ID: 1186747000

View in Genome Browser
Species Human (GRCh38)
Location X:12580202-12580224
Sequence GAGTTTTAGCCACTGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186747000_1186747006 18 Left 1186747000 X:12580202-12580224 CCCATGTCCAGTGGCTAAAACTC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1186747006 X:12580243-12580265 TTTTCTGGCCTGAAGAACAAGGG 0: 1
1: 1
2: 3
3: 22
4: 296
1186747000_1186747003 3 Left 1186747000 X:12580202-12580224 CCCATGTCCAGTGGCTAAAACTC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1186747003 X:12580228-12580250 TAGAAAACCTATAGTTTTTCTGG 0: 1
1: 0
2: 5
3: 24
4: 243
1186747000_1186747009 30 Left 1186747000 X:12580202-12580224 CCCATGTCCAGTGGCTAAAACTC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1186747009 X:12580255-12580277 AAGAACAAGGGGCCAGAGTTTGG 0: 1
1: 0
2: 2
3: 33
4: 278
1186747000_1186747005 17 Left 1186747000 X:12580202-12580224 CCCATGTCCAGTGGCTAAAACTC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1186747005 X:12580242-12580264 TTTTTCTGGCCTGAAGAACAAGG 0: 1
1: 0
2: 6
3: 22
4: 321
1186747000_1186747007 19 Left 1186747000 X:12580202-12580224 CCCATGTCCAGTGGCTAAAACTC 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1186747007 X:12580244-12580266 TTTCTGGCCTGAAGAACAAGGGG 0: 1
1: 2
2: 13
3: 33
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186747000 Original CRISPR GAGTTTTAGCCACTGGACAT GGG (reversed) Intronic
900312249 1:2039428-2039450 TAGGTTTAGACACTGGAAATAGG + Intergenic
908619419 1:65961021-65961043 CTGTTTTAGGCACTGGAGATTGG + Intronic
912004748 1:104884235-104884257 GAGTTTTAGCCAGTTGTCTTTGG - Intergenic
912609694 1:111030342-111030364 CAGTTTGAGCCACTGGAGCTGGG - Intergenic
912913170 1:113783880-113783902 TTGTTCTAGCCACTGCACATTGG + Intronic
914654325 1:149725304-149725326 GAGTTCTGGCCTCTGAACATGGG - Intergenic
917580523 1:176373230-176373252 GAGTTTTAGCCAAAGGAATTAGG - Intergenic
918437225 1:184527909-184527931 CAGTTTTATCCCATGGACATTGG + Intronic
919747746 1:201019380-201019402 CAGTTTTACCCACTGGAAAATGG - Intronic
921326338 1:213988982-213989004 GAGTTTTAGCCTGGGGAGATCGG - Intronic
921341721 1:214140625-214140647 TACTTATAGCCACAGGACATTGG + Intergenic
921682146 1:218046248-218046270 GAGGTTTAGCCACTTGCCTTAGG - Intergenic
1064401714 10:15026760-15026782 GAGTTTGAGCCACTGCACTCCGG + Intergenic
1066619030 10:37324691-37324713 AAGTTTGAGCCACTGGAGCTGGG - Intronic
1071007473 10:80899417-80899439 TAGTTTTAGCCACTGGAAGGTGG + Intergenic
1073200522 10:101731429-101731451 AAGTTTGAGCCACTGGGCATGGG + Intergenic
1073949182 10:108786457-108786479 AAGTTTGAGCCACTGGATCTGGG - Intergenic
1074549197 10:114427374-114427396 AAGTTTTATCCAGTGGAGATTGG + Intergenic
1074949607 10:118318496-118318518 GATTTCTAGCCACTGAAGATTGG - Intronic
1075479076 10:122763815-122763837 GAGTTTTAGACCCTGGACCCTGG + Intergenic
1077100990 11:822259-822281 GCGTTTTACCCACTGGGCACTGG - Intronic
1080885513 11:36363952-36363974 CATTTTTAGCCACTGGTCTTGGG + Intronic
1084993394 11:72951003-72951025 GAGTTCTAGCCAGTGGATAGGGG - Intronic
1086331898 11:85762506-85762528 GAGTTTTAGTCAATGGTCAGTGG - Intronic
1086592793 11:88535280-88535302 CAGTTTTAGCCAATGATCATGGG + Intronic
1087542425 11:99537117-99537139 AAGTTTTAGCTACTGGAAAAAGG + Intronic
1092278032 12:7076993-7077015 GTTTTTGAGACACTGGACATTGG - Intergenic
1096432072 12:51553938-51553960 GAGTTTAAGCCAGTGCTCATTGG - Intergenic
1096815238 12:54197679-54197701 GGGTTTGAGCCACAGGACAGAGG - Intergenic
1098914203 12:76240411-76240433 GAGTTTTAGACCCTGGACCCTGG - Intergenic
1099781608 12:87202599-87202621 GACTTAGAGCCACTGGACTTAGG + Intergenic
1099941128 12:89189960-89189982 GAGTTTTAGCCAAAGTAAATAGG + Intergenic
1100879814 12:99004227-99004249 TTGTTTCAGCCACTGTACATAGG + Intronic
1101844306 12:108350048-108350070 GAGGTTAAGCCACTTGACTTAGG - Intergenic
1102196526 12:111029285-111029307 GAGCATTGGCCACTGGGCATCGG + Intergenic
1102766500 12:115438159-115438181 GTGTTTTAGGGACTGGAGATAGG + Intergenic
1103153808 12:118665812-118665834 GAATTTAAGCCACTGTACTTTGG - Intergenic
1103575663 12:121875472-121875494 GAGATTGAGCCACTGCACTTCGG - Intergenic
1104113378 12:125725240-125725262 GGGTTTTAGACCCTGGACCTTGG - Intergenic
1104270163 12:127276168-127276190 GCGTTCTAGCCAGTGGACAATGG - Intergenic
1106386295 13:29289309-29289331 CTGTCTTAGCCACTGGACTTGGG + Intronic
1109766052 13:66899334-66899356 GAATTTTAGCCTCTAGACTTTGG - Intronic
1110621155 13:77597247-77597269 GAGTTATAGCCATTGCACACTGG - Intronic
1111438211 13:88240327-88240349 CAGTTGGAGCCACTGGTCATCGG - Intergenic
1113025609 13:105937812-105937834 GAATTTTAGGCACTGGTCAATGG - Intergenic
1113399163 13:109975570-109975592 GATTTTTCTCCGCTGGACATTGG - Intergenic
1115999069 14:39223884-39223906 GAGTGTTATCCTCTAGACATAGG + Intergenic
1126333720 15:47563872-47563894 TATTTTTTGCCACAGGACATTGG - Intronic
1128122456 15:65162818-65162840 GAATATTAGCAACTGGACAGCGG - Intronic
1129115860 15:73365079-73365101 GAGTTTTAGCCATTGGCCTTGGG - Intronic
1130822105 15:87506776-87506798 GAGCTTTAGTCAGTGGAGATGGG - Intergenic
1139527340 16:67525053-67525075 GAGTTTAAGCCACAGGAGAAAGG - Intronic
1140448823 16:75053616-75053638 TAGTGACAGCCACTGGACATTGG - Intronic
1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG + Intergenic
1146696882 17:34915906-34915928 GAATTTTAGCCACAGGAGGTAGG + Intergenic
1149796579 17:59526593-59526615 TAGTTTTAGCTCCTGGAAATGGG + Intergenic
1152024800 17:77801870-77801892 GAGTTTAAGCCCCTGAACATGGG - Intergenic
1155890666 18:31264355-31264377 GAGTATGAACCACTGGAAATGGG + Intergenic
1159476840 18:68931794-68931816 GAGTTTTAGCCAATGGATATGGG - Intronic
925243164 2:2352121-2352143 GAGTTTGCGCCACTGCACCTGGG + Intergenic
926518792 2:13883686-13883708 GAGTTGGAGCCAGTGGACTTGGG + Intergenic
926788403 2:16543885-16543907 GAGGATTAGCCACTGGACCAGGG - Intergenic
926832457 2:16978603-16978625 CAGTCTTGGCCACTGGAAATAGG + Intergenic
929087783 2:38185395-38185417 GAGTTTTAGCAACTTCCCATAGG + Intergenic
929359946 2:41075391-41075413 GATTTTTAGACACTGGAGAAAGG - Intergenic
929559362 2:42946095-42946117 GGGTTTCAGCCACTGGTCAGAGG - Intergenic
931264735 2:60650574-60650596 GAGAGTTAGCCATTGGAAATGGG + Intergenic
932228689 2:70064220-70064242 GAGTTTTAAACACTGGCCCTTGG - Intergenic
932322102 2:70829847-70829869 CAGCTTCAGCCACTGGACTTGGG + Intergenic
935751839 2:106242145-106242167 GGGTTTTAGACCCTGGACCTCGG + Intergenic
935912254 2:107909694-107909716 GGGTTTTAGACCCTGGACCTCGG + Intergenic
940266884 2:151848222-151848244 GGATTTCAGCCACTGGACTTGGG - Intronic
940351066 2:152688884-152688906 GAATTTTAGTGAGTGGACATGGG - Intronic
940982802 2:160022257-160022279 CAATTTTAGCCAGTGAACATGGG - Intronic
943357017 2:186868883-186868905 GAGAAATAGCCACTAGACATTGG - Intergenic
943543549 2:189246533-189246555 GAATTTTAGCAAATGGAAATAGG + Intergenic
943585634 2:189736024-189736046 GAGTTTAAGACAGTTGACATTGG + Intronic
945275965 2:207987885-207987907 GAGTTTTAGCTACTGACCACAGG - Intronic
947543266 2:230992871-230992893 GAGATTTATCCACTTGAGATAGG + Intergenic
948050324 2:234975038-234975060 GAGTTTCAGGAACTGGACAGGGG + Intronic
1170440645 20:16375788-16375810 GAGTCTTTTCCACTGGCCATTGG - Intronic
1173515191 20:43660363-43660385 GTGCTTTTGCCACTGGATATAGG + Intergenic
1174264718 20:49323116-49323138 GATTTTTAGCCACTGAGCTTGGG + Intergenic
1175905386 20:62376985-62377007 GAGATTCAGCCCCGGGACATGGG - Intergenic
1180663274 22:17487806-17487828 GAGTGTAAGCCACAGGACAGTGG - Intronic
1181908945 22:26222506-26222528 GTGTTCTAGCCACTTGACATAGG + Intronic
951280908 3:20748280-20748302 GTGTTTAAGGCACTGCACATTGG + Intergenic
952756812 3:36876272-36876294 AAGTGTTAGCCCCTGGACCTGGG - Intronic
957702436 3:83733950-83733972 GACTTTTGGCCACTTGCCATAGG - Intergenic
959532558 3:107450318-107450340 CAGTTTTAGCCACTGAGCCTGGG - Intergenic
959634566 3:108549688-108549710 CACTTTTAGCCACTGGCTATGGG + Intergenic
960026379 3:113015500-113015522 GATTTTTAGCAACTAGAGATAGG + Intronic
960423229 3:117474786-117474808 GAGTCTAAGGCACTGGACAAGGG + Intergenic
961669840 3:128521028-128521050 CAGTTGTGGCCACTGGACATGGG + Intergenic
962429467 3:135306193-135306215 ATGTTGTAACCACTGGACATGGG - Intergenic
964223050 3:154368229-154368251 GAAGTCTAGCCAGTGGACATTGG - Intronic
964518610 3:157540272-157540294 GTGTTGAAGCCACTGGACATTGG - Intergenic
965260754 3:166482099-166482121 TATTTTTAGCTACTGTACATGGG - Intergenic
966119378 3:176505577-176505599 CAGTTTTAGCATCTGAACATGGG - Intergenic
966273445 3:178136491-178136513 GAGTTTGAGTCACTTGTCATGGG + Intergenic
967825295 3:193872671-193872693 CAGTTTCAGCCTCTGGAAATGGG + Intergenic
968423014 4:500788-500810 GAGCTTTGGCTACTTGACATGGG - Intronic
974144526 4:57930499-57930521 GGGTTTTAGCTTCTTGACATTGG + Intergenic
975180482 4:71338895-71338917 GAGCTTTAGGCATTGGACAGAGG + Intronic
979753129 4:124303982-124304004 AAGCATTAACCACTGGACATTGG - Intergenic
982919422 4:161254921-161254943 CAGTTTGAGCCACTGGAACTGGG + Intergenic
984359777 4:178713729-178713751 GATTTTTAGGTACTAGACATTGG - Intergenic
989800051 5:45526399-45526421 CAGTTTCAGCCACTGGCCTTCGG + Intronic
990299606 5:54437264-54437286 CAGTTTTAGCCCCTTCACATTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
995175781 5:109174769-109174791 AAGTTATAGCCATTGGCCATGGG + Intronic
996798998 5:127381600-127381622 TAGTTTCAGCCAATGGACAGTGG - Intronic
998787694 5:145730177-145730199 GAGTTTTAGACCCTGGACCCTGG + Intronic
1001424977 5:171617066-171617088 TAGTTTTAGCACCTTGACATAGG + Intergenic
1002364066 5:178696574-178696596 TGGTTTTAGACACTGGACAAGGG + Intergenic
1004296467 6:14416246-14416268 GTGTTCTAGCCACAGCACATAGG - Intergenic
1006289116 6:33120946-33120968 CAGTTTGAGCCACTGGAGCTGGG + Intergenic
1013194894 6:107836453-107836475 GAGATTTAGTATCTGGACATTGG - Intergenic
1014557395 6:122851040-122851062 AATTTTCAGCCATTGGACATTGG - Intergenic
1015034065 6:128631108-128631130 AAGTTTTAAACAATGGACATTGG + Intergenic
1022273370 7:28832224-28832246 TTGTTTAAGCCACTGGAAATTGG - Intergenic
1023285159 7:38611715-38611737 GAGTTCTACCCACTGGCCACAGG + Intronic
1023324783 7:39042355-39042377 GAGTTCTGGCCACTGGACTGTGG + Intronic
1027421742 7:78023607-78023629 TAATTTTAGCCACTGGGCCTGGG - Intronic
1034986340 7:155517734-155517756 CACTTTTATCCACTGGCCATGGG + Intronic
1035346858 7:158206045-158206067 GGCTTGTAGCCACTGGACTTGGG + Intronic
1036398864 8:8390713-8390735 GAGTTTTAGCCCCTAGAGACCGG + Intergenic
1036426698 8:8651411-8651433 CAGTTTTGGCCACTGGAATTGGG + Intergenic
1039397843 8:37242451-37242473 ATGTTATAGCAACTGGACATTGG + Intergenic
1039630475 8:39106961-39106983 GAGTTTTAGCCAATGGCCTGCGG + Intergenic
1040722025 8:50336115-50336137 GAGTTTTAGCCAATGGAATGTGG - Intronic
1042860219 8:73305624-73305646 CAGTTACAGCCACTGGACCTGGG + Intronic
1044712967 8:95074524-95074546 CAGTTTTAGACATAGGACATTGG - Intronic
1050987365 9:12100682-12100704 GAGTTTTAGGCAATAGACATGGG + Intergenic
1052280221 9:26724318-26724340 GTCTTTAAGCCACTTGACATAGG - Intergenic
1058861712 9:109122935-109122957 GAGTTATAAACACTGGGCATTGG - Intergenic
1061576410 9:131509811-131509833 GAGTTTGAGCCTCTGGTCTTGGG + Intronic
1062402860 9:136380053-136380075 GTGCCGTAGCCACTGGACATGGG - Intronic
1186747000 X:12580202-12580224 GAGTTTTAGCCACTGGACATGGG - Intronic
1188980571 X:36723450-36723472 GAGTTTTATGCACTTGAGATGGG + Intergenic
1189799420 X:44678011-44678033 GAGTATAAGCCACTGCACCTGGG + Intergenic
1194153148 X:90351384-90351406 GGGTATTAGCCACTTGAAATTGG - Intergenic
1195327999 X:103773664-103773686 AAGTTCTAGCCACAGTACATAGG + Intergenic
1196898247 X:120359170-120359192 GCCTTTTAGCCACTAGAAATAGG + Intergenic
1198661711 X:138975968-138975990 GATTTTGAGCCACTGTTCATTGG + Intronic
1199198041 X:145055592-145055614 GAGTTTTGGCAAATGTACATAGG - Intergenic
1200395508 X:155984318-155984340 GGGTTTTAGACCCTGGACCTTGG + Intergenic
1202047986 Y:20753297-20753319 ATGTTTCAGCCACTGGACAGTGG - Intergenic