ID: 1186747343

View in Genome Browser
Species Human (GRCh38)
Location X:12583556-12583578
Sequence CGGTTAGGCCTGGCTTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186747343_1186747350 17 Left 1186747343 X:12583556-12583578 CCAGCGCAAGCCAGGCCTAACCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1186747350 X:12583596-12583618 TGCTGGTAAAGCCTCGCACCTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1186747343_1186747347 0 Left 1186747343 X:12583556-12583578 CCAGCGCAAGCCAGGCCTAACCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1186747347 X:12583579-12583601 CACCAGCTGAGCCTCAGTGCTGG 0: 1
1: 0
2: 1
3: 24
4: 220
1186747343_1186747351 20 Left 1186747343 X:12583556-12583578 CCAGCGCAAGCCAGGCCTAACCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1186747351 X:12583599-12583621 TGGTAAAGCCTCGCACCTGGCGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186747343 Original CRISPR CGGTTAGGCCTGGCTTGCGC TGG (reversed) Intronic
901815018 1:11788943-11788965 CGGGTGGGCCTGGCCTGAGCTGG - Exonic
905789952 1:40784441-40784463 CCGGGAGGCCAGGCTTGCGCGGG - Intronic
906240674 1:44240298-44240320 TGGTTCAGCCTGGCTTGGGCTGG + Intronic
917291725 1:173477689-173477711 CCGTTCGGCCTGCCCTGCGCGGG + Intronic
1063566345 10:7174719-7174741 CGGTTAGGCCTTTCTTACTCAGG + Intronic
1074814044 10:117131540-117131562 CAGTAAGGCCTGGCTAGGGCCGG + Intronic
1075626998 10:123970716-123970738 GGGCTAGGCCTGTCTAGCGCTGG - Intergenic
1081574369 11:44310056-44310078 CATTCATGCCTGGCTTGCGCAGG + Exonic
1085778790 11:79390071-79390093 CGTTTAGTCTTGGCTTGGGCAGG + Intronic
1093282134 12:17207752-17207774 CAGTTTGGCCTGGTTTGGGCTGG + Intergenic
1101940774 12:109097810-109097832 CGGTGAGGCGCGGCTTGGGCCGG + Exonic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1126156075 15:45566724-45566746 TGGTTAGGCCTAGCTTCTGCAGG + Intergenic
1129329805 15:74821197-74821219 CCGTCAGGCCTGGCTTGGCCTGG - Exonic
1132844322 16:1992942-1992964 GGGGTAGGCCTGGCTCGCCCCGG - Exonic
1139676623 16:68528417-68528439 TGGTTAAGACTGGCTGGCGCTGG - Intergenic
1143649657 17:8255648-8255670 GGGTGAGGGCCGGCTTGCGCTGG + Exonic
1143948385 17:10614220-10614242 TGGTTGGGCCTGACTTGGGCTGG + Intergenic
1144682054 17:17202764-17202786 TGGTTAGGTTTGGCTTTCGCTGG + Exonic
1152970734 18:158767-158789 CGCGTAGGCCTGGCCTGCACGGG + Intronic
1153301841 18:3598265-3598287 CGTTTAGGCCTGGCAGGCGGAGG + Intronic
1160322705 18:77911413-77911435 CGCTCAGGCTTGGCTTGCCCAGG - Intergenic
1168686841 19:58354031-58354053 CGGGTAGGCCTGGGAAGCGCAGG - Intergenic
929386598 2:41415034-41415056 TGGTTAGGCCAGGCCTGAGCAGG - Intergenic
937854092 2:126660282-126660304 TGGTCAGGCCTGGCATGCTCTGG + Intronic
948205581 2:236161189-236161211 CGCTGAGGCCTGGCTGGCACAGG - Intergenic
948213823 2:236214428-236214450 CGGTGAGGCCTGGAGAGCGCAGG + Exonic
1179799490 21:43804316-43804338 CAGTAAGGCCTGGATTGCCCGGG + Exonic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1184252019 22:43266201-43266223 CGGGTGAGCCTGGCTCGCGCGGG - Intronic
1184773673 22:46612670-46612692 GGGTTAGGACTGGCTTGACCTGG + Intronic
951834175 3:26962963-26962985 CAGTTGGGCCTGGCTTGAGTAGG + Intergenic
953785106 3:45905629-45905651 TGGGAAGGCCTGGCTTGGGCAGG - Intronic
953854326 3:46489258-46489280 CGGTTTGGTCAGGCTGGCGCTGG - Intergenic
954173090 3:48821100-48821122 CTGTGAGGCATGGCTTACGCTGG - Intronic
963273600 3:143308817-143308839 AGGTTTGGCCTGGCTTCCCCTGG + Intronic
967835752 3:193960906-193960928 CGGTTAGGCCTGACTGTCCCAGG - Intergenic
968084590 3:195868623-195868645 GGGGCAGGCCTGGCTTCCGCAGG + Exonic
968578218 4:1377712-1377734 CGGTTAGTCCTGGATGGCACCGG + Intronic
969720552 4:8891162-8891184 CGGCAAGGCCTGGCTGGCCCAGG + Intergenic
972723309 4:41722567-41722589 CTGTTAGTCCTCCCTTGCGCAGG - Intergenic
981716535 4:147757796-147757818 CTGTCAGGCCTGGCTCACGCTGG + Intronic
996820344 5:127619651-127619673 AGGATAGGCCTGGCTTGCAAAGG + Intergenic
1000107978 5:158078856-158078878 CTGTCATGCCTGGCTTGGGCTGG + Intergenic
1000209126 5:159095242-159095264 CGGGGAGGCCTGGCTTGCTTGGG + Intronic
1010209861 6:73354255-73354277 TGATTAGGCCTGGTTTGCGCTGG - Exonic
1019340974 7:508799-508821 CTGTGAGGCCTGGCTGGGGCTGG - Intronic
1035418870 7:158710639-158710661 CGTTAACGCCTGGCTTGGGCAGG - Intergenic
1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG + Exonic
1062170792 9:135133591-135133613 AGGTGAGGCCTTGCTTCCGCAGG - Intergenic
1062419017 9:136470188-136470210 CCTTCAGCCCTGGCTTGCGCAGG - Intronic
1186747343 X:12583556-12583578 CGGTTAGGCCTGGCTTGCGCTGG - Intronic
1199933932 X:152553005-152553027 GGGTAAGGCTTGGCTTGCTCTGG - Intergenic