ID: 1186742849

View in Genome Browser
Species Human (GRCh38)
Location X:12535967-12535989
Sequence CAAGACAGAGAGACTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186742843_1186742849 24 Left 1186742843 X:12535920-12535942 CCTGGTACCTAGTAAACATTAAA 0: 1
1: 0
2: 10
3: 102
4: 691
Right 1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG 0: 1
1: 0
2: 3
3: 22
4: 258
1186742844_1186742849 17 Left 1186742844 X:12535927-12535949 CCTAGTAAACATTAAATAAATGT 0: 1
1: 2
2: 15
3: 139
4: 847
Right 1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG 0: 1
1: 0
2: 3
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186742849 Original CRISPR CAAGACAGAGAGACTTTTGT GGG Intronic
900616998 1:3569958-3569980 AAAGACAGAGGCCCTTTTGTGGG + Intronic
902767021 1:18623718-18623740 GAAGCCAGAGAGGCTTTTGCTGG - Intergenic
904073407 1:27819746-27819768 CAACACAGAGTGACTTTCTTTGG - Intronic
904306610 1:29594114-29594136 CAAGGCAGAGAGATGTATGTGGG + Intergenic
904346008 1:29870371-29870393 AAAGACAGTGAGGCTTTTATTGG - Intergenic
904956540 1:34288863-34288885 AAAGACAAAGTGACTTTTGGGGG + Intergenic
907864299 1:58384609-58384631 GCAGACAGACAGCCTTTTGTGGG - Intronic
909952687 1:81738224-81738246 CAAGAAAGGGAGACATTGGTTGG - Intronic
910998918 1:93141125-93141147 TAAGACATAAAGATTTTTGTTGG - Intergenic
911884065 1:103275256-103275278 CAAGACAAAAAAACTTGTGTGGG - Intergenic
911898874 1:103474996-103475018 CAAGAAATAGTGACTTTTGGAGG + Intergenic
912247181 1:107971693-107971715 CAATGCAAAGAAACTTTTGTGGG + Intergenic
913277569 1:117154002-117154024 CCAGGCAGAGAGACAGTTGTGGG + Intronic
913278298 1:117160290-117160312 TAAGAAAGAGAGACTTGTGCAGG - Intronic
913377884 1:118174687-118174709 AAAGACAGACAGAATTTTGAAGG + Intronic
915070219 1:153260474-153260496 CACAACAGAGAGAGGTTTGTCGG - Intronic
916388837 1:164307684-164307706 CAAGAGGGATAGAGTTTTGTAGG + Intergenic
918960258 1:191266268-191266290 CAAGAGGGAGAAAGTTTTGTTGG + Intergenic
919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG + Intergenic
920624659 1:207585348-207585370 CAAGACAAAGAGAGTCTTTTTGG - Intronic
921400361 1:214715347-214715369 CTAGAGACAGTGACTTTTGTTGG + Intergenic
921601753 1:217113568-217113590 CAATAGAAAGAGACTTTTGGGGG + Intronic
921756628 1:218864411-218864433 CCAGACAGATAGATATTTGTTGG + Intergenic
924094135 1:240533719-240533741 CAAGACAGAAAGGATTTTGGTGG + Intronic
1063802104 10:9591896-9591918 GAACACACAGAGACTGTTGTAGG + Intergenic
1064521606 10:16209073-16209095 AAAGAAAGAGAGACTTTGTTTGG - Intergenic
1065012098 10:21430111-21430133 AAAGAGAGAGAGAGTTGTGTTGG - Intergenic
1065639266 10:27765404-27765426 CAAGACAGAAAGCCTTGCGTTGG - Intergenic
1065907395 10:30269996-30270018 AAAGACAGAGAAGCATTTGTTGG + Intergenic
1066114449 10:32227095-32227117 CAACAGAGAGAGACTTGTGGAGG + Intergenic
1066651824 10:37663579-37663601 CAAGACAGTGAGAATTGTCTGGG + Intergenic
1067209224 10:44244696-44244718 CCAGACAGAGAGACTCTGCTGGG + Intergenic
1067391595 10:45868101-45868123 CAAGCCAGCAAGAGTTTTGTTGG + Intergenic
1067403085 10:45995563-45995585 CAAGCCAGCAAGAGTTTTGTTGG - Intronic
1067743698 10:48916280-48916302 CCAGAAAGAGAGGCTCTTGTTGG - Intronic
1067871694 10:49968036-49968058 CAAGCCAGTAAGAGTTTTGTTGG - Intronic
1068368286 10:56080793-56080815 CAAGTCTGTGAGACTTTTGGAGG - Intergenic
1069104371 10:64364815-64364837 CAAAACAGAGAGACCTTTGTCGG - Intergenic
1070541386 10:77417853-77417875 CAAGACAGACAGACTTTGGGAGG + Intronic
1071705927 10:87998424-87998446 CAGGAGAGAGAGAGTTGTGTGGG + Intergenic
1072508479 10:96093835-96093857 CAACACAGAGATACCTTTTTTGG + Intergenic
1073723439 10:106202256-106202278 CAAGGCAGAAAGACTTTTAGGGG + Intergenic
1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG + Intronic
1079648746 11:22899770-22899792 CAAGACACTGAGGCTTTTTTAGG + Intergenic
1080575211 11:33592609-33592631 CAAGACAGAGTTACTGTTCTTGG + Intronic
1080954475 11:37077326-37077348 CAAGGTATAGAGACATTTGTCGG - Intergenic
1081365435 11:42229670-42229692 CAAGACAGAGAGTGATTTTTAGG + Intergenic
1081412133 11:42772413-42772435 CAAGAAAGAATCACTTTTGTAGG - Intergenic
1083638905 11:64134942-64134964 GAAGGCAGAGAGATTTGTGTGGG + Intronic
1084702737 11:70798148-70798170 CATCAGAGAGAGACTTTTGGGGG - Intronic
1085014949 11:73167811-73167833 CAAAACAGAGAGACGTTTGCAGG + Intergenic
1085226756 11:74928496-74928518 CAAGACAGTGAGACTGTCATTGG - Intronic
1086746855 11:90439714-90439736 TAAAACTGAGAGACTTTTTTGGG + Intergenic
1088438897 11:109846558-109846580 CCAGACAGTGAGATTTTTGGAGG - Intergenic
1088484883 11:110330922-110330944 CAAGACAGAGAGAGAGTTGTGGG + Intergenic
1089178190 11:116563288-116563310 CAGGACTGAGAGCCTCTTGTTGG - Intergenic
1089708010 11:120294533-120294555 TGAGATAGAGAGACTTCTGTTGG - Intronic
1089757497 11:120697195-120697217 CATGAGAGAGAGCCTTTGGTTGG + Intronic
1090154371 11:124422198-124422220 AAACTCAGAGAGACTTTTCTTGG - Intergenic
1090234129 11:125133941-125133963 CAAGAGTGAGAGCCTTTAGTGGG - Intergenic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1091625803 12:2119871-2119893 CAAGACAGAGAGACTTTCTCTGG - Intronic
1091634570 12:2187344-2187366 CAAGACAGAGAGGCTGCTATGGG - Intronic
1091947077 12:4556406-4556428 GAAGACAGAGAAACCTTTTTTGG - Exonic
1092593301 12:9972090-9972112 TCAGACAGAGAGACCTTTATAGG + Intronic
1092768544 12:11875470-11875492 CAAGCCAGTAAAACTTTTGTAGG - Intronic
1093542718 12:20305935-20305957 CATCACAGAGTGGCTTTTGTAGG - Intergenic
1093896365 12:24578940-24578962 CAAGACAGAGATATTTCTCTGGG + Intergenic
1095289662 12:40463245-40463267 CAAGACAGAGACCCTTTTGGGGG + Intronic
1095821873 12:46487185-46487207 GCAGACAGACAGACATTTGTGGG + Intergenic
1095878916 12:47111525-47111547 CAAGACGGAAAGAGTCTTGTGGG - Intronic
1097678416 12:62626827-62626849 CACGATAGAAAGCCTTTTGTGGG - Intergenic
1098489428 12:71058373-71058395 CAAGAGAGAGAGACTTATGCAGG - Intronic
1099649975 12:85413989-85414011 GAAGACAGAAAGACTTTTACAGG - Intergenic
1099658570 12:85526547-85526569 CAAGACAGAAAGAGTTTGGAGGG - Intergenic
1101739309 12:107487947-107487969 CAGGGCAGAAAGACTTTTGGGGG + Intronic
1104249386 12:127077005-127077027 GAAAACAAAGAGACTTTTATTGG - Intergenic
1104438985 12:128779807-128779829 CAAGACACAGAGACTTTATGTGG - Intergenic
1107303309 13:38990669-38990691 CAAGATAAAGAGAATTTCGTGGG - Exonic
1108037985 13:46311990-46312012 CAAGACTGCCAGACATTTGTAGG - Intergenic
1109440499 13:62365277-62365299 CTACACAGTGAGTCTTTTGTTGG - Intergenic
1112742605 13:102492342-102492364 AAAGATAGAGAGACTTTGGGTGG - Intergenic
1114163637 14:20196531-20196553 CAAGGCAGAGTGGCTTTTGAAGG - Intergenic
1115152752 14:30304257-30304279 CAAGTCAGAGAGATTTTGGAAGG + Intergenic
1115734143 14:36305752-36305774 AGAGAGAGAGATACTTTTGTGGG - Intronic
1116001149 14:39244015-39244037 CCAGACAGACAGGCTTTTCTGGG - Intronic
1117337168 14:54765605-54765627 CAACACAGTGAGACTTGTCTCGG + Intronic
1117694119 14:58341050-58341072 AAAGACAGAGAGACTGATGGAGG - Intronic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1118582292 14:67314312-67314334 TAAGCCAAAGAGACTTTTCTGGG + Intronic
1118620307 14:67609020-67609042 CAAGTCAGGGGCACTTTTGTGGG - Intergenic
1118826039 14:69382473-69382495 CAAACCAGAGTGATTTTTGTTGG - Intronic
1119996570 14:79260447-79260469 GAAAACAGAGAGGCTTGTGTTGG + Intronic
1120624594 14:86809364-86809386 AGAGACAGAGAGACAGTTGTGGG - Intergenic
1121187297 14:91985688-91985710 AAAGACAGATTGCCTTTTGTTGG - Intronic
1127304112 15:57685055-57685077 CCACACTGAGAGACTTGTGTGGG + Exonic
1127530460 15:59838675-59838697 AGAGAAAGAGAGAATTTTGTAGG + Intergenic
1127919462 15:63481825-63481847 CCAGACAGGGAGCCTCTTGTGGG + Intergenic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1129295871 15:74599832-74599854 CAAGACAGAGAGTCCCTGGTGGG + Intronic
1131648080 15:94367492-94367514 CCAGACAGAGTGAGTTTTGGGGG + Intronic
1131718337 15:95138349-95138371 TAAGCCAGAGAGACATCTGTTGG - Intergenic
1136292258 16:29282226-29282248 CAAGACAGAGAGGATTTTTAGGG - Intergenic
1137338890 16:47578916-47578938 CTAGAGAGACAGGCTTTTGTTGG + Intronic
1140978567 16:80084451-80084473 CAAGAGAGAGAGAATTTTCTGGG - Intergenic
1145278346 17:21450278-21450300 ACAGAGAGAGAGACTTTAGTAGG - Intergenic
1145316168 17:21736174-21736196 ACAGAGAGAGAGACTTTAGTAGG - Intergenic
1145401107 17:22533758-22533780 ACAGAGAGAGAGACTTTAGTAGG + Intergenic
1145714598 17:27008099-27008121 ACAGAGAGAGAGACTTTAGTAGG - Intergenic
1145945201 17:28768854-28768876 AAAAAAAGAGAGACTTCTGTTGG + Intronic
1146219225 17:31003919-31003941 CAAGCCAGAAAGACTTTCCTTGG + Intergenic
1147346547 17:39800663-39800685 CACCCCAGAGAGAATTTTGTAGG + Intronic
1149167142 17:53765875-53765897 AAAGAAATAGAGACTTTTTTAGG + Intergenic
1149180992 17:53936128-53936150 AAAGACAGAGACACTTTTGAAGG + Intergenic
1150150594 17:62805955-62805977 GAAGGAAGAGAGACTTTTGTAGG - Intronic
1150583606 17:66497925-66497947 CAAGATAGAGTGCCTGTTGTGGG + Intronic
1153178686 18:2407875-2407897 CAAGGCATAGAAACTTTGGTGGG - Intergenic
1153592186 18:6685281-6685303 AAAGAAACAGTGACTTTTGTGGG - Intergenic
1153596041 18:6726141-6726163 CAAGACAGACAGGCTTTGCTGGG + Intergenic
1155274160 18:24169956-24169978 AATGTCAGAGAGACTTTTGGAGG + Intronic
1157103794 18:44754291-44754313 GAACACAGTGAGACTTCTGTAGG + Intronic
1158997102 18:62932873-62932895 CAAGTCTGAGAGTCTTTTGGAGG - Intronic
1159604684 18:70462780-70462802 AAGGACAGAGATACTTTTGGTGG + Intergenic
1160590404 18:79941359-79941381 CATGGCAGAGAGACTCTTGAGGG - Intronic
1162537986 19:11275476-11275498 CTAGAGAGAGAGACATTTGCAGG + Intergenic
1164676293 19:30103943-30103965 CAAGAAAGAGAGCATTTTGGAGG - Intergenic
1165200722 19:34142274-34142296 CAGGACAGAGATACTGTTGCAGG + Intergenic
1165799018 19:38536292-38536314 CAAGACAGAATGACTTCTGGTGG - Intronic
1168290641 19:55355360-55355382 CAAGCCAGAGAGAGCTTTGGGGG + Intronic
925227910 2:2201883-2201905 CAAGAAATACAGACTTTTATTGG + Intronic
926421814 2:12707398-12707420 CAAGAACGAGTTACTTTTGTTGG - Intergenic
929185738 2:39092002-39092024 GAAGAAAAACAGACTTTTGTGGG - Intronic
929634287 2:43501333-43501355 AAAAAAAGAGAGACTTTTATGGG + Intronic
930743341 2:54856424-54856446 CAGGACATGGATACTTTTGTGGG - Intronic
931174575 2:59840305-59840327 TAAGACAGACAGATTTGTGTAGG + Intergenic
932066089 2:68562385-68562407 CTGGAGAGAGATACTTTTGTAGG + Intronic
932696512 2:73961394-73961416 CAACACAGTGAGACTGTTGTGGG - Intergenic
932736272 2:74256819-74256841 AGAGACAGAGATAATTTTGTCGG + Intronic
935026690 2:99283763-99283785 CATGACAGAGAGACAATTCTAGG + Intronic
935141504 2:100356850-100356872 CAAGACAGAGATAATTTTTAGGG + Intergenic
935146667 2:100400030-100400052 GAAGACAGAGAGGCTCTTTTGGG - Intronic
936464801 2:112738029-112738051 CAAGCCCCAGAGACTGTTGTAGG - Exonic
938697889 2:133851097-133851119 AAAGACAGAGAGAGAGTTGTGGG + Intergenic
939967285 2:148622889-148622911 CTGGACAGAGAGCCTTTTCTAGG - Intergenic
940223811 2:151381574-151381596 GAGGACAGAGAGACCTTTCTAGG - Intergenic
942206466 2:173624655-173624677 CAACAAAGATAGACTCTTGTCGG - Intergenic
944319415 2:198320728-198320750 CAAGACACAGAGAGCTCTGTCGG - Intronic
944712611 2:202348595-202348617 TAAAGCAGAGAGACTTTTTTTGG - Intergenic
945641470 2:212436791-212436813 CAAACCAAAGAGACTTTTGCAGG + Intronic
945792451 2:214322079-214322101 CAAGACAGAGAAACATGTGGAGG - Intronic
946576448 2:221081179-221081201 AAATAAAGAGAGACCTTTGTTGG - Intergenic
947244187 2:228028943-228028965 AAAGATAAAAAGACTTTTGTTGG + Intronic
947687678 2:232104383-232104405 TAACACACAGAAACTTTTGTGGG + Intronic
948623176 2:239249432-239249454 GAAGACAGAGAGACTTGAGTGGG + Intronic
1172306452 20:33884267-33884289 CCAGGCAGAGAGACCTGTGTGGG - Intergenic
1172905871 20:38368862-38368884 AAAGGCACAGAGAATTTTGTTGG + Intronic
1173153450 20:40587338-40587360 CAAGTGAGAGAGACATTTCTAGG - Intergenic
1173767724 20:45629076-45629098 ACAGAAAGAGAGACTATTGTAGG - Intronic
1176735160 21:10539523-10539545 CACGACAGACAGCCTTTTGTGGG - Intronic
1176840938 21:13843113-13843135 AAAGACAGAGAGACAGTTGGTGG + Intergenic
1178367865 21:32002496-32002518 TATGTCAGAAAGACTTTTGTAGG - Exonic
1178427880 21:32493391-32493413 CAAGACAGAGACACTTTCAAAGG - Intronic
1179798250 21:43798239-43798261 GAAGCCAGAGTGACTTCTGTGGG + Intronic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
1184260929 22:43315669-43315691 CAACAGAGAGAGCCTTTTCTTGG + Intronic
1184317731 22:43710092-43710114 TAAGACAGAGAACCTTTTTTGGG - Intronic
1184812243 22:46843979-46844001 CAAGGCAGATAGATGTTTGTGGG + Intronic
949136192 3:569258-569280 AAAGACAGAGTGCCTTTTCTTGG + Intergenic
950235487 3:11316448-11316470 TAAGACAGAGAGAATTTCTTAGG - Intronic
951828330 3:26894419-26894441 AAAGACAGAGAGACCTTTGTAGG - Intergenic
955268481 3:57471540-57471562 CAAGAGAGAGAAACTTATTTTGG - Intronic
956613891 3:71152127-71152149 GAAGACAGAGATTCTTTGGTTGG + Intronic
957600427 3:82327040-82327062 CAAGGAAGACAGACTATTGTTGG + Intergenic
957613571 3:82499574-82499596 CAAGACTGGGAGCCTTTTGAAGG - Intergenic
957844563 3:85715240-85715262 CATGACAATGAGACCTTTGTTGG + Intronic
959215966 3:103450088-103450110 GCAGACAGAGAGACTTTGTTTGG + Intergenic
960495355 3:118367111-118367133 CAAAACTGACAGACTTTTGCTGG - Intergenic
961148491 3:124615793-124615815 AACCACAGAGAGACTTTTGCGGG + Intronic
961401228 3:126645263-126645285 CAAGACAGAAAGATATTTCTTGG - Intronic
961432854 3:126895554-126895576 CAAGACAGAGGGCCTTTCATGGG - Intronic
961693918 3:128690815-128690837 CTAGACAGAGTAACTTTTCTAGG + Intergenic
962189539 3:133296037-133296059 CAAGACAAGGATACTTTTTTTGG - Intronic
962545868 3:136434714-136434736 CAGGACAGAGAGATCTTTGAAGG - Intronic
967047424 3:185750649-185750671 CAAGACAGAAAGGCTTCTCTTGG + Intronic
969726558 4:8921591-8921613 TAACACAGTGAGACTCTTGTTGG - Intergenic
970212300 4:13722255-13722277 CAAGACAGAGAGACGAAAGTGGG - Intergenic
970680945 4:18507197-18507219 CCAGACAGAGAGGCTTTGTTAGG + Intergenic
976006223 4:80433401-80433423 TAAGAAAGAGAAACATTTGTGGG + Intronic
976556007 4:86452381-86452403 CAAGAGAGAGAAATTATTGTAGG + Intronic
977044098 4:92047539-92047561 CATTACAGAGAGACTGTTCTGGG + Intergenic
984145806 4:176058718-176058740 CATGACAGAGAGACTGGGGTGGG + Intergenic
986026542 5:3856300-3856322 GAAGTCAGAGAGACTTGTCTGGG - Intergenic
986425907 5:7631297-7631319 TAAGATGGAGATACTTTTGTGGG + Intronic
987602330 5:20087457-20087479 CGTGACAGAGAAATTTTTGTGGG + Intronic
989729213 5:44628030-44628052 CAAATGAGAGAGACTTTAGTGGG + Intergenic
990219249 5:53569052-53569074 CAAGACAGACTGACATTTTTAGG - Intronic
990252593 5:53931784-53931806 TAAGACAGAGAGAGGCTTGTGGG - Intronic
990335398 5:54767649-54767671 AAGGCCAGAGAGACTTTTCTTGG + Intergenic
992896990 5:81254186-81254208 CAAGAGAGAAAGCCTTTTGAAGG - Intronic
993164638 5:84336534-84336556 CAAGACAGTGAGAGTGTTGATGG + Intronic
993803865 5:92379309-92379331 AATGACAGAGAGACATCTGTTGG - Intergenic
994121410 5:96117942-96117964 AAAGACAGAGAACTTTTTGTAGG - Intergenic
995584191 5:113629919-113629941 CCAGATAGAGAAACTTGTGTGGG + Intergenic
995589981 5:113689243-113689265 CAAAAAAGAGAGTCTTTTGTCGG + Intergenic
995616269 5:113967688-113967710 CAAGACCGAGAGAGTTATGGTGG - Intergenic
996981097 5:129496066-129496088 CATGAAAGAAAGAATTTTGTTGG + Intronic
997794984 5:136800164-136800186 CAAAACAGAGAGAACTGTGTAGG + Intergenic
998952913 5:147410163-147410185 TAAGACAGAGATTCTTTAGTTGG - Intronic
999013098 5:148064604-148064626 AAAGAGTGAGGGACTTTTGTGGG + Intronic
999661846 5:153872610-153872632 CGTGGCAGAGACACTTTTGTTGG - Intergenic
1001940323 5:175735530-175735552 CAGGGCAGAGAGACCTTTCTTGG + Intergenic
1001971352 5:175957405-175957427 GAAGACAGAGAGAATCTGGTTGG - Intronic
1002116795 5:176968584-176968606 CTTGAAAGAGAAACTTTTGTTGG - Exonic
1002246090 5:177886372-177886394 GAAGACAGAGAGAATCTGGTTGG + Intergenic
1003150030 6:3540567-3540589 CAAGATAGAGAGAGGTTTGGGGG - Intergenic
1003831802 6:10020169-10020191 GGAGACAGAGAAACTTTTTTTGG - Intronic
1003986243 6:11437926-11437948 CAAGACACAGAGACACCTGTGGG - Intergenic
1004470846 6:15927813-15927835 CAAGACTGACAGACTGTAGTTGG + Intergenic
1004904160 6:20220865-20220887 CAAGACAGAGTGGCTTTGGTGGG - Intergenic
1006558758 6:34890560-34890582 AAAGGCAGAGAGACTTGTTTAGG + Intronic
1006650912 6:35550915-35550937 AAAGCCAAAGAGACTTTTGATGG + Intergenic
1006956491 6:37878084-37878106 CAATACAGTGAGAGTTGTGTGGG + Intronic
1008333898 6:50276376-50276398 TAAGAGAGAGAGACTGTTTTAGG - Intergenic
1008375044 6:50781889-50781911 AAAGTCAGAGAGATATTTGTTGG - Intergenic
1011905421 6:92361095-92361117 CAAGATAGAGAGAAATTCGTGGG - Intergenic
1012268149 6:97172884-97172906 CAAGACAGAGATACATTTGAAGG + Intronic
1013337288 6:109176760-109176782 GAAGCCAGGGAGACTTTTGAAGG + Intergenic
1013710140 6:112887691-112887713 CAAGAGAGAGAGAGTTGTGGGGG + Intergenic
1016638837 6:146325056-146325078 CAAGACAGAGTGACATTTGTTGG + Intronic
1016874103 6:148847779-148847801 CAACACAGAGAGCCTGTTCTGGG + Intronic
1016921270 6:149296473-149296495 CAAGACAGTAAGACATTTTTAGG - Intronic
1018460395 6:163993322-163993344 CAAGAAAGAGGGACATTTCTTGG - Intergenic
1018774616 6:167001245-167001267 CAAGACAGAGTGATTATTCTTGG - Intronic
1020834547 7:13132510-13132532 CAAGAGAGAGAGACTTGGGGAGG - Intergenic
1022945336 7:35278400-35278422 CAGGATAGAGAGCCATTTGTGGG + Intergenic
1024956628 7:54927386-54927408 AAAGAGAGAGAGACTTTGTTTGG + Intergenic
1026664463 7:72330484-72330506 AAAGAGAGAGAGACCTTTGTTGG + Intronic
1028257391 7:88616396-88616418 TAAGAAGGAGAGATTTTTGTAGG + Intergenic
1029155576 7:98515132-98515154 AGAGACAGAGAGACTTTTGCAGG - Intergenic
1029378119 7:100194392-100194414 AGAGACAGAGAAACTCTTGTTGG + Intronic
1032067329 7:128781473-128781495 CAAACCAAAGAGACTTTTTTGGG - Intergenic
1032510687 7:132470036-132470058 CAAGGCAGAGAGGCTTTTGGTGG - Intronic
1033519762 7:142148807-142148829 CAAGACAGGGAGACTTTGATGGG + Intronic
1034252443 7:149703179-149703201 AAAGACAGGGAGTCTTTTGATGG + Intergenic
1034730191 7:153380650-153380672 AAAGACAGAGAGTCTTCTGAAGG - Intergenic
1035400489 7:158562055-158562077 CCTGACAGAGAGACTTCTCTTGG - Intronic
1037057147 8:14456892-14456914 CAAGAGAGAGAGAGTGTGGTTGG - Intronic
1037224287 8:16565629-16565651 AAAGGCAGAAAGCCTTTTGTAGG + Intronic
1038363586 8:26907964-26907986 CAAGACCAAGACACCTTTGTGGG - Intergenic
1038589586 8:28824449-28824471 GAAGACAGAGGGACTTAGGTAGG - Intronic
1039085107 8:33771961-33771983 TAACACAGAAAGACCTTTGTGGG - Intergenic
1041462839 8:58130943-58130965 GAAGACAGTGATACTGTTGTGGG - Intronic
1043044636 8:75306282-75306304 CAAGCAAGAGAGGATTTTGTAGG - Intergenic
1043263373 8:78229875-78229897 AATGCCAGATAGACTTTTGTAGG + Intergenic
1044294408 8:90510933-90510955 CAAGACAAAGATTCTTTTCTTGG + Intergenic
1044338506 8:91018869-91018891 CATGGCACAGAGATTTTTGTTGG - Intronic
1045404362 8:101850591-101850613 CAAGATATAGTAACTTTTGTGGG - Intronic
1045943168 8:107763203-107763225 CAAGATAGAGAGAGGTTTGTAGG + Intergenic
1046263320 8:111799446-111799468 AAAGCCAGAGGGACTTTTATTGG + Intergenic
1046335547 8:112781728-112781750 AAAGACAGAGAGACTCTGTTGGG + Intronic
1047683944 8:127284598-127284620 AAAGACACAGAGATTTATGTGGG + Intergenic
1047849880 8:128845327-128845349 CAAGACTGAGTGACTCTAGTGGG + Intergenic
1051148227 9:14052831-14052853 TAAGACACTGAGATTTTTGTGGG - Intergenic
1051336948 9:16074270-16074292 CAAGACAAAGAGAATGCTGTTGG - Intergenic
1052284569 9:26770366-26770388 CAATACAAATACACTTTTGTAGG + Intergenic
1052323276 9:27191164-27191186 TAACACAGAGAGATTTTTGAAGG + Intronic
1052722825 9:32193059-32193081 CAATACATGGAGTCTTTTGTGGG + Intergenic
1052987687 9:34500177-34500199 GAAGGCAGAGACAATTTTGTGGG + Intronic
1055711747 9:79070652-79070674 TAAGATAGAGAGAATTCTGTGGG + Intergenic
1057292152 9:93813589-93813611 CAAGACAGAGAACCGTATGTTGG - Intergenic
1059821376 9:117976987-117977009 CAAAGCATAGAGAGTTTTGTAGG - Intergenic
1059858793 9:118433800-118433822 CAAGACAGCAAAACTTTTGAAGG + Intergenic
1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG + Intronic
1187265166 X:17725691-17725713 GAAGAGGGAGAGTCTTTTGTGGG + Exonic
1188290001 X:28375884-28375906 AAAGACAGAGAAACATTTGGTGG - Intergenic
1188504707 X:30869439-30869461 CAACACACAGTGACTTTTATAGG - Intronic
1190784527 X:53632131-53632153 CAATACATAAAGACTTTTGCAGG + Intronic
1191798066 X:65044406-65044428 CAAAACATATAGACTTTTGTAGG + Intergenic
1197037740 X:121897531-121897553 CATGACTAAGAGATTTTTGTGGG + Intergenic
1197866054 X:131018255-131018277 GAAGCCAAAGAGACCTTTGTAGG - Intergenic
1199750725 X:150815050-150815072 TAAGACAAAGAGACTTATATTGG + Intronic
1200751042 Y:6944508-6944530 CAAGACAGAAGGACTTCTGGAGG - Intronic
1201475044 Y:14372176-14372198 CAATACAGAGAAAATTATGTAGG + Intergenic
1202593170 Y:26509049-26509071 CATGACAGACAGCCTTTTGTGGG - Intergenic