ID: 1186743707

View in Genome Browser
Species Human (GRCh38)
Location X:12544428-12544450
Sequence TTAAGGCATCTGCACAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186743707_1186743711 14 Left 1186743707 X:12544428-12544450 CCAAGTTTGTGCAGATGCCTTAA 0: 2
1: 0
2: 0
3: 5
4: 123
Right 1186743711 X:12544465-12544487 TACAATGTTTTTAAGTGTCTTGG 0: 2
1: 0
2: 2
3: 21
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186743707 Original CRISPR TTAAGGCATCTGCACAAACT TGG (reversed) Intronic
903096585 1:20981210-20981232 TTGAGGCCTCTGGAAAAACTGGG + Exonic
906414196 1:45607194-45607216 TTAGGCCATCTGCTGAAACTTGG + Intronic
907712718 1:56899152-56899174 TTAAGTCATCTGCATATACATGG + Intronic
908630092 1:66094616-66094638 TTAAGGCAAAGACACAAACTGGG + Intronic
910153535 1:84185931-84185953 TTGAGGCATATACACAGACTAGG + Intronic
918673134 1:187246129-187246151 TTAAGAAAACTGCATAAACTAGG - Intergenic
920570040 1:207009507-207009529 GTAAGGCATCTGAAAAAACAAGG + Intronic
921168256 1:212523140-212523162 TTAAGGCTGTTGCAGAAACTTGG + Intergenic
924556782 1:245125431-245125453 TGCAAGCACCTGCACAAACTTGG + Intronic
924572462 1:245249463-245249485 TTAACACATATGCACAAACAAGG - Intronic
1064029131 10:11872508-11872530 CTAATGCCTCTCCACAAACTGGG - Intergenic
1064290593 10:14030778-14030800 GTAAGCCATCTACACAAACATGG - Intronic
1064414088 10:15134055-15134077 TTACTGCATTTCCACAAACTGGG + Intronic
1064697111 10:17978558-17978580 TTAAGGAAACTTCACAAACATGG - Intronic
1066250584 10:33629076-33629098 ATAAGGCTTATGCATAAACTTGG + Intergenic
1076299412 10:129413522-129413544 TTAAGCCCTCTGCACAATTTGGG + Intergenic
1078982410 11:16551522-16551544 TTATGGCATCTACACCAAATAGG - Intronic
1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG + Intergenic
1086681559 11:89679805-89679827 TCAAGACAACTTCACAAACTTGG - Intergenic
1088751230 11:112843812-112843834 TTAAGGCATCAGCATCACCTGGG - Intergenic
1088904252 11:114142314-114142336 TCAAGGCTTGTGCACAGACTTGG - Intronic
1095389166 12:41685440-41685462 TAATGGCATTTGCACAACCTGGG + Intergenic
1095970152 12:47896282-47896304 TTAAATCATCTTCAAAAACTGGG - Intronic
1096095672 12:48934055-48934077 TTTAGGCATCTGCTAAAAGTAGG - Intronic
1098845778 12:75534037-75534059 TTAGGTCATCTGCAGAAATTGGG - Intergenic
1100749324 12:97679485-97679507 TTAAGTGATCTGCACACCCTTGG - Intergenic
1102285709 12:111654664-111654686 TTACGGCATATCCAGAAACTGGG + Intronic
1113715214 13:112500246-112500268 ATAAGGCATCTAAGCAAACTAGG + Intronic
1116168259 14:41362377-41362399 GTAAAGCAGCTACACAAACTTGG - Intergenic
1119986806 14:79147631-79147653 TGAAGGCTTCTGGACAAAGTTGG - Intronic
1120272375 14:82329700-82329722 GTAACGAATCTCCACAAACTTGG - Intergenic
1121912738 14:97806738-97806760 TTAAGGCATCTGGAGATGCTGGG + Intergenic
1124344464 15:28913021-28913043 TTCACGCATCTGCACTATCTGGG + Intronic
1125649506 15:41303397-41303419 TTCAGACATCTGCACTATCTGGG + Intergenic
1126354758 15:47783452-47783474 ATAATGCATTAGCACAAACTTGG + Intergenic
1126893085 15:53227403-53227425 TTAGGGCATGTGCAGAAGCTAGG + Intergenic
1132938081 16:2492143-2492165 TTAAGGCATCTATAAAAACCAGG - Intronic
1133423741 16:5669320-5669342 TTGAGGCTTTTGCAGAAACTTGG - Intergenic
1133668909 16:7998417-7998439 TGAAGGCATCAACATAAACTAGG - Intergenic
1134336757 16:13307221-13307243 TTAAGTCCTGTGCACATACTAGG - Intergenic
1137010625 16:35316668-35316690 TCAGGGCATGTGCACAAACCAGG - Intergenic
1138270799 16:55694581-55694603 TTCAGGCATAGGCACAAATTTGG + Intronic
1138347309 16:56328013-56328035 TTTTGCCATCTGCACTAACTTGG + Intronic
1139732868 16:68962167-68962189 TTCAGGAAGTTGCACAAACTGGG - Intronic
1140088529 16:71818106-71818128 TTAAGACATCTGCAGTAACTGGG + Intergenic
1140226408 16:73080969-73080991 AAAACCCATCTGCACAAACTCGG - Intergenic
1140283570 16:73578465-73578487 TTAAAGCCTCTGAGCAAACTAGG - Intergenic
1142297394 16:89234601-89234623 TTAAGGCATCATCACAAAAGTGG - Exonic
1144068387 17:11644765-11644787 CTGAGGAATCTGCACAAACTCGG - Intronic
1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG + Exonic
1149637175 17:58180385-58180407 TGAAGGGATCTGCACACAGTAGG - Intergenic
1150169730 17:62980654-62980676 TCAGGGCATCTGCATTAACTGGG + Intergenic
1153173929 18:2349681-2349703 TTAAGTAATTTGCACAAATTTGG - Intergenic
1155827514 18:30466628-30466650 TAATGGCATCTGCAGAAACCTGG - Intergenic
1158268560 18:55687235-55687257 TTATTGCATCTGCTCAAAATGGG - Intergenic
1160574781 18:79847019-79847041 TTCTGGCATCTTCACAAATTTGG - Intergenic
925355516 2:3238467-3238489 TTAAGGCTAATGCACAAAGTGGG + Intronic
926409838 2:12591422-12591444 TAAAGGCCTCTGAACAAAATGGG + Intergenic
928814455 2:35274191-35274213 TCCAGGCAGCTCCACAAACTGGG + Intergenic
932552542 2:72785820-72785842 TTAAGCCAGCTGCAGAAATTTGG - Intronic
934861642 2:97768551-97768573 TTAAGGCTTCTGAATAAAATGGG + Intronic
935283444 2:101540376-101540398 TTGAGACATACGCACAAACTGGG + Intergenic
937062323 2:118989805-118989827 TCAAGGCAGTTACACAAACTTGG - Intronic
938179674 2:129169146-129169168 TGAAGGAATCTGCACGAACCTGG + Intergenic
939454631 2:142418472-142418494 TTAATGTATGTGCACAAAATGGG - Intergenic
941585712 2:167355529-167355551 TTAAGGAATCTGAACTATCTAGG + Intergenic
948155330 2:235776819-235776841 CTCAGGCATCGGCACCAACTCGG + Intronic
1169082853 20:2807697-2807719 TTAATGCATCTGATCAACCTAGG - Intergenic
1169719745 20:8661605-8661627 TTAAGGCATGTACACAAAAACGG + Intronic
1174086206 20:48009572-48009594 ATAAGTCATCTGCACAAGCCTGG - Intergenic
1177110695 21:17024333-17024355 TTAAAGCATGTGTACAGACTTGG + Intergenic
1178497466 21:33099421-33099443 TTGAGGCATCTGCACTCACACGG + Intergenic
1178922183 21:36745964-36745986 TGCAGGCATCTGCACCATCTCGG - Intronic
1182161413 22:28125889-28125911 ATGAGGCATCTGCATAAAGTAGG + Intronic
1182955119 22:34417274-34417296 TTATGGCAAATGCACATACTGGG + Intergenic
950760121 3:15215127-15215149 TGAAAACATCAGCACAAACTGGG + Intronic
961141034 3:124556462-124556484 TGAAGGCTTCTCCAGAAACTAGG - Intronic
962739566 3:138353181-138353203 TACAGGCATCAGAACAAACTGGG + Intronic
964665447 3:159166922-159166944 CTAATGCATCTGCAAATACTAGG + Intronic
967056198 3:185830701-185830723 TAAAAGCATCTGGACAAAATAGG + Intergenic
967110522 3:186289364-186289386 TTAACGAATCTCCAGAAACTAGG + Intronic
967458446 3:189717685-189717707 TTAATGCTTCTGCAAAATCTGGG + Intronic
968781288 4:2583635-2583657 TTCTGGCAACTGCAGAAACTGGG - Intronic
973142425 4:46784991-46785013 TTAAGGCACATGCACAAATCTGG + Intronic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
975193699 4:71497255-71497277 TTAAGGCTGTTGCCCAAACTAGG + Intronic
976730979 4:88260970-88260992 TTAAGGACTCTTGACAAACTAGG - Exonic
977025562 4:91814240-91814262 TTAAGACTTGTGAACAAACTGGG - Intergenic
978486181 4:109256353-109256375 TTAAGGCATCTTCTCAAACCAGG + Intronic
979223357 4:118255641-118255663 TCAAAGCTGCTGCACAAACTGGG + Exonic
979456452 4:120930853-120930875 TTGAGGAAACTGCACAAACAAGG - Intergenic
980232227 4:130059993-130060015 TTGAGGGATAGGCACAAACTGGG - Intergenic
985159893 4:187033838-187033860 TCAAGCCATCTGCAGAAATTTGG + Intergenic
986434193 5:7711853-7711875 TTAATGCATCACCAAAAACTTGG - Intronic
988125588 5:27029777-27029799 TCAAGGAATCTGCACACATTTGG + Intronic
990461184 5:56032702-56032724 TCAAGTGATCTGCCCAAACTTGG + Intergenic
996682284 5:126240503-126240525 TTAAGTCATCAGAACAATCTTGG - Intergenic
1007526927 6:42504141-42504163 TTAAGGTATCTTCACAGAATTGG - Intergenic
1010467148 6:76181559-76181581 TTATGTCATCTGCAGCAACTTGG + Intergenic
1014457497 6:121653535-121653557 TCAACGCATCTGCATAATCTTGG + Intergenic
1016323604 6:142875118-142875140 TTAAGGAAACTGCTCAAACTTGG + Intronic
1017589686 6:155965529-155965551 TTAAGTCATTTGCCCAAAGTTGG - Intergenic
1018158376 6:161012072-161012094 TTAAGGCCTCTTCACAAATGTGG - Intronic
1019049121 6:169169888-169169910 TAAACACATCTGCACACACTTGG + Intergenic
1020654519 7:10913632-10913654 TTAAGGCATCTGCCCAATAATGG - Intergenic
1023327769 7:39078622-39078644 TTAAGGCAACTGATCAAACCTGG + Intronic
1025022220 7:55488827-55488849 TGCAGGCATCTGCACAAAGCAGG - Intronic
1028104900 7:86865637-86865659 ATAAGGAATTAGCACAAACTGGG + Intergenic
1029309946 7:99653761-99653783 TTCAGACTTCTGCCCAAACTGGG - Intronic
1030432004 7:109461668-109461690 TAATGGCATCTGCAGAAACCTGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1035794772 8:2344689-2344711 TTAAGCCATATGCACATACGTGG + Intergenic
1036489964 8:9215692-9215714 TTAAAGCTTCTGCTCAAACAGGG - Intergenic
1038832566 8:31077808-31077830 TTGAGGCATATACACAGACTGGG + Intronic
1040849281 8:51881930-51881952 TTAATGCATATGCAAAAACATGG - Intronic
1046231009 8:111358422-111358444 TTCAGGCAGCTCCCCAAACTGGG - Intergenic
1051557837 9:18404785-18404807 TTACAGAAGCTGCACAAACTAGG + Intergenic
1052623945 9:30950603-30950625 TTATGGCATATGAACAAAGTTGG - Intergenic
1052644145 9:31210704-31210726 TTAAGGCTTCAGCAAAAACCAGG - Intergenic
1052723829 9:32205071-32205093 TTAAGGAATCTACACATATTTGG + Intergenic
1053240308 9:36489243-36489265 TCAAGGCATTTGCTCAAATTGGG - Intergenic
1055718766 9:79148070-79148092 GTTAGGCATCTGAACAAATTAGG - Intergenic
1057557877 9:96102001-96102023 TTAAGGCATCTTCTCACAATAGG - Intergenic
1186743707 X:12544428-12544450 TTAAGGCATCTGCACAAACTTGG - Intronic
1186775255 X:12858089-12858111 TTAAGGCATCTGCACAAACTTGG + Intergenic
1187855078 X:23628936-23628958 TTCAGGCATCTAGTCAAACTGGG - Intergenic
1192729262 X:73786052-73786074 TTCAGGCATCTGGAATAACTGGG + Intergenic
1193576400 X:83202826-83202848 TCAAGCGATCTGCCCAAACTTGG + Intergenic
1195116735 X:101706869-101706891 GTATGGCATGTGCAAAAACTAGG + Intergenic
1202079927 Y:21073786-21073808 TGAAGGCAATTGCACCAACTAGG - Intergenic