13:70972047-70972069 TTTTAAATATAAATATTTCCCGG + Intergenic
1111200908 13:84935401-84935423 TGTTAAATATACCGAATAATTGG + Intergenic
1111727312 13:92029075-92029097 AGATAAATATATAGATTTCCAGG - Intronic
1112002270 13:95221966-95221988 AATTAAATATACAGATTTCCAGG + Intronic
1112160113 13:96858395-96858417 TGTAAAAAATACAGATTTCTAGG + Intergenic
1112243737 13:97708252-97708274 TGTTAAATTTACATATTAAATGG + Intergenic
1112356991 13:98681843-98681865 TGTGAAATAAAGAGAATACCAGG - Intergenic
1112373697 13:98819134-98819156 TGCTTAAAATACAGATTCCCGGG + Intronic
1112722782 13:102264042-102264064 TTTTAAAAATACAGATTATTAGG - Intronic
1112751200 13:102585246-102585268 TGTTAAAAATACAGTTTACCTGG - Intergenic
1112902026 13:104368645-104368667 TGTTAAATATTCTGACTTCCAGG + Intergenic
1112987801 13:105472944-105472966 TGTTAAATTTTCAGATTTCCAGG + Intronic
1114441432 14:22751464-22751486 TGTTAAATCTACCTATGACCTGG - Intergenic
1115250197 14:31337169-31337191 ATTTAAAAATACAGATTGCCAGG + Intronic
1115277791 14:31626966-31626988 TGTTAAATATACAGATTTCCAGG + Intronic
1115374263 14:32655733-32655755 TGATAAATAGACAAATTGCCTGG + Intronic
1115460017 14:33650011-33650033 TGTTTAGAATACAGATTCCCTGG + Intronic
1115865927 14:37746505-37746527 TGTTAAAAATACAGATTTTGAGG - Intronic
1116117055 14:40667525-40667547 AGTGAAATGGACAGATTACCAGG - Intergenic
1116728052 14:48587696-48587718 TGTTAAATATACAGCTTTCTAGG + Intergenic
1117133724 14:52712234-52712256 TATTAAAAATACACATTACTAGG + Intronic
1117253959 14:53959659-53959681 TGTGAAATATACAGATTTCTGGG - Intergenic
1117320937 14:54622827-54622849 TGTTAGATACACAGATTCTCAGG + Intronic
1118159749 14:63276236-63276258 TGTTAGAAATACACATTCCCAGG - Intronic
1118348445 14:64956758-64956780 TGTTAAAAATACAGATTTCTGGG - Intronic
1118365509 14:65092205-65092227 TGTTATAAATACAGATTCCCAGG + Intronic
1118830322 14:69425491-69425513 TGTTAAAAATAGATATTCCCGGG - Intronic
1118966061 14:70586777-70586799 TGTTAAGTGTAAAGATTCCCAGG - Intronic
1119148571 14:72337733-72337755 TGTTAATCATACAGATTAAAAGG - Intronic
1119615463 14:76096033-76096055 TGTTCAAAATGCAGATTCCCAGG - Intergenic
1119690763 14:76670456-76670478 TGTAAAATAAACAGATTACTAGG + Intergenic
1120375177 14:83695650-83695672 TGCTTAAAATACAGATTCCCAGG + Intergenic
1120739966 14:88097123-88097145 TGGTAAATTACCAGATTACCTGG + Intergenic
1120819647 14:88900295-88900317 TGTTAAAAACACAAATTCCCGGG + Intergenic
1121136374 14:91502483-91502505 TGATAAATATACAGAATGCTTGG + Intronic
1121607792 14:95253976-95253998 TATTAAACATACAGATTCCCAGG - Intronic
1121671402 14:95713567-95713589 TTTTAAAAATACAGATTTCTGGG + Intronic
1121838306 14:97111895-97111917 TGTTAGAAATCCAGATTACAGGG + Intergenic
1122085350 14:99297171-99297193 TGTGAAAAATACAGATTCCTGGG - Intergenic
1124813789 15:32968274-32968296 TGTTAAATATCTAGATTATAGGG + Intronic
1124932662 15:34137244-34137266 TACTAAAAATACAGATTAGCCGG - Intergenic
1125289537 15:38130583-38130605 TGTTAAAAATGGAGATTCCCAGG + Intergenic
1125483247 15:40094696-40094718 TGTTCAGTATACAGATTCCTGGG - Intronic
1125571837 15:40726172-40726194 TGTTAAATATACAGATTACCAGG + Intronic
1125791895 15:42373319-42373341 AGTTGAAAATACAGATTCCCAGG - Intronic
1128315575 15:66657284-66657306 TGCCAAAAATACAGATTCCCAGG - Intronic
1128331799 15:66760966-66760988 TGTTAAAAACATAGATTCCCGGG + Intronic
1128842716 15:70863259-70863281 TATTAAATACACAGATTTCTAGG - Intronic
1128880426 15:71237282-71237304 TGTTAAAAATGCAGATTCTCAGG + Intronic
1129449257 15:75640814-75640836 AGTTAATAATACAGATTTCCAGG - Intronic
1129605740 15:77024192-77024214 TGTTAGAAATACAGATTCTCAGG - Intronic
1129894567 15:79093793-79093815 TGTTAGAAATGCAGATTATCAGG - Intergenic
1130727942 15:86460551-86460573 TGTTAAACATACAGCTTCCCAGG + Intronic
1130860975 15:87889260-87889282 TGTTAAAAATATAGATTCCTAGG + Intronic
1131104830 15:89726325-89726347 TGTTAAAAATACAGATTCTCAGG - Intronic
1131374436 15:91911923-91911945 TGTTAAAAATATAGATGTCCCGG - Intronic
1131428421 15:92366484-92366506 TGTTAAAAATACAGATACCTGGG - Intergenic
1131438908 15:92443891-92443913 CGTTAAAAATATAGATTCCCGGG - Intronic
1131682972 15:94743392-94743414 TGTTAAATATGCAGATTTCCAGG + Intergenic
1132279014 15:100596320-100596342 TGTTAGAAATACAAATTACTGGG - Intronic
1133407912 16:5540630-5540652 TGTTAAAAATCCAGATTTCTGGG + Intergenic
1134308878 16:13058246-13058268 TGTTAAAAATGCAGGTTCCCAGG + Intronic
1134403935 16:13938825-13938847 TGCAAAATATACATATAACCTGG + Intronic
1137240584 16:46652325-46652347 TTTTAAACATACAAATCACCTGG - Intergenic
1137684901 16:50380003-50380025 TTTGAAATACACAGATTTCCGGG + Intergenic
1137734607 16:50714393-50714415 TGTGAAAAATATAGATTTCCTGG - Intronic
1137937810 16:52651367-52651389 TGTTAAAAACACAGATTCCTGGG + Intergenic
1138233686 16:55361179-55361201 TGTTAAAAATCCAAATTACTGGG + Intergenic
1139333066 16:66209187-66209209 TGTTGAAAATGCAGAATACCAGG - Intergenic
1139348873 16:66322907-66322929 TGTTGAAAATACAGATTCCTAGG - Intergenic
1140181731 16:72726948-72726970 TTTTAACTATAAATATTACCTGG + Intergenic
1140948463 16:79793459-79793481 TTTTTAATTTACAAATTACCTGG + Intergenic
1140951294 16:79820370-79820392 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1141332846 16:83127790-83127812 TGATAAATATAATGATTACCAGG - Intronic
1141568885 16:84922342-84922364 TCTTAAAAATATAGATTGCCAGG + Intergenic
1142606245 17:1082782-1082804 TGTTTAAAACACAGATTTCCTGG - Intronic
1143905692 17:10207495-10207517 TGTTGAAAACACAGATTCCCGGG - Intergenic
1143949429 17:10620963-10620985 TATTAACTATACAAGTTACCAGG + Intergenic
1144002030 17:11064157-11064179 TCTGAAATATACAGATTCCTTGG + Intergenic
1144162900 17:12578955-12578977 TTTTTAAGATACAGATTTCCAGG - Intergenic
1144479607 17:15618027-15618049 TGTTAGAAATACAGAATCCCTGG + Intronic
1144918696 17:18745712-18745734 TGTTAGAAATACAGAATCCCTGG - Intronic
1145785192 17:27588918-27588940 TGTTGAAAATCCAGATTCCCGGG + Intronic
1145868778 17:28257018-28257040 TGGTAAATATACATATTTCCAGG - Intergenic
1146231073 17:31110036-31110058 TGTTAAAAGTACAGATTTCCTGG + Intronic
1146723297 17:35138346-35138368 TGTTAGAAATGCAGATTCCCAGG + Intronic
1146778617 17:35645984-35646006 TGTTAAAAATACTAATTACTAGG + Intronic
1147534947 17:41314697-41314719 TGTTAAAAACACAGATTCCCAGG + Intergenic
1148106874 17:45123680-45123702 TTTTAAAAATACAGATGCCCAGG - Intronic
1148340743 17:46872144-46872166 TGGTAAATGTACAGATTCCCAGG + Intronic
1148391704 17:47277281-47277303 TGTTAAAAATAAAGCTTCCCGGG + Intronic
1149048267 17:52273174-52273196 TTATAAATATACAGAAAACCTGG + Intergenic
1149730735 17:58943661-58943683 TGTTAAATATGAAGATTCACAGG + Intronic
1149985423 17:61343459-61343481 TTTTAAAGATACAGATGCCCAGG + Intronic
1150132736 17:62678130-62678152 GATTAAAAATACAGATTACCAGG - Intronic
1150419948 17:65024638-65024660 TATTAAAAATACAGATTCCCAGG + Intronic
1150627801 17:66853805-66853827 TGTTGAAAATACAGCTTATCAGG - Intronic
1150968466 17:69999165-69999187 TGTTAAAAATATAGATTATTGGG + Intergenic
1152006417 17:77684654-77684676 TGAAAAAAATACAGATTCCCAGG - Intergenic
1153005807 18:498300-498322 TGTAATAAATACAGATTACGTGG + Intronic
1153804512 18:8700751-8700773 TGTTAAAAATGCAAATTATCTGG - Intergenic
1154410051 18:14134887-14134909 TGTTAGAAATACAGATTTTCAGG - Intergenic
1154440420 18:14384314-14384336 TTTTAAATTTACACATCACCAGG + Intergenic
1155391899 18:25347724-25347746 GCTTAAAAATACAGATTACCAGG - Intronic
1155699020 18:28720072-28720094 TGATAAATGTACAGATTTCGTGG - Intergenic
1155972477 18:32094089-32094111 TTTTAAAAATAAAGATTTCCGGG - Intronic
1155990136 18:32271572-32271594 TGTTAGAAATGCAGATTCCCAGG - Intronic
1156097058 18:33547020-33547042 TGTAAAATTTACAAATTACTTGG + Intergenic
1156809478 18:41229322-41229344 TGTTAGACATTCAAATTACCAGG - Intergenic
1157284458 18:46368010-46368032 TGTTAAACATGCAGATTCCTGGG + Intronic
1157309205 18:46539158-46539180 TGTTAAAAATACAGATTTGCAGG + Intronic
1157316889 18:46599254-46599276 TGCTAAATATCCAGATTACCTGG + Intronic
1157681663 18:49612285-49612307 TGTTAGAAATGCAGATTATCAGG + Intergenic
1157807755 18:50670841-50670863 TATTAGAGATACAGATTCCCAGG + Intronic
1157939807 18:51915774-51915796 TGCTAAAAATGCAGATTTCCGGG - Intergenic
1158269626 18:55698480-55698502 TGTTAAAAATACAAATTTTCAGG - Intergenic
1158554146 18:58461309-58461331 AGTGAAAAATGCAGATTACCTGG + Intergenic
1158876401 18:61738423-61738445 TTTTAAAAATACAGATTCCTAGG - Intergenic
1159418693 18:68186108-68186130 TGTAAAATATATAGATGATCTGG - Intergenic
1160194283 18:76739553-76739575 TGTTAAAAATGCAGATTCTCAGG - Intergenic
1160245683 18:77157323-77157345 TTTTAAACACACAGAATACCTGG - Intergenic
1160280211 18:77482820-77482842 TTTTAAATATACACTTTCCCTGG + Intergenic
1162066377 19:8127817-8127839 TATTAAAAATACAAATTAGCTGG + Intronic
1162537375 19:11271136-11271158 TGCTAAAAATACAAATTAGCTGG - Intergenic
1162940760 19:14007448-14007470 TGTTAAATATCCAAATTAATGGG + Intergenic
1163080136 19:14933378-14933400 TCTTTGATATACAGATTTCCAGG - Intergenic
1165582216 19:36876447-36876469 TGGTAATTATACAGATGTCCTGG - Intronic
1165641199 19:37388567-37388589 TGTTAAAAATACTGATTTCAGGG - Exonic
925262094 2:2537785-2537807 TGTTAACAATACAGATTTCTGGG - Intergenic
926443551 2:12916797-12916819 TGTTAAATAAACAGATCATTAGG + Intergenic
926580299 2:14627432-14627454 TGATAAAAATGCAGATTCCCAGG - Intergenic
927448328 2:23185300-23185322 TTTCAAATATGCAGATTCCCAGG + Intergenic
927599680 2:24430104-24430126 TGTTTAATATACTGGTTACAGGG - Intergenic
927739718 2:25557655-25557677 TGTTAAATATACAAAGTCCCAGG - Intronic
927998151 2:27501021-27501043 TGTTCAAAATGCAGATTCCCAGG - Intronic
928483340 2:31705822-31705844 AGTTAAATATTCAGATTCCCAGG - Intergenic
928732920 2:34253503-34253525 TGTTAAAAATGCAGAATCCCAGG + Intergenic
928820233 2:35353121-35353143 TGTTAGAAATGCAGATTATCAGG - Intergenic
929377866 2:41312203-41312225 TGTTGAATCTACAGATCACATGG + Intergenic
930063876 2:47312788-47312810 TGTTAAATATACAAAGTCACAGG + Intergenic
930413082 2:51051876-51051898 TTTGAAAAATACAAATTACCTGG - Intergenic
930758759 2:55007651-55007673 TGCTTAATATGCAGATTGCCAGG + Intronic
931136848 2:59412974-59412996 TGATATACATATAGATTACCTGG + Intergenic
931267693 2:60675031-60675053 CGTTAAATATACAAATTACCAGG + Intergenic
931458289 2:62429113-62429135 TGTCAAATACACAGATTCCTAGG - Intergenic
931700116 2:64902510-64902532 TGTTAGAAATGCAGATTCCCAGG - Intergenic
931743639 2:65272336-65272358 TGTTAAATATTGAGCTTAGCCGG - Intergenic
931911620 2:66905774-66905796 TGTGAAATATACAGAGTGGCTGG + Intergenic
932130699 2:69184859-69184881 TTTAAAAAATACAGATTCCCAGG + Intronic
932228488 2:70062435-70062457 TGTTTAAAATGCAGATTTCCTGG - Intergenic
933006207 2:76998571-76998593 TGTTAAATGTGCAGATTCCTGGG - Intronic
933347670 2:81109974-81109996 GGTTAAATTTAAAGATTACTGGG - Intergenic
933351630 2:81159872-81159894 AGTTAACAATACAGATTACAGGG - Intergenic
933507084 2:83191128-83191150 TGTTAAATAAATAAATTACTAGG + Intergenic
933617379 2:84496626-84496648 TTCTAAACATACAGATTTCCAGG - Intergenic
934537921 2:95151734-95151756 TGTTAAACATTCAGGTTCCCAGG - Intronic
934908232 2:98225095-98225117 TATTAAAAATACAAATTAGCTGG - Intronic
935209802 2:100929486-100929508 TTTGAAAAATACATATTACCAGG + Intronic
935416928 2:102828945-102828967 TGTTCAATATACATATTCACAGG - Intronic
935809688 2:106785525-106785547 TGTTAACAATACAGATTTCTGGG + Intergenic
935838727 2:107084534-107084556 TGTTAAACACCCAGATTACTGGG + Intergenic
936090181 2:109496826-109496848 TTTAAAATAAAGAGATTACCCGG + Intronic
936664889 2:114582998-114583020 TGTTAGAAATGCAGATTCCCAGG - Intronic
937612312 2:123876766-123876788 TGTTAAAAATTCAAATTCCCAGG - Intergenic
937622290 2:124002545-124002567 TATCAAAAATACAGATTTCCAGG + Intergenic
939131410 2:138240192-138240214 TGTTAAAAATGCAAATTACTGGG - Intergenic
939407083 2:141772481-141772503 TGTTAAAAATGCAAATTCCCAGG + Intronic
939592689 2:144084909-144084931 TGTTAAACATTCAGATTCTCAGG + Intronic
939827498 2:147032424-147032446 AGTTAAAAATATAGTTTACCCGG + Intergenic
940036039 2:149312868-149312890 GTTTAAATATACAGATTCTCAGG - Intergenic
940313951 2:152308077-152308099 TGTTAAACATACAAATTCCAGGG + Intergenic
940696259 2:156983275-156983297 TGTAAAATATACATATGAACTGG + Intergenic
940781056 2:157934022-157934044 TGTTAAAAATGCAGAATCCCAGG - Intronic
940805776 2:158184963-158184985 AGATAAATATACAGATTAAAAGG + Intronic
940854728 2:158721080-158721102 TGTTAAAAATACAGCTTCCCTGG + Intergenic
941190294 2:162373302-162373324 TGTTTAAAATGCAGATTACAGGG + Intronic
941990366 2:171550017-171550039 TGTTAAAAATACAGATTCCTGGG + Intronic
942300183 2:174553741-174553763 TGTTAAAAATACAAATTCCCTGG + Intergenic
943027564 2:182648136-182648158 TGTTATATGCACAGATTGCCAGG - Intergenic
943076460 2:183201291-183201313 TGTTAAAAATGCACATTTCCTGG + Intergenic
943774306 2:191748854-191748876 TTTTAAAAATACTGATTCCCAGG + Intergenic
944458708 2:199921304-199921326 TGTTAAAAATACTAATTCCCAGG - Intronic
944619167 2:201495763-201495785 TGTAAAAAATACACATTCCCAGG - Intronic
945178595 2:207068501-207068523 TGAAAAATATACAAATTAACTGG - Intergenic
945280105 2:208027931-208027953 TGTTAAAAATGCAGATTCCTAGG + Intergenic
945522138 2:210841923-210841945 TGTTAAAAATACAGAATATCAGG + Intergenic
945586067 2:211664803-211664825 TTTTAAATATACATATCACTAGG + Intronic
945641618 2:212438703-212438725 TATTAAATATACAGATTAACGGG - Intronic
946217041 2:218192490-218192512 TGTTAAGTATACAGATTGCAAGG + Intergenic
946669929 2:222091627-222091649 TGTTAAATATGCAAATTCTCAGG - Intergenic
946910116 2:224451928-224451950 TGTTAAATTTAAATATTCCCAGG + Intergenic
947013375 2:225590436-225590458 TGTTAAAAATACAGATTGCTGGG + Intronic
947018871 2:225652224-225652246 TGTTAAATATCTAGATTATCTGG - Exonic
947335277 2:229076147-229076169 TGTTAAAAATATAGATTACTGGG - Intronic
947502300 2:230680178-230680200 TATTAAAAGTACAGATTCCCAGG - Intergenic
1169609852 20:7366034-7366056 TGTTAAAAATACAAATTCTCAGG - Intergenic
1169641551 20:7757789-7757811 TGTTAGATATGCAAATTATCGGG - Intergenic
1169858313 20:10126772-10126794 TGTTAAAAATGCAAATTATCAGG + Intergenic
1169936932 20:10893614-10893636 TGTTAACTATTCAGTTAACCAGG + Intergenic
1169981965 20:11394793-11394815 TGTTAAATGTGAAGATTTCCAGG - Intergenic
1170409373 20:16072210-16072232 TTTTAAAAATACAGATTGCTGGG - Intergenic
1170445188 20:16419080-16419102 TGTTAGATATGCAAATTCCCAGG - Intronic
1171088895 20:22265846-22265868 CATTAAAAATACAGATTCCCAGG - Intergenic
1171099875 20:22373054-22373076 TGTTAAACATACAGATTCCTGGG - Intergenic
1172484363 20:35289500-35289522 TATTAAAAATACAGATTAGCTGG - Intronic
1174350765 20:49966025-49966047 TTTTAAAGATACAGATTCCCAGG - Intergenic
1174648735 20:52106451-52106473 TGTTAAAAATACAGATTCTCAGG - Intronic
1174931925 20:54825851-54825873 AGTTAAAAATACAGATTCCTAGG + Intergenic
1176455620 21:6906858-6906880 TTTTAAATTTACACATCACCAGG - Intergenic
1176863012 21:14023524-14023546 TGTTAGAAATACAGATTTTCAGG + Intergenic
1177725096 21:24956517-24956539 TTTTAAATGTAAAGCTTACCTGG - Intergenic
1178056489 21:28804954-28804976 CATTAAATATACAGCTTACCAGG + Intergenic
1178494374 21:33074515-33074537 TGTGAAATATACAGCTTAGAGGG + Intergenic
1178536469 21:33414180-33414202 TGTTTAAAATGCAGATTTCCTGG + Intronic
1181854082 22:25769771-25769793 TGTTAAAAATGCAGATTCCTGGG + Intronic
1182079811 22:27520943-27520965 TGTTAGAAATACAGATTATTGGG - Intergenic
1182378586 22:29867696-29867718 TGTACAAAATGCAGATTACCTGG + Intergenic
1182455352 22:30446937-30446959 TTTTAAATCTACCTATTACCTGG - Intergenic
1183014025 22:34971287-34971309 TGTTTAATATGCAGATTCCTGGG + Intergenic
1183375616 22:37463171-37463193 AGGTAAAAATACAGATTCCCTGG + Intergenic
1183813803 22:40281752-40281774 TGTAAAATATAGTAATTACCCGG + Intronic
949266809 3:2166442-2166464 TATTAAAAATACAGACTACTGGG - Intronic
949397167 3:3626975-3626997 AGTTAAATATTCTGATTATCAGG - Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
949841191 3:8321854-8321876 TGTTAGAAATACAGATTCCCAGG + Intergenic
949867014 3:8554790-8554812 AATTAAATACACAGATTTCCCGG + Intronic
949921097 3:9001277-9001299 TGATGAATATACTGCTTACCCGG + Intronic
949925569 3:9038382-9038404 TGTTAAAGATGCAGATTTCTTGG + Intronic
950036149 3:9887299-9887321 TGTTAAAAACACAGATTTCTGGG - Intergenic
950054640 3:10014944-10014966 TGAAAAATATAAAAATTACCTGG + Intergenic
950134819 3:10573595-10573617 TGTTAACAATACAGAGTCCCAGG - Intronic
950466646 3:13159492-13159514 TGTTGAAAATACAGATTGCCAGG - Intergenic
950651075 3:14407022-14407044 CTTTAAAAATACAGATTCCCAGG - Intronic
950957598 3:17071022-17071044 TGTTAAATAAGCAGATTCCTGGG - Intronic
951108533 3:18773499-18773521 TGTTAAAAACACATATTCCCAGG + Intergenic
951297579 3:20957812-20957834 TGTTAAAGATGCAAATTCCCAGG - Intergenic
951492199 3:23283812-23283834 TGTTACAAATGCAGATTACCAGG + Intronic
951512353 3:23517540-23517562 TGTTCAATAAACAAATTAACTGG - Intronic
951617686 3:24566768-24566790 TGTTAAAAAAACAGATAACTTGG + Intergenic
951624230 3:24642602-24642624 TGTTAGACATGCAGATTATCAGG - Intergenic
951663386 3:25095440-25095462 TGTTAAAAACACAGATTGCTGGG - Intergenic
951940218 3:28069488-28069510 TGTTAAACATGCAGATTCCAAGG + Intergenic
952096321 3:29959369-29959391 TGTTAGACATACAGATTCTCAGG + Intronic
952164897 3:30737150-30737172 TGGTAAATATACAGACCACTAGG - Intronic
953080410 3:39611453-39611475 TGTTAAAAATGCAGATTCTCGGG - Intergenic
953492303 3:43362482-43362504 TGTTAAAGATACAGATTCCTGGG + Intronic
954786626 3:53098207-53098229 TGTGTAATAAACAGATTCCCTGG + Intronic
955516160 3:59728638-59728660 TGTTAAAAACACAGATTTCTGGG + Intergenic
955689361 3:61575759-61575781 TGTAAAATATAAAAATTAGCCGG - Intronic
955961054 3:64341738-64341760 TATGAAATACACAGATTTCCAGG + Intronic
956185213 3:66555964-66555986 TGGTAAATATACAGATTCCCAGG + Intergenic
956247566 3:67201189-67201211 TGTTAAAAATGCAGATTTTCAGG + Intergenic
956362209 3:68460773-68460795 TGTTTGAAATACAGATTACTGGG - Intronic
956365108 3:68492896-68492918 TTTTGAATATACAGATTTCTTGG + Intronic
956422974 3:69103816-69103838 TGTTTAAAATACAGATTCCCAGG + Intronic
956502632 3:69903268-69903290 TTATAAAAATACAGATTACAAGG - Intronic
956848782 3:73208813-73208835 TGTGAAATATGCAGATTCCTGGG - Intergenic
956902026 3:73726965-73726987 TGTTTAAAATGCAGATTCCCAGG - Intergenic
957143558 3:76393157-76393179 TGTTAAAAATACAGATGTCCAGG + Intronic
957327143 3:78710939-78710961 TGTTAAGTATACAGATTATCAGG - Intronic
957341919 3:78910893-78910915 TGTTAGAAATACAAATTAACAGG + Intronic
958032074 3:88123520-88123542 TGTTAAATATTCAAATTATCAGG + Intronic
959324870 3:104924388-104924410 TGTTAGAAATACAGATTCTCAGG + Intergenic
959406225 3:105964840-105964862 TGATAAAAATACAGATTCCTGGG + Intergenic
959625322 3:108443185-108443207 TGTTAAAAATACAAATTCCTGGG - Intronic
959799161 3:110470283-110470305 TTTTAAAAATACAGATTTCTAGG + Intergenic
961145930 3:124593353-124593375 TGTTACAAATGCAGATTCCCAGG + Intronic
961981974 3:131089215-131089237 TGTTGAAAATACAGATTCCTTGG + Intronic
962086854 3:132200272-132200294 TGTTAAATATATAGATTCCTAGG - Intronic
962104952 3:132380862-132380884 TGTTCAAGATTCAGATTCCCAGG + Intergenic
962265030 3:133938707-133938729 TGTTAGATATGCAGATTTTCAGG + Intronic
962445296 3:135458317-135458339 TGTTAAAAATGCAGAATACCTGG + Intergenic
962532356 3:136294769-136294791 TATTAAAAATAAAAATTACCTGG - Intronic
962875715 3:139534698-139534720 TCTTAGAAATACAGATTATCTGG - Intronic
962880537 3:139572481-139572503 TATTAAATATCCAGATTCCTGGG + Intronic
962971170 3:140403445-140403467 TCTTAAAAATACAGAATCCCAGG - Intronic
963066029 3:141265405-141265427 TGTTAAAGATGCAGATTTCTGGG - Intronic
963509280 3:146226650-146226672 TGTTAAAAGTAGAGATTTCCAGG - Intronic
963942704 3:151111010-151111032 TGTTAGAAATACAGATTCTCAGG + Intronic
964066239 3:152583379-152583401 TGTTAGAAATACAAATTATCAGG + Intergenic
964120772 3:153180753-153180775 TGTTAAATATGCAGATTCTCAGG + Intergenic
964166723 3:153715855-153715877 TAATAAAAATACAGACTACCAGG - Intergenic
964878420 3:161396013-161396035 TTTTAAAAATAAAGATTAGCTGG - Intergenic
965508377 3:169541160-169541182 TGTTAGAAATACAGATTCTCAGG - Intronic
965689667 3:171342254-171342276 TGTTAGATATACAAATTATCTGG - Intronic
965867785 3:173226475-173226497 TTTTAAAAATACAGATTGCTTGG + Intergenic
965908650 3:173742976-173742998 TCTTCAATATAGAGATTGCCTGG + Intronic
966005111 3:175001254-175001276 TGTCAGAAATACAGATTCCCAGG - Intronic
967766779 3:193289615-193289637 TATAAAATAAACAGAATACCAGG + Intronic
967977807 3:195045140-195045162 TGTTACAGATGCAGATTCCCAGG + Intergenic
968136817 3:196225804-196225826 TGTTAAAAATGCAGATGACTGGG + Intronic
969041284 4:4298005-4298027 TGTTAAAAATGCAGATTCCTGGG - Intronic
969320355 4:6408682-6408704 TGTTTAAAATTCAGATTCCCAGG - Intronic
969601830 4:8181453-8181475 TGTTAAAAATCCAGATTTCTGGG + Intergenic
969937521 4:10696879-10696901 TGTTAAAAATGCAGATTCCAGGG + Intergenic
970107878 4:12605364-12605386 TATTAGAAATACAGATTATCAGG + Intergenic
970187810 4:13481260-13481282 TGTCAAAAATACAGGTTACTGGG + Intronic
970440788 4:16079674-16079696 TGTTAAAAATGCAGATTAATGGG - Intronic
970484727 4:16513622-16513644 TGTTAAAAATTCAGATTTCAGGG + Intronic
970799324 4:19952894-19952916 TCTTAAAGATTCAGATTTCCAGG - Intergenic
970870739 4:20814147-20814169 TGTTAAAAATGCAGACTCCCAGG + Intronic
971165051 4:24174396-24174418 TTGTAAAAATACAGATTATCAGG - Intergenic
971370269 4:26013491-26013513 TTTTAGAAATACAGATTCCCTGG + Intergenic
971545000 4:27874612-27874634 TTTTAAATATACATATTATACGG - Intergenic
971747674 4:30605209-30605231 TGATAAATATATTAATTACCTGG - Intergenic
971940484 4:33208360-33208382 TCTTAAATGTATAGATTAACTGG + Intergenic
972163392 4:36253085-36253107 TACTAAAAATACAGATTAGCTGG + Intergenic
972420746 4:38883947-38883969 TGTTAAAAATTCAGATTCCTGGG + Intronic
972644494 4:40954596-40954618 TGTTAGAAATACAGATTCCTGGG - Intronic
972803482 4:42503126-42503148 TGTTTAACATACAGAATACTTGG + Intronic
972900824 4:43681062-43681084 TGATCAATATTCAAATTACCTGG - Intergenic
972982683 4:44725390-44725412 AGTTAAAAATACAGATTCTCAGG + Intronic
973210085 4:47605753-47605775 TCTTAAAAATACAGACTCCCAGG - Intronic
973320715 4:48807762-48807784 TTTTAAAAATACAGATTCTCTGG - Intronic
973938095 4:55871564-55871586 TGTTAAAAACATAGATTGCCTGG + Intronic
974042846 4:56872294-56872316 TGCTAAATATGCTGATTCCCAGG + Intergenic
974378861 4:61111755-61111777 AGTCCAAAATACAGATTACCTGG - Intergenic
975177711 4:71307339-71307361 AATTAAAAACACAGATTACCAGG - Intronic
975218745 4:71789282-71789304 TTTTAAATATATATATTTCCAGG + Intronic
975265364 4:72358774-72358796 TGTTAAATTAAGAGTTTACCTGG - Intronic
975502210 4:75099706-75099728 TCTTCAATATAAAGAATACCAGG - Intergenic
975678305 4:76850157-76850179 TGTTAAACAAACAGATTCACAGG - Intergenic
976613613 4:87054168-87054190 TGTTAAAAATAAAAATTCCCAGG + Intronic
976639892 4:87327394-87327416 TGTTCCATATACAGAAAACCAGG + Intergenic
976651967 4:87445462-87445484 TGTTAAATTTTCGGATTCCCAGG + Intronic
977142618 4:93393127-93393149 TGTTTAGGATACAGATTATCTGG - Intronic
977285640 4:95102895-95102917 TGTTGAATATGCACATTTCCTGG + Intronic
978419050 4:108510787-108510809 CTTTAAAGATACAGATTCCCAGG + Intergenic
978698303 4:111610510-111610532 TGTTAGATATACAGACTCTCAGG - Intergenic
978930331 4:114302914-114302936 ATTTAAAAATAGAGATTACCTGG - Intergenic
979225538 4:118279957-118279979 TGTAAAATATAAAAATTACCAGG + Intergenic
979554914 4:122034681-122034703 TGTCAAATATACATATAGCCTGG - Intergenic
979687007 4:123521749-123521771 TGTTAAAAATACAGATATCTTGG + Intergenic
979974587 4:127181303-127181325 TGTTAAAAATGCAAATTTCCTGG - Intergenic
980014078 4:127628829-127628851 TGTTTAAAATAGAGATTTCCAGG + Intronic
980542921 4:134217875-134217897 TTTTAAATATTCTGATTACTTGG - Intergenic
981299725 4:143173438-143173460 TGTTCAATATACAGTTTAATTGG - Intergenic
981507247 4:145515880-145515902 TGTTAGAAACAAAGATTACCAGG - Intronic
981775476 4:148362144-148362166 AATTTAATATACAGATTTCCTGG + Intronic
982023094 4:151223836-151223858 TGTTTAATATACAGATTTTGAGG + Intronic
984360335 4:178721922-178721944 TGGTAAAGATACAGAATAACTGG - Intergenic
984574195 4:181428358-181428380 TGTTAAAAACACATATTGCCAGG + Intergenic
986771353 5:10976956-10976978 TGTTAGAAATGCAGATTACTGGG + Intronic
987478735 5:18426575-18426597 TGTTAAAAATACACAACACCCGG - Intergenic
988079276 5:26395770-26395792 TTTAAAATATATAGATTACTTGG - Intergenic
989342760 5:40394856-40394878 TGTAAAAACTACAGATTCCCAGG + Intergenic
989645472 5:43627438-43627460 TGTTAAAAATTCAAATTCCCAGG - Intronic
990789908 5:59465483-59465505 TAGTAAATATACACAGTACCAGG - Intronic
990944246 5:61233311-61233333 GGTTACAAATACAGATTCCCAGG + Intergenic
991092640 5:62707869-62707891 TGTTAAAAATACAGATGCTCAGG + Intergenic
991948351 5:71923536-71923558 AGTTAAGGATACAGATTCCCAGG + Intergenic
991971800 5:72148563-72148585 TGTTCAAAATGCAGATTCCCAGG - Intronic
992439532 5:76786297-76786319 TGTTAAAAACACAGATTTCTTGG + Intergenic
993335478 5:86653046-86653068 TGTTAAAAATGCAGATTTCTGGG - Intergenic
993464299 5:88226062-88226084 ATGTGAATATACAGATTACCAGG + Intronic
993485972 5:88486080-88486102 TGTTAAAAATACAAATTAATAGG + Intergenic
993602913 5:89951253-89951275 TGTTCTATATACAGAACACCAGG - Intergenic
993656785 5:90587425-90587447 TGTAAAAAATACATATTTCCTGG - Intronic
995739214 5:115337199-115337221 TGTTAAAAATACAGATTACTGGG + Intergenic
996068781 5:119110610-119110632 TGTTCAATATATAGATTATGTGG - Intronic
996077785 5:119217742-119217764 TATTACATATACATATTACAGGG - Intronic
996373486 5:122777322-122777344 TGTTAAAAATGCAGAATACTGGG - Intronic
996449864 5:123608790-123608812 TTTTAAAAATACTGATAACCAGG - Intronic
996808181 5:127481759-127481781 TTTTAAATCTACATATAACCTGG - Intergenic
997792379 5:136772340-136772362 TGTTAAAAATACAGATTTTCAGG - Intergenic
998487933 5:142519779-142519801 TGTTGAACATGCAGATTCCCAGG + Intergenic
998771059 5:145546076-145546098 TGCTAAATATGCAGATTTCCAGG + Intronic
999024270 5:148207897-148207919 TACTAAATATACAGATCCCCAGG + Intronic
999483983 5:151974587-151974609 TGTTATACATTCAGATTCCCAGG - Intergenic
999700069 5:154219656-154219678 TGTTAAACATGCAGATTCCCCGG - Intronic
999713827 5:154343087-154343109 TGTTTAACATGCAGATTCCCCGG + Intronic
999911061 5:156199854-156199876 TTTTAAATATACAGCTTCTCTGG - Intronic
1000197908 5:158977813-158977835 TCTTAAATAAACAGGGTACCAGG + Intronic
1000210551 5:159103502-159103524 TGTTAGAAATGCAGATTTCCAGG + Intergenic
1000454070 5:161427342-161427364 GGTTAAATAGAAAGATTACTTGG + Intronic
1001320919 5:170680860-170680882 TATGAAACATAGAGATTACCAGG + Intronic
1001421903 5:171593928-171593950 TTTTAAAAGTACAGATTTCCGGG + Intergenic
1001460731 5:171911297-171911319 TGTTAAACACACAGATTGCTGGG + Intronic
1002076342 5:176710707-176710729 TGTTAGAAATGCAGATTCCCAGG - Intergenic
1002122011 5:177012257-177012279 TGTTAAATATACAGATTTTGAGG - Intronic
1002152151 5:177243097-177243119 TGTTTAATTTACAGTTCACCAGG + Intronic
1002772789 6:303871-303893 TGTTAAAAATACACATTTCTGGG - Intronic
1003297945 6:4850799-4850821 TGTTAAATATCCAAATTATATGG - Intronic
1003444090 6:6169132-6169154 TGTTAAAAATACAGATGTCTAGG - Intronic
1004802668 6:19167672-19167694 TAATAAATATACAGATTCCTGGG + Intergenic
1004925704 6:20413244-20413266 TGTTACAGATTCAGATTCCCAGG + Intronic
1005420523 6:25643671-25643693 AATTAAATATCCAGATTATCTGG + Intergenic
1005711293 6:28505297-28505319 TGGTAAAAATACAGAATACCAGG - Intronic
1007392735 6:41559824-41559846 TCTTAGAAATACAGATTCCCAGG + Intronic
1007436080 6:41812003-41812025 TGTTATATATACAGATTTCCTGG + Intronic
1007530217 6:42535553-42535575 TTTTAAAAATACAGATTTCTAGG - Intergenic
1007578869 6:42943601-42943623 TGTTAAACATACAGATGTCTGGG + Intergenic
1007909799 6:45502428-45502450 TGTTAAACATACAGATGCCCAGG + Intronic
1008114667 6:47534541-47534563 TACTAAATATACAAATTAGCCGG + Intronic
1008296040 6:49778780-49778802 TGTTAGAAATGCAGATTACTGGG - Intergenic
1008428194 6:51383536-51383558 TGTTAGACATACAAATTACTGGG + Intergenic
1008636406 6:53415325-53415347 TGTTAAAAATCCAGCTTGCCAGG - Intergenic
1008812955 6:55527291-55527313 TTTTAAAAATACAGATTTCTTGG + Intronic
1009484570 6:64203689-64203711 TGTTAAAAATACAGAGTAAGAGG + Intronic
1009641178 6:66338785-66338807 TGTTAAAAATACACATTTCCGGG + Intergenic
1009950399 6:70388815-70388837 TGTTAAATACACAAATTCCCAGG + Intergenic
1010496482 6:76538820-76538842 TGTTATATATACAGCTGACCAGG - Intergenic
1010842998 6:80670751-80670773 TGTTAAATGTTCAGCTTACCAGG + Intergenic
1011020016 6:82802559-82802581 GAATAAATATACAGATAACCTGG + Intergenic
1011369117 6:86613449-86613471 TTTTAAATACACAGATTGCAAGG + Intergenic
1012928655 6:105294180-105294202 TGTTAAAAATACAGTTTTCCAGG + Intronic
1013287258 6:108692310-108692332 TGTTAAAAATTCAGATTCCTTGG + Intergenic
1013576229 6:111485255-111485277 TGCTAACAATACAGATTCCCAGG - Intergenic
1014665863 6:124236647-124236669 TATTAAATATCCAGATTCCTTGG + Intronic
1014677530 6:124385481-124385503 TTTTAAACATAAAGATCACCAGG + Intronic
1014805758 6:125827646-125827668 TCCTAAACACACAGATTACCTGG - Intronic
1015599120 6:134895319-134895341 TTTTAAATGAACAGATCACCTGG - Intergenic
1015877265 6:137835135-137835157 TGTTAAATGTACTGATTTCCAGG + Intergenic
1016109821 6:140209121-140209143 TGTTAAAAATCCAGATTCCTGGG + Intergenic
1016428738 6:143961087-143961109 TTTTAAAAATACAGATTCCTGGG + Intronic
1016547840 6:145244298-145244320 TGTTCAAAATGCAGATTCCCTGG + Intergenic
1017024382 6:150168369-150168391 TACTAAAAATACAGATTACCTGG + Intronic
1017025079 6:150174379-150174401 TACTAAAAATACAGATTACCTGG - Intronic
1017044971 6:150338328-150338350 CGTGAAATTTACAGATTAACTGG + Intergenic
1017067676 6:150544504-150544526 GGTTAAATATTCAGATTCCCAGG - Intergenic
1017914732 6:158822768-158822790 TGTTAAAGAAACAGATTCCCAGG - Intergenic
1018468231 6:164071964-164071986 TGTTAACTATACAGAGTACTGGG + Intergenic
1018556350 6:165055022-165055044 TGTAAAATAAACATATTACAAGG - Intergenic
1019301858 7:309238-309260 TATTAAAAATACAAATTAGCCGG + Intergenic
1019966777 7:4505990-4506012 TGTTAAAAATACAGATTCGTAGG - Intergenic
1020164153 7:5795187-5795209 TGCTAAAAATACAGATTAGTTGG + Intergenic
1020339413 7:7093638-7093660 TGTAGAATATACAGATTCACTGG + Intergenic
1020909779 7:14114360-14114382 TTGTAAATCTACAGATTACTTGG - Intergenic
1021336960 7:19415311-19415333 TGTTAAAAATGCAAATTATCAGG - Intergenic
1021523706 7:21562831-21562853 TGTTACATAGACAGATGAACTGG + Intronic
1021860340 7:24899881-24899903 TGTTAAACATGCAGATTATCAGG - Intronic
1022847809 7:34228407-34228429 TTTTAAAAATACAGATGACCAGG + Intergenic
1022951626 7:35344555-35344577 TGTTAAGAATACACATTCCCTGG + Intergenic
1023000878 7:35806420-35806442 AGTTAAAAATGCAGATTAACTGG + Intronic
1023585205 7:41722676-41722698 TTTTACAAATACAGTTTACCAGG + Intergenic
1023668291 7:42548708-42548730 TGTTGAATTTACAGATTATTTGG - Intergenic
1023727472 7:43158992-43159014 TGTTAAAAATGCAAATTATCTGG - Intronic
1023898789 7:44457935-44457957 GGTTAAACATACAGTTTAACAGG + Intronic
1024047499 7:45595256-45595278 TGTTAGGAATGCAGATTACCAGG + Intronic
1024320999 7:48069566-48069588 TGTTAAATTTATAAATTAACTGG - Intergenic
1024459660 7:49647240-49647262 TTTGAAATATACAAATTACATGG + Intergenic
1026214583 7:68337140-68337162 TGTTAAAAATCCAGATTGCAAGG + Intergenic
1026343419 7:69453551-69453573 AGTTAAACATACACATTCCCAGG + Intergenic
1027421403 7:78020372-78020394 GGTGAAAAATACAGATTCCCCGG + Intronic
1027661160 7:80989710-80989732 TATTAAAAAAACTGATTACCTGG + Intergenic
1027873214 7:83736950-83736972 TGTTAAAAATACAGATTTTTAGG + Intergenic
1027944346 7:84725756-84725778 TGCTAAAAATACATATTAGCTGG - Intergenic
1028028379 7:85875757-85875779 TGATTATCATACAGATTACCAGG - Intergenic
1028144091 7:87302831-87302853 TGTTAAAAATGCAGACTACTAGG - Intergenic
1029014381 7:97299960-97299982 GGTAAAATATACAAATTATCAGG + Intergenic
1029890801 7:103928438-103928460 TGTTAAATATGCTGATTCCTGGG - Intronic
1030195979 7:106853939-106853961 TGTTAAAAACACAGATTCCTAGG - Intergenic
1030394534 7:108968998-108969020 TGTTAGAAATACAGAATTCCAGG - Intergenic
1030526854 7:110664669-110664691 TTTTAAAAACACAGATTTCCAGG - Intronic
1030832731 7:114246244-114246266 TGTTAAATAAACTGATTAAAGGG - Intronic
1030944705 7:115703418-115703440 TGTTAAATACATAAATTAACAGG - Intergenic
1031013839 7:116551114-116551136 TGGTAAAAATACAGATCCCCAGG + Intronic
1031137170 7:117897515-117897537 TGTTAAATATCTGAATTACCTGG - Intergenic
1031451145 7:121921556-121921578 TCTTAAATAAAGAGGTTACCTGG + Intronic
1032063755 7:128747834-128747856 TGTTCAAAGTACAGATTCCCAGG - Exonic
1032237437 7:130137598-130137620 TGTTAACAATACAGATTCCTGGG + Intergenic
1033416781 7:141168606-141168628 TACTAAAAATACAAATTACCTGG + Intronic
1033983286 7:147192465-147192487 TGTTAAACATGCAAATTATCTGG + Intronic
1034095038 7:148399975-148399997 TGTTAGAAATACAGATGCCCAGG + Intronic
1034332375 7:150294091-150294113 TGTTTAAAATACAGATTACTAGG + Intronic
1034585480 7:152088100-152088122 TATTAAAAATACAGATTCCCAGG - Intronic
1034665662 7:152815787-152815809 TGTTTAAAATACAGATTACTAGG - Intronic
1034920021 7:155071866-155071888 TGTTAAATATACAGAACACGAGG + Intronic
1036677062 8:10843118-10843140 TGTAAAATAAAAAGGTTACCAGG - Intergenic
1036706102 8:11048513-11048535 TGTTAAAAATACAGGTTCCTGGG + Intronic
1039296037 8:36156079-36156101 TGTTTAAAATACAGATTAAAGGG + Intergenic
1039296166 8:36157550-36157572 TGTTAAAGCAGCAGATTACCTGG + Intergenic
1040703683 8:50099275-50099297 TGTAAAATATAAAGAATATCTGG - Intronic
1041015341 8:53587608-53587630 TGTTAAATATGCAGAATCCCAGG + Intergenic
1042448380 8:68916415-68916437 TGTTAGAAATACAAATTCCCTGG + Intergenic
1042494720 8:69442964-69442986 TTATAAATTTACAGATTACTTGG + Intergenic
1042909053 8:73805878-73805900 TGTTAAGCATACACATTTCCTGG - Intronic
1043863359 8:85347994-85348016 TGTTAAAAACATAGATTCCCAGG - Intronic
1043960345 8:86410527-86410549 TGTTAAAAATGCAGATCCCCAGG + Intronic
1044355628 8:91219716-91219738 TGTTAGAAATACAAATTATCTGG + Intronic
1044849965 8:96418396-96418418 TATTAAAAATACAAATTAGCTGG + Intergenic
1046127076 8:109923136-109923158 TGTTAAATATGCACATTTCTGGG - Intergenic
1046540637 8:115577367-115577389 TGCTAAAAATACAGATTCTCAGG - Intronic
1046847421 8:118933687-118933709 TGTTAAAAATATAGATTCCTGGG + Intronic
1047028732 8:120852836-120852858 TTTTAAATATTCAGTTTACATGG + Intergenic
1047285405 8:123483518-123483540 GGTTTCATATCCAGATTACCAGG - Intergenic
1048129898 8:131684165-131684187 TGCTTAATATTCAGATTCCCAGG - Intergenic
1048233128 8:132663509-132663531 TGTTAAATGTACAGATAACAAGG - Intronic
1050150767 9:2617544-2617566 GGTTACATATACAGATTCCTGGG + Intergenic
1050181223 9:2924805-2924827 TGTTAAGAATTCAGATTCCCAGG + Intergenic
1050261224 9:3842714-3842736 TATTAAATATACAGAATTCCAGG - Intronic
1050313802 9:4380558-4380580 TGTTAACTATGCAGATTTCCGGG + Intergenic
1050313809 9:4380621-4380643 TGCTAAATATCCAGATTTCTTGG - Intergenic
1050419454 9:5448215-5448237 TGTTTAAAATACAGATTCCAGGG - Intergenic
1050824163 9:9923181-9923203 TGTTAACTCTACAGATAATCTGG + Intronic
1050873230 9:10602467-10602489 GGTTTAATCTTCAGATTACCTGG - Intronic
1051714932 9:19972707-19972729 TGTAAAATATATGAATTACCAGG - Intergenic
1052211841 9:25913371-25913393 TGAAAGATATACAGATAACCTGG + Intergenic
1052660446 9:31422109-31422131 AGTTAAAAATAAAGATTACCAGG + Intergenic
1053044136 9:34899872-34899894 TGTTAAAAATATAGATTTTCTGG + Intergenic
1053391488 9:37739595-37739617 TGCTAAAAATACAGATTCTCAGG + Intronic
1055000899 9:71447562-71447584 TTTTAAATATCCTGATTCCCAGG - Intergenic
1055055003 9:72015319-72015341 TGATAAATATACAATTTCCCAGG - Intergenic
1055281842 9:74683069-74683091 TCTTAAAAATGCAGATTACTGGG - Intronic
1055301761 9:74889905-74889927 TGTGAAAGATACAGATTCCTGGG - Intergenic
1055969254 9:81895177-81895199 GGTTAGACATACAGATTTCCAGG + Intergenic
1056432774 9:86545104-86545126 TGTTAAAAATACAGGTGCCCAGG - Intergenic
1057755298 9:97830157-97830179 TTCAAAATATACAGATCACCAGG + Intergenic
1057862098 9:98648764-98648786 TGCTAAACATCCAGATTTCCAGG - Intronic
1057976295 9:99609429-99609451 TGTTCAATATGCAGGTTTCCAGG - Intergenic
1058083832 9:100727541-100727563 TGTTAAAGATGCAGATTCCCAGG - Intergenic
1058146901 9:101422516-101422538 TGTTAAAAATAGAAATTCCCTGG + Intronic
1058184119 9:101833724-101833746 TGTTAAAAATTTAGATTTCCAGG - Intergenic
1058493732 9:105531223-105531245 TTTTAAAAATGCAAATTACCAGG - Intronic
1058735298 9:107888635-107888657 TTTTAAAAATACAAATTGCCAGG - Intergenic
1058830870 9:108815253-108815275 TGTTTAATATGCAGGTTCCCAGG + Intergenic
1059026785 9:110642855-110642877 TAAAAAATATACAGATTAGCTGG + Intergenic
1059067047 9:111096304-111096326 TGTTAGAAATACAGATTCTCAGG + Intergenic
1059512401 9:114861647-114861669 TGATAAATATACAGAAACCCAGG - Intergenic
1059548609 9:115204562-115204584 TATTAAATATACAGGTTACAAGG + Intronic
1059585671 9:115603468-115603490 TTTTAAATATACTGATGCCCAGG + Intergenic
1059883518 9:118718872-118718894 TGTTAAAAATACAGATTCCTGGG - Intergenic
1060620391 9:125060441-125060463 GGTTATATATTCAGAATACCTGG - Intronic
1061168544 9:128938721-128938743 TGTTAAAAATACAGATTCCAGGG - Intronic
1062203954 9:135325331-135325353 TGTGAAACGTACAGAATACCAGG + Intergenic
1062726861 9:138079124-138079146 TGTTAGACATACAGATTCCCAGG + Intronic
1186007536 X:5089856-5089878 TGTTAAATCTACATATGACCTGG + Intergenic
1186364060 X:8873358-8873380 TGTTAAATGGACAGATTATCAGG + Intergenic
1186516544 X:10170594-10170616 TGTTAGAAATGCAGATTCCCCGG + Intronic
1186583905 X:10851017-10851039 TGTTAAAAATCCAGATTCCTGGG - Intergenic
1186600869 X:11035769-11035791 TGTTAGAAATATAGATTCCCAGG + Intergenic
1186738897 X:12496417-12496439 TGTTAAATATACAGATTACCAGG - Intronic
1186922076 X:14293178-14293200 TGTTAAAAATGCAGATGACCAGG + Intergenic
1187254637 X:17630857-17630879 CTTTAAAAATACAGATTCCCAGG + Intronic
1187427331 X:19190143-19190165 GGTTAAAAATGCAGATTCCCAGG - Intergenic
1187715677 X:22100230-22100252 TGTTAAAAATGCAGATTCCAAGG + Intronic
1187715689 X:22100295-22100317 TGTTTAAAATAAAGATTACTTGG - Intronic
1188221773 X:27549482-27549504 TATAAAATATAGAGATTGCCAGG + Intergenic
1188405130 X:29798001-29798023 TGTTAGAGACACAGATTATCGGG + Intronic
1188734433 X:33695178-33695200 TGTTAAAAATGCAGATTCCTAGG + Intergenic
1188803291 X:34557951-34557973 TGCTAAAAATGCAGAATACCTGG - Intergenic
1188859454 X:35239545-35239567 TTTTAAAAATACAGATTCCTAGG + Intergenic
1189055666 X:37697157-37697179 TGTTAAATATATAGATTACCAGG + Intronic
1189066044 X:37810318-37810340 TTTAAAAAATGCAGATTACCTGG - Intronic
1189228509 X:39433558-39433580 TGTTAAAAATCCATATTCCCAGG - Intergenic
1189329205 X:40132873-40132895 TGTTAAAGATAGAGATTTCCAGG + Intronic
1189841099 X:45079303-45079325 TGCTAAATATGCACAGTACCAGG + Exonic
1189952458 X:46246636-46246658 TGTTAAATACACAGATTCCCAGG - Intergenic
1190013411 X:46805172-46805194 TATTAAAAATACAGATTCCCAGG - Intergenic
1190385409 X:49879184-49879206 TGTTAAAATTACAGATTCCTTGG - Intergenic
1190497798 X:51043385-51043407 TGTTAGAGATGCAGATTATCGGG - Intergenic
1191958810 X:66676656-66676678 TGTTAAAAATGCAGAATATCTGG + Intergenic
1192225683 X:69226456-69226478 TGTTAAAGATACAGACTTACAGG - Intergenic
1192367040 X:70482587-70482609 TAGTAAAAATACAGATTCCCAGG + Intronic
1192404508 X:70870868-70870890 TGTGAAAAATACAGATGCCCAGG - Intronic
1192437172 X:71150047-71150069 TGTTCAACATATAGATTTCCAGG - Intronic
1192439337 X:71163347-71163369 TGTTAAAAACACAGATTGCTGGG + Intronic
1193340164 X:80338797-80338819 TTTTAAAAATGCAGATTACTGGG + Intronic
1194662829 X:96645624-96645646 TGTTAAATATACACATTCCTGGG + Intergenic
1194745690 X:97626072-97626094 TATTACAAATACAGATTCCCGGG - Intergenic
1195134249 X:101888033-101888055 AGTTAAAAATATAGATTCCCAGG + Intronic
1195152150 X:102083091-102083113 TGTTAAAATTGCAGATTACTGGG - Intergenic
1195520866 X:105827019-105827041 TGTTAAAAATACAGATTCCTTGG - Intronic
1196038438 X:111173617-111173639 TGTTAAAGATAAAGATTCCCAGG + Intronic
1196049432 X:111289451-111289473 TGTTAAATATTCAGCTTCCCAGG + Intergenic
1196169395 X:112571038-112571060 TGTTTAAAATGCAGATTTCCAGG + Intergenic
1196578181 X:117346307-117346329 TGCCAAATAAACACATTACCCGG - Intergenic
1196971449 X:121113455-121113477 TGTTAACAATACATATTCCCAGG - Intergenic
1197028063 X:121779576-121779598 TGTTGAATATACATATTATGAGG - Intergenic
1197724423 X:129767298-129767320 TGATAAATATGCAGATTCCAGGG - Intronic
1197756436 X:129998579-129998601 TGTTCAAAATACAGATTCCTAGG - Intronic
1198138377 X:133777711-133777733 TGTTAAATATACAGATTCTTAGG + Intronic
1198141104 X:133804367-133804389 GGTTAAAGATACAGATTCCTTGG - Intronic
1198826919 X:140708331-140708353 TGTTAAAAATACAGATTTCTGGG + Intergenic
1198849870 X:140954823-140954845 TGTTAAAGATGCAGATTCCTGGG + Intergenic
1198849876 X:140954887-140954909 TAATAAATATACAGATAACCAGG - Intergenic
1199061348 X:143358816-143358838 TGTTAAATAGACAGATTCATGGG + Intergenic
1199277132 X:145958811-145958833 TGATAGATATATAGATAACCAGG - Intergenic
1199495709 X:148450016-148450038 TGTCAAATATACAAATTGCCAGG - Intergenic
1201620771 Y:15954751-15954773 TGTTGAATATACAGGTGACCTGG + Intergenic
1202276536 Y:23126558-23126580 TGTTAAAAATGCAGATTACTGGG + Intergenic
1202289492 Y:23294132-23294154 TGTTAAAAATGCAGATTACTGGG - Intergenic
1202429529 Y:24760280-24760302 TGTTAAAAATGCAGATTACTGGG + Intergenic
1202441262 Y:24909810-24909832 TGTTAAAAATGCAGATTACTGGG - Intergenic