ID: 1186747421

View in Genome Browser
Species Human (GRCh38)
Location X:12583872-12583894
Sequence GCCTGGACGCCCGCTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186747421_1186747424 -9 Left 1186747421 X:12583872-12583894 CCTCAGAAAGCGGGCGTCCAGGC 0: 1
1: 1
2: 0
3: 2
4: 73
Right 1186747424 X:12583886-12583908 CGTCCAGGCTTGAGGGTGCGAGG 0: 2
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186747421 Original CRISPR GCCTGGACGCCCGCTTTCTG AGG (reversed) Intronic
900396411 1:2454930-2454952 GCCTGGACAACAGGTTTCTGGGG - Intronic
901655802 1:10768557-10768579 CCCTGGACTCCAGCCTTCTGGGG + Intronic
904003302 1:27350522-27350544 AACTGGACGCCCCCTTCCTGCGG + Intronic
910441889 1:87261421-87261443 GGCTGGAAGCCAACTTTCTGTGG - Intergenic
915346012 1:155197330-155197352 GCTTGGAGGCCGGCTCTCTGGGG - Intronic
1066068222 10:31778048-31778070 GCCTGGACTTCTGATTTCTGTGG + Intergenic
1067832925 10:49620736-49620758 GCCTGGACGTCCACTGTCTCGGG - Intronic
1075629370 10:123991856-123991878 GCCCCGCCGCCTGCTTTCTGCGG - Intergenic
1076662524 10:132065019-132065041 GCCTGCACGCCCAGGTTCTGGGG - Intergenic
1077047178 11:551766-551788 GCCTGAAGGCCTGCTTTCTGAGG + Exonic
1088696153 11:112367593-112367615 GCCTGGAACCCCGCTTCCTCTGG - Intergenic
1089554654 11:119309752-119309774 GCCTGCACACCCCCTTTCAGAGG - Exonic
1091652075 12:2318214-2318236 GCCTGGGCGCTCTCCTTCTGGGG + Intronic
1096797021 12:54084308-54084330 GCCTGGACTCTGGATTTCTGGGG - Intergenic
1102565311 12:113793680-113793702 ACCTGGATGCCCCCTTTCTAAGG + Intergenic
1105043892 12:132986111-132986133 GCCTGGACGCCCAGTTTCCCAGG - Intergenic
1114219316 14:20682842-20682864 GCCTGGAGGCCCGCCCTCTCCGG + Intergenic
1122079535 14:99257326-99257348 GCCGGGGCTCCCCCTTTCTGAGG - Intronic
1124244893 15:28060259-28060281 GCCTGCACGCCCTCTAGCTGGGG + Intronic
1125297676 15:38220810-38220832 GCCTGGAAGCCAGCTCTCTGGGG - Intergenic
1126422546 15:48490050-48490072 GCCTGGAAACCTGCTTCCTGAGG - Exonic
1126550438 15:49923110-49923132 CCCTAGACGCCCACATTCTGTGG + Intronic
1128996714 15:72302614-72302636 GCATGGAGGCCCCCTTTGTGCGG + Intronic
1133336245 16:5008504-5008526 GCCTGGGCGCCTGCTTGGTGTGG - Exonic
1136533917 16:30888021-30888043 GGCTGGACGCCTGGGTTCTGTGG - Intronic
1138820791 16:60256602-60256624 GCCTGGACCCCATCTTACTGGGG - Intergenic
1143344242 17:6238351-6238373 TCCTGGATGCTTGCTTTCTGGGG + Intergenic
1146000104 17:29125840-29125862 CCCTGGCCGCCCTCTTCCTGAGG - Intronic
1151994150 17:77598034-77598056 GCCTGGCCGCCGCCTCTCTGGGG + Intergenic
1152559366 17:81070338-81070360 GCCTGGACGTCCGCTCAGTGTGG - Intronic
1156763796 18:40626502-40626524 ACCTGGACACCAGCTTTCTCTGG + Intergenic
1161361027 19:3849868-3849890 GGCTGGACGTCCGCTGGCTGAGG + Intronic
1163747267 19:19055908-19055930 ACCTGCACGCCGGCCTTCTGCGG - Exonic
1166539502 19:43595898-43595920 GACTGGAAGCCAGATTTCTGAGG - Intronic
1167106090 19:47430549-47430571 TCCCGGTCGCCTGCTTTCTGCGG + Intronic
1168284355 19:55323007-55323029 GCCTGGACTCCTGCATTTTGGGG - Intronic
1168694067 19:58395292-58395314 GCCTGCACACCCAGTTTCTGTGG + Intergenic
929174176 2:38960257-38960279 GCCTGGACATCTGCTTCCTGCGG + Exonic
933273287 2:80256619-80256641 GGCTGGATGACCGCTTTCTAGGG - Intronic
933604924 2:84372569-84372591 TCCTGGAAGCCCACATTCTGAGG + Intergenic
938939445 2:136156423-136156445 GCCTGGATGCCATCTTTCTTGGG - Intergenic
945063302 2:205926871-205926893 GCCTGGATGCCTATTTTCTGGGG + Intergenic
945803424 2:214461891-214461913 GCCTAAAAGCCAGCTTTCTGAGG - Intronic
1171858302 20:30370759-30370781 GCCTGTACGCCCAGCTTCTGGGG - Intergenic
1173423930 20:42926805-42926827 GCCTGGCTGCCCCCTTGCTGAGG - Intronic
1173572028 20:44083510-44083532 GGCTGGCTGCCCGCCTTCTGGGG + Intergenic
1175408768 20:58752449-58752471 GTGTGGACGTCCGCTTGCTGTGG - Intergenic
1177076943 21:16588116-16588138 GCCTGGCTGCCTGCTTCCTGAGG + Intergenic
1177816952 21:25988053-25988075 GCCTGGTCGCTCACTTACTGCGG - Intronic
1179801728 21:43814425-43814447 GCCTGGAAGCCCGTTTCCTTGGG - Intergenic
1181283591 22:21736411-21736433 GCACGGACGACCGCATTCTGGGG - Intergenic
1184786401 22:46674050-46674072 GCCTGCACGCCTGCTGTCAGGGG - Intronic
1185208576 22:49554063-49554085 CCATGGACGCCGGCCTTCTGGGG + Intronic
950183760 3:10932761-10932783 GTCTGCACGCCAGCTTTCAGAGG - Intronic
963432915 3:145232403-145232425 GCCACCACGCCCGGTTTCTGTGG - Intergenic
963734817 3:149007973-149007995 GCCATGATCCCCGCTTTCTGAGG + Intronic
969717365 4:8874202-8874224 CTCTGGGCGCCCGCTGTCTGGGG + Intergenic
976614325 4:87060712-87060734 GCCTGTACTCCCGGCTTCTGGGG + Intronic
987150479 5:15034552-15034574 GGCTGGAGGGGCGCTTTCTGTGG + Intergenic
1000207855 5:159079447-159079469 GCCTGGATGCCCGTATTATGTGG - Intronic
1010133264 6:72520923-72520945 GCCTGGACCCTCCTTTTCTGTGG - Intergenic
1010209957 6:73354589-73354611 GCCTGGACGCCCGCTTTCCGAGG - Intergenic
1014551204 6:122790832-122790854 GCCTGAATGAGCGCTTTCTGGGG + Intronic
1019656512 7:2198922-2198944 GACTGGTCGCCGGCTTCCTGTGG - Intronic
1024668432 7:51567858-51567880 GCCTGGACGTGCGCACTCTGGGG + Intergenic
1028709458 7:93890764-93890786 GCCCGGGTGCCCGCTTTATGCGG + Exonic
1032077774 7:128844215-128844237 GCCTGGCAGCCCGTTTGCTGTGG + Exonic
1045385580 8:101668326-101668348 ACCTGGAGGCCCGCTCTCTAAGG + Exonic
1046965684 8:120163079-120163101 GCCTGGACTGGCGCCTTCTGGGG - Intronic
1053786590 9:41656885-41656907 GCCTGGACTCTGGATTTCTGGGG - Intergenic
1054450278 9:65400106-65400128 GCCTGGACTCTGGATTTCTGGGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060528342 9:124333046-124333068 GGCAGGACCCCCGCTGTCTGTGG + Intronic
1061377473 9:130234956-130234978 GGCTGGAGGCCTGCTTGCTGAGG - Exonic
1186341553 X:8651155-8651177 GGCTGGAGCCCTGCTTTCTGTGG - Intronic
1186747421 X:12583872-12583894 GCCTGGACGCCCGCTTTCTGAGG - Intronic
1199872483 X:151912298-151912320 GCCTGGACCCCTGTTCTCTGCGG - Intergenic