ID: 1186748637

View in Genome Browser
Species Human (GRCh38)
Location X:12597789-12597811
Sequence AAATTTTACTATAGGTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186748635_1186748637 14 Left 1186748635 X:12597752-12597774 CCATCTAGCTCTCAAATTTGGTG 0: 1
1: 0
2: 3
3: 29
4: 201
Right 1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 285
1186748632_1186748637 22 Left 1186748632 X:12597744-12597766 CCAAAGTCCCATCTAGCTCTCAA 0: 1
1: 0
2: 3
3: 20
4: 212
Right 1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 285
1186748634_1186748637 15 Left 1186748634 X:12597751-12597773 CCCATCTAGCTCTCAAATTTGGT 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186748637 Original CRISPR AAATTTTACTATAGGTCTGT TGG Intronic
906388171 1:45390104-45390126 AAATTTAACTATATATTTGTAGG - Intronic
907032442 1:51185772-51185794 AAACTTTAATGTAGGTCTGGAGG - Intergenic
907170737 1:52461564-52461586 AAATTTTACTATAGGCACTTTGG + Exonic
909028603 1:70512164-70512186 AAATTTTATTATAACTGTGTTGG + Intergenic
912172622 1:107118948-107118970 AAACTTTATGATAGGTATGTAGG + Intergenic
912221664 1:107684754-107684776 AAATTTTGCTCTAGATTTGTTGG + Intronic
912481228 1:109983660-109983682 AACTTTTAATAAAGGTTTGTGGG - Intergenic
914459598 1:147870961-147870983 CAATTTTACTTTATGTTTGTAGG - Intergenic
915830100 1:159120264-159120286 ACCTTTTACTATACGTCTTTTGG - Intronic
916886790 1:169077146-169077168 TAATTTTTCTTTTGGTCTGTTGG - Intergenic
917496393 1:175544113-175544135 GAATTTTACTTCAGGTATGTGGG + Intronic
917593901 1:176507886-176507908 AACTTTTACTTTAGATATGTTGG - Intronic
918000491 1:180489988-180490010 AAATTTTACTAAAGTACTGAAGG + Intronic
918974465 1:191464104-191464126 AACTTTTATTTTAGGTTTGTGGG - Intergenic
919588176 1:199465162-199465184 ATAGTTTACTTTAGGTCTCTGGG - Intergenic
920802682 1:209204199-209204221 ATATTTTATTATAGGGCTGGAGG + Intergenic
921532003 1:216295276-216295298 AAATTATACAATAGGTTAGTAGG + Intronic
924242257 1:242052625-242052647 AAAGTTTACTGTAGGTGTATGGG - Intergenic
1063755638 10:9004427-9004449 AAGTTTTATTAGAGGTGTGTAGG - Intergenic
1064464879 10:15569026-15569048 AAGTTTTCCTAGAGATCTGTGGG + Intronic
1064872788 10:19958405-19958427 ATAATTTATTTTAGGTCTGTAGG - Intronic
1065776420 10:29124597-29124619 CAATTTTACTACAGGTCTAAAGG - Intergenic
1066204436 10:33173728-33173750 AATTTCTACTATGGGTCTGGTGG - Intergenic
1067156718 10:43787947-43787969 AAATTTGAATTCAGGTCTGTAGG + Intergenic
1069208225 10:65720359-65720381 AAACTTTATCATAGGTTTGTAGG - Intergenic
1071902350 10:90134880-90134902 AAATTTTAATATAGGACTACTGG - Intergenic
1072027277 10:91473424-91473446 AAGTTTAAGTATACGTCTGTTGG - Intronic
1073799864 10:107029608-107029630 AAGTTTCAATATATGTCTGTTGG - Intronic
1073832693 10:107404191-107404213 AAAATGTACTATAGGTATGAGGG - Intergenic
1079027219 11:16959090-16959112 AACTTTTATTTTAGGTTTGTGGG + Intronic
1079511351 11:21215000-21215022 ATATTGTACTATAGGTATATAGG + Intronic
1079551514 11:21704665-21704687 CAATTTTACTATAGGCTTTTTGG + Intergenic
1080141788 11:28930521-28930543 AAATTTTTCTATAACTCGGTGGG - Intergenic
1081066627 11:38549373-38549395 AAATTTTAAAATATGACTGTAGG - Intergenic
1082173834 11:49038810-49038832 ATATTTTACTTTATGTATGTTGG - Intergenic
1083109260 11:60388899-60388921 AAACCTATCTATAGGTCTGTGGG - Intronic
1085465207 11:76718549-76718571 AGACTTTATTATAGGTATGTAGG + Intergenic
1086013819 11:82139422-82139444 AAGTTTTTTTATATGTCTGTTGG + Intergenic
1086691934 11:89797272-89797294 ATATTTTACTTTATGTATGTTGG + Intergenic
1086713867 11:90042386-90042408 ATATTTTACTTTATGTATGTTGG - Intergenic
1087359408 11:97138865-97138887 AACTTTTATTTTAGGTCTGGGGG + Intergenic
1087488255 11:98787299-98787321 AAATTTTATTTTAGGTTTGTGGG + Intergenic
1087888257 11:103505668-103505690 AAATTTTTCTCTCGTTCTGTAGG - Intergenic
1088377410 11:109158069-109158091 AAAGTTAACTAAAGGTTTGTGGG - Intergenic
1088966805 11:114731179-114731201 AAATATTCCGATAGGTATGTTGG - Intergenic
1092889819 12:12958843-12958865 AACTTTTATTTTAGGTTTGTGGG + Intergenic
1093275086 12:17116191-17116213 AACTTTTATTTTAGGTTTGTGGG - Intergenic
1094785010 12:33838205-33838227 AGCTTTTTCCATAGGTCTGTTGG - Intergenic
1098093982 12:66935179-66935201 AAATTTTATTATAGGAATGCTGG - Intergenic
1098967052 12:76801820-76801842 AATTATTACTTTATGTCTGTTGG - Intronic
1099448576 12:82781324-82781346 AAAATGTACTACAGGACTGTTGG - Intronic
1099647284 12:85374581-85374603 AAATTTTATTAAAAGTGTGTAGG - Intergenic
1100898968 12:99216638-99216660 AAATCTTAGTAGAGATCTGTGGG + Intronic
1101456955 12:104843084-104843106 ATATTTTTCTATAGTTCAGTAGG - Intronic
1102851486 12:116250320-116250342 TTATTTTACTGCAGGTCTGTTGG - Intronic
1105723230 13:23136361-23136383 ATATTTTACTCTGGGTCTGAAGG + Intergenic
1106236705 13:27867757-27867779 AAGTTTCACTATAAGTCTTTGGG - Intergenic
1106923731 13:34591203-34591225 AAATTTTTCTATGTGTCTTTAGG - Intergenic
1109619640 13:64886485-64886507 AAATTTTTTTATATATCTGTTGG + Intergenic
1109733029 13:66441302-66441324 AAATTTGTCTATAGCTCTGGTGG - Intronic
1109812969 13:67539786-67539808 AACTTTTACTTTAGGTCCGAGGG - Intergenic
1109926786 13:69152250-69152272 TAATTTCACTGTATGTCTGTGGG - Intergenic
1110490635 13:76101260-76101282 AACTTTTATTTTAGGTATGTGGG - Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1111724965 13:91995556-91995578 AAATTTTACCACAGTTCTGTGGG - Intronic
1113374411 13:109750894-109750916 AAATTTTAATATAGGAGTGGTGG - Intergenic
1113527078 13:110988353-110988375 TAATTTTAGTAAAGTTCTGTAGG + Intergenic
1113546557 13:111155274-111155296 ATATTTTGCTATAGGTTTCTCGG + Intronic
1114698749 14:24654599-24654621 ATATTTTACTGTATTTCTGTAGG + Intergenic
1114960759 14:27885574-27885596 AAATTTTATCATAGGTATGTAGG - Intergenic
1114980053 14:28151801-28151823 AAATTTTAGTTCAGTTCTGTTGG - Intergenic
1115791562 14:36884738-36884760 GCATTTTTCTATATGTCTGTTGG + Intronic
1115873338 14:37831711-37831733 ACATTTTTTTATAGATCTGTTGG + Intronic
1119437343 14:74605941-74605963 AAACTTTAATATTGGCCTGTAGG - Intronic
1125418992 15:39484967-39484989 AAATTTTTCTCTCAGTCTGTAGG - Intergenic
1126644844 15:50865069-50865091 AAATTTAACTTTAAGTTTGTTGG - Intergenic
1127002503 15:54526261-54526283 AAATTTCACTTCAGTTCTGTAGG + Intronic
1128209232 15:65882212-65882234 AAATCTCACTGTTGGTCTGTAGG + Intronic
1130752776 15:86730485-86730507 ACATTTTATTTTAGGTCCGTGGG + Intronic
1131607466 15:93922487-93922509 AAATTCTATTATAGATATGTTGG - Intergenic
1135429161 16:22367510-22367532 AAATTTTATTCTAGGTATGATGG + Intronic
1135573258 16:23565673-23565695 ACATTTTACTTCAGTTCTGTGGG - Intronic
1136601366 16:31292269-31292291 AACTTTTACTTTAGGTTTGAGGG + Intronic
1138718958 16:59056390-59056412 AAATTCTACTATTGGGCTCTTGG + Intergenic
1140213769 16:72991270-72991292 AAATTTTATCATAGGCATGTAGG + Intronic
1145019837 17:19421060-19421082 AAAATTTATTATAGTTCTGGAGG + Intergenic
1146706420 17:35003804-35003826 AAAGGTTTCTACAGGTCTGTTGG - Intronic
1149418512 17:56485538-56485560 AATTTTTACTTTAAGTATGTTGG + Intronic
1149443354 17:56693847-56693869 AACTTTTATTTTAGGTCTGGGGG + Intergenic
1154029475 18:10740192-10740214 AAATATCACTATAGGTCGATGGG - Intronic
1155065050 18:22261819-22261841 ACATTTTTCTATATGTTTGTTGG + Intergenic
1155136638 18:23001321-23001343 AATTTTTATTTTAGGTTTGTGGG + Intronic
1155808035 18:30196656-30196678 GAATTTTATCATAGGTTTGTTGG + Intergenic
1156136093 18:34040068-34040090 TCAATTTACAATAGGTCTGTTGG + Intronic
1157936478 18:51878722-51878744 ATATTTTAGTATAGCTCTTTAGG + Intergenic
1158156964 18:54436883-54436905 AAATTTGACTTTAGGTATTTTGG + Intergenic
1158338625 18:56440896-56440918 AAATTTTTCCATAGGTTTTTGGG - Intergenic
1158950928 18:62494073-62494095 AACTTTTATCATAGGTATGTAGG + Intergenic
1159732475 18:72046653-72046675 AAATTTTACTTTACATCAGTAGG + Intergenic
1162641254 19:12012029-12012051 AAATTTTGCTCTTGGACTGTTGG + Intergenic
1162700369 19:12510602-12510624 GAATTTTACCTTAGTTCTGTAGG + Intronic
1164876029 19:31690152-31690174 AAATTTTATTAGATGTCTTTTGG + Intergenic
1166530335 19:43539015-43539037 TAATTTTATTATAGTTCTGGAGG - Intergenic
1168470779 19:56638959-56638981 GAATTTTATTATAGGTGTATTGG - Intergenic
926983128 2:18592770-18592792 ATATTGTACTATAGTTTTGTAGG + Intergenic
928624030 2:33121084-33121106 ACATTTTCCTTTAGTTCTGTTGG + Intronic
930233652 2:48868194-48868216 AAATTTTATTTTAGGTTTGGGGG - Intergenic
930470575 2:51806872-51806894 AAAGTTAACTATAAATCTGTGGG + Intergenic
930988772 2:57624924-57624946 AAATTTTTCTATAGGCATTTTGG - Intergenic
932464784 2:71911959-71911981 AAATTTTTCTTTCAGTCTGTTGG - Intergenic
933558091 2:83856798-83856820 AAATTATCTTATAGGTCTTTAGG + Intergenic
935461384 2:103339251-103339273 AATTTATACAACAGGTCTGTTGG + Intergenic
936803984 2:116303237-116303259 ATATTTAACTATAGGATTGTAGG + Intergenic
939043370 2:137219951-137219973 AAATTGTGCTATAGAACTGTAGG + Intronic
939702637 2:145412570-145412592 AAATTTTACAAAAGTTCTATGGG + Intergenic
939727509 2:145741133-145741155 TAATTTTAATAAAGTTCTGTGGG + Intergenic
939929863 2:148219782-148219804 AAATGTTACTATAGCTTTGTAGG - Intronic
941144035 2:161820749-161820771 ACATTTTTCTATATGTCTTTTGG + Intronic
942212225 2:173682626-173682648 AAATTTTATTTTAGGTTTGGCGG + Intergenic
942561171 2:177220670-177220692 AAATTTGAATTCAGGTCTGTAGG - Intronic
945315199 2:208363031-208363053 AACTTTTATTTTAGGTCTGGGGG + Intronic
945502770 2:210598099-210598121 AACTTTTATTTTAGGTCTGGGGG + Intronic
947675026 2:231971181-231971203 AAATTGTACTTTAGGTTTGGAGG + Intronic
1169572099 20:6917561-6917583 AAATATTATTATAGATATGTGGG + Intergenic
1170576285 20:17664039-17664061 AAATTTCATCATAGGTATGTAGG - Intronic
1170713747 20:18814724-18814746 AAACTTTACTATGAGACTGTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173356333 20:42295001-42295023 AAATTTCACTATATATATGTTGG - Intronic
1173556238 20:43968022-43968044 AACTTTTATTATATTTCTGTTGG + Intronic
1174985537 20:55447756-55447778 AAATTTTATTTAAGGGCTGTTGG - Intergenic
1175242485 20:57560035-57560057 AAATTTGACTGAAGGTCTGATGG + Intergenic
1175743745 20:61438888-61438910 AATTTTTACTATTTGTCTGGGGG - Intronic
1177021797 21:15869570-15869592 AAATTTGACTTTAAGTGTGTAGG - Intronic
1177340040 21:19786375-19786397 AAATTATACTAGAGGTCAATGGG + Intergenic
1178662220 21:34517241-34517263 AAATTTTAGTTTAGGTGTTTGGG - Exonic
1178982651 21:37277906-37277928 AAATTTTCCTATACATCAGTGGG + Intergenic
1181366832 22:22383180-22383202 ACATTTTTCTATATGTTTGTTGG + Intergenic
1182964673 22:34509896-34509918 AAAATGTACTATAGGACAGTTGG + Intergenic
1184033193 22:41906584-41906606 CAACTTTACAATTGGTCTGTTGG + Exonic
949509555 3:4756334-4756356 AACTTTTACTTTAGGTTTGAGGG + Intronic
950414250 3:12859493-12859515 AATTTTTTCTTGAGGTCTGTAGG - Intronic
950508086 3:13408284-13408306 AAATTGTGCTTTTGGTCTGTGGG + Intronic
950934595 3:16825691-16825713 AAATTTTACCCTCGGTCTGTGGG - Intronic
951734047 3:25843878-25843900 AAATTTTTCTATAGCACTTTTGG + Intergenic
952019624 3:29001872-29001894 AAATTTTATTTTAGGTTTGGGGG + Intergenic
952685449 3:36142599-36142621 AAACTATACTATAAGCCTGTAGG - Intergenic
956507253 3:69955429-69955451 AAATTATATTATATTTCTGTTGG + Intronic
956569101 3:70673982-70674004 AAATTTTACTCTAAGTGTGATGG - Intergenic
956573526 3:70724948-70724970 TAAGTTCACTATAGGTGTGTGGG + Intergenic
956996252 3:74829460-74829482 TAATTTTACTTTGGGTCTGAGGG - Intergenic
957213357 3:77289903-77289925 CAATTTTACTTTATGTCTTTAGG - Intronic
957213370 3:77290009-77290031 CAATTTTACTTTATGTCTTTAGG - Intronic
957213837 3:77294440-77294462 CAATTTTACTTTATGTCTTTAGG - Intronic
957213851 3:77294546-77294568 CAATTTTACTTTATGTCTTTAGG - Intronic
959784273 3:110275268-110275290 TAATTTTACCAAAGGTCTTTTGG + Intergenic
963373192 3:144428161-144428183 AAATTTTTCTCAAGGTCTGGAGG + Intergenic
963445487 3:145401181-145401203 AAATTTTAGAAGAGGACTGTTGG + Intergenic
963616256 3:147542061-147542083 AACTTTTATTTTAGGTTTGTGGG - Intergenic
964366317 3:155954272-155954294 AAATTTTATTTTAGGTTTGGGGG + Intergenic
965843534 3:172935794-172935816 AATTTTCACTATAGGCATGTGGG + Intronic
966469485 3:180272819-180272841 AAATTATAGTAAAGCTCTGTTGG - Intergenic
966598604 3:181751285-181751307 AACTTTTACTTTAGGTTTGGGGG - Intergenic
966670303 3:182518758-182518780 AACTTTAATTATAGGTTTGTTGG + Intergenic
967416688 3:189226711-189226733 AATTTTTTCTATAGTTCTTTCGG - Intronic
967602644 3:191407439-191407461 ATTTCTTACTACAGGTCTGTTGG + Intergenic
968606708 4:1538930-1538952 AAGTTTTACTGTGGGTCTGAAGG - Intergenic
969198835 4:5585378-5585400 AAATTCTACTATTTGTCTTTTGG + Intronic
969851297 4:9959045-9959067 AAATTGTACTATATGTGTATTGG + Intronic
971027560 4:22603530-22603552 TAATTTTACTTTGGGTCTGAGGG - Intergenic
971129656 4:23792714-23792736 AAATTTCAGCATAGATCTGTAGG - Exonic
973064214 4:45767244-45767266 TAATTTTACAATATGCCTGTAGG - Intergenic
973176721 4:47214989-47215011 CAATTTTATAATAGGTTTGTTGG + Intronic
974063957 4:57060407-57060429 AATTTTAACTATGGGTCTGTGGG + Intronic
974515222 4:62898842-62898864 AAATTTTACAATAGATTTTTTGG - Intergenic
975210768 4:71697384-71697406 AAACTTTACTAAATGCCTGTGGG + Intergenic
976154773 4:82130921-82130943 AAATTTGAATTCAGGTCTGTAGG - Intergenic
976358550 4:84149967-84149989 AACTTTTAGTTTAGTTCTGTAGG - Intergenic
977148036 4:93471439-93471461 AAATTCTATAATAGGTCTGAGGG + Intronic
977393614 4:96445621-96445643 AACTTTTATTATAGGTTTGGGGG + Intergenic
977438069 4:97025955-97025977 AAATGTTAATATAGGTACGTAGG - Intergenic
979085090 4:116398296-116398318 ACATATTAATATATGTCTGTTGG + Intergenic
979497702 4:121402789-121402811 TAATTTTATTACAGTTCTGTAGG + Intergenic
979538164 4:121848619-121848641 AAATTTTATCATAGGCATGTAGG + Intronic
980206357 4:129723718-129723740 AACTTTTACTATAGGCTTGCGGG - Intergenic
981383730 4:144102783-144102805 GAATATTACTCTAGGCCTGTGGG - Intergenic
982722820 4:158876914-158876936 AAAGCTTATTATAGGTCTCTTGG + Intronic
982890750 4:160846687-160846709 ATAGTTTAATATAGGTCTTTGGG + Intergenic
983455659 4:167960349-167960371 AAATGTTTCTATAGGCCTCTTGG + Intergenic
983732013 4:171007630-171007652 AAACTTTATCATAGGTATGTAGG + Intergenic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
984529307 4:180896398-180896420 AAATTGTACTACAGAGCTGTAGG - Intergenic
985309720 4:188584106-188584128 AAAAATTACTATAGCACTGTAGG - Intergenic
986945211 5:13009754-13009776 AACTTTTATTTTAGATCTGTGGG - Intergenic
988782056 5:34531219-34531241 AAATTTTATTTTAGGTTTGGGGG - Intergenic
988912789 5:35861720-35861742 AAAGTTTACTAAAGGTCTCAGGG + Intronic
990438916 5:55824172-55824194 ATATTTTACTACAAGTCTTTTGG + Intergenic
991968845 5:72118770-72118792 ATATTTTACTATAACTCTGCTGG - Intronic
993277314 5:85877074-85877096 AAATTTTAGTATAGGAATATTGG - Intergenic
993451697 5:88079006-88079028 AACTTTTAGTTTAGGTTTGTGGG - Intergenic
993620062 5:90157447-90157469 TAATTTTACTCTAGTTTTGTGGG - Intergenic
993936092 5:94004748-94004770 AAATGTTACTAGAGGCTTGTAGG - Intronic
994906356 5:105844958-105844980 ATTTTTTCTTATAGGTCTGTGGG + Intergenic
995250060 5:109982993-109983015 AAAAATGACTATAGCTCTGTAGG - Intergenic
995646887 5:114322814-114322836 AACTTTTATTATAGGTTTGAGGG + Intergenic
999235796 5:150092810-150092832 AAACTTTATCATAGGTATGTAGG - Intronic
999437688 5:151576428-151576450 AAGTTATACTATAGGTTTTTGGG + Intergenic
1000723975 5:164745560-164745582 TAATTTTTCTATAGCTCTGGAGG + Intergenic
1001832519 5:174801395-174801417 CTATTTAACTATAGGTCTATAGG - Intergenic
1002818734 6:702576-702598 AGAGTTGACTATAGGACTGTTGG + Intergenic
1004525694 6:16405364-16405386 AAATTTAAATAAAGGTCTTTAGG - Intronic
1005173495 6:23015634-23015656 GAATTATACTATAATTCTGTAGG + Intergenic
1008306284 6:49905076-49905098 AAATTTTTCTATATCTCTTTGGG - Intergenic
1008323965 6:50154169-50154191 AACTTTTATTTTAGGTCTGGGGG + Intergenic
1009656491 6:66552711-66552733 AACTTTTATTTTAGGTCTGGGGG - Intergenic
1009756088 6:67941977-67941999 AAATTTTTCTCTCGTTCTGTAGG - Intergenic
1012049135 6:94317656-94317678 AAATTTTATTTTAGGTTTGGGGG + Intergenic
1012200049 6:96394724-96394746 GAGTTTTACTATAGGGATGTAGG + Intergenic
1012712006 6:102618362-102618384 AATGTTTCCAATAGGTCTGTGGG + Intergenic
1013754313 6:113443200-113443222 AAACTTTATTGTAGGTATGTAGG + Intergenic
1016746293 6:147583750-147583772 AATTTATGCTCTAGGTCTGTTGG + Intronic
1020397592 7:7734380-7734402 AAATTTTAATTAAGGTCTTTAGG + Intronic
1021019100 7:15574109-15574131 AAATTTTCATATAGTTCTGAGGG - Intergenic
1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG + Intronic
1024924632 7:54599948-54599970 AACTTTAACTATGGGCCTGTAGG - Intergenic
1026434468 7:70383369-70383391 AAATTTTACTATGGGACTTTAGG - Intronic
1027308120 7:76923553-76923575 AGATATTGCTATAGGTCTCTGGG + Intergenic
1028364937 7:90017734-90017756 ATATCTTCCTATAGGTATGTAGG + Intergenic
1028765340 7:94551012-94551034 AAATTTTATCATATGTCTGTAGG + Intronic
1029877405 7:103769062-103769084 AAATTTTATTCAAGGTCAGTTGG - Intronic
1030971344 7:116060846-116060868 AACTTTTATTTTAGGTTTGTGGG - Intronic
1033115823 7:138624189-138624211 AAATTTTACTCCAGCTCTGTAGG - Intronic
1034631706 7:152536051-152536073 AAATTTTAATATAGTACTTTAGG + Intergenic
1036060381 8:5311600-5311622 AATTTTTACTTTAGGTATGAAGG + Intergenic
1037061491 8:14516151-14516173 ACATTTTACTTTAGGTTTGAGGG + Intronic
1037415201 8:18642244-18642266 AAATTTTCCAATAGATCTTTTGG - Intronic
1037573907 8:20182961-20182983 AAAGTTTACTATTGATTTGTTGG - Intronic
1038109460 8:24479435-24479457 AAAATTTACTATAGCTCCCTTGG + Intronic
1038887303 8:31677632-31677654 AAATTTTACTGTGGATTTGTTGG - Intronic
1039638823 8:39195797-39195819 AAAATATACTGTAAGTCTGTAGG - Intronic
1039673594 8:39633720-39633742 AAATTTTACTATAAATAAGTAGG - Intronic
1041473136 8:58233440-58233462 TAATTATACTTTAGCTCTGTTGG + Intergenic
1041978442 8:63826747-63826769 AAATTTTACTTCAAGTCAGTTGG + Intergenic
1042480824 8:69300949-69300971 GAATTTTACTTTGGGGCTGTTGG - Intergenic
1042909238 8:73808104-73808126 ATATTTTACTTTAGGTGTTTGGG - Intronic
1043111044 8:76182886-76182908 AATTTTTATTGTAGGTCTGCTGG + Intergenic
1043127308 8:76415092-76415114 AAACTTTATCATAGGTATGTAGG - Intergenic
1043143696 8:76624192-76624214 ATATTTTGCTAAAGGTCTCTTGG + Intergenic
1043169840 8:76951971-76951993 AATTTTTATTTTAGGTTTGTGGG - Intergenic
1043844222 8:85145543-85145565 CATTTTTACAATAGGTCTGCTGG - Exonic
1044070024 8:87747937-87747959 AAATTGTAATATAGTTCTGTTGG - Intergenic
1044501162 8:92959685-92959707 CAATTTTACTATGGGTTTATTGG - Intronic
1044597397 8:93971643-93971665 AAATTTTAGTACACGTCTTTTGG + Intergenic
1045904108 8:107322585-107322607 AAATTTCACGATAGTTCTGTGGG + Intronic
1046147514 8:110180532-110180554 AAATTTTACTACAGACCTATAGG - Intergenic
1050026893 9:1344184-1344206 ACATTGTACAATAGGTCTCTTGG + Intergenic
1050128099 9:2380390-2380412 AAATTTTACTAAAGATTTGTAGG + Intergenic
1050326925 9:4506917-4506939 ACCTTTTATTATATGTCTGTGGG - Intronic
1052053208 9:23873126-23873148 ACATTTTTTCATAGGTCTGTTGG - Intergenic
1052505004 9:29341842-29341864 ATCTTTTACTGTAGTTCTGTAGG - Intergenic
1052518814 9:29516103-29516125 AACTTTTATTTTAGGTCTGAGGG - Intergenic
1055473535 9:76638420-76638442 TATGTTGACTATAGGTCTGTAGG + Intronic
1056294944 9:85183420-85183442 AACTTTTACTTTAGGTTTGGGGG + Intergenic
1057684961 9:97222959-97222981 AACTGTTACTATAGAACTGTGGG - Intergenic
1058728347 9:107825252-107825274 AAATTTTTCTAAAGCTCTCTTGG - Intergenic
1059505115 9:114791556-114791578 AAATTTTCTTATAGGTCAGGAGG + Intronic
1060146202 9:121254597-121254619 AAATCTTTCTAAAGGTCTTTTGG - Intronic
1185996355 X:4954200-4954222 AAATTTTATTTTAGGTTTGGGGG - Intergenic
1186168086 X:6848362-6848384 TAATTTGAAAATAGGTCTGTGGG + Intergenic
1186252689 X:7685828-7685850 AAATTTTTCTCTCAGTCTGTAGG - Intergenic
1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG + Intronic
1188223356 X:27567214-27567236 AAAGTTTTGTATATGTCTGTTGG + Intergenic
1188283329 X:28297682-28297704 ATATTTTCTTATAGCTCTGTAGG - Intergenic
1188544505 X:31288990-31289012 AAATTTTAGTCTAGGTGTGGCGG + Intronic
1188569917 X:31572119-31572141 AACTTTTATTTTAGGTTTGTGGG - Intronic
1188886381 X:35555599-35555621 ATATTTTTTTATAGGTTTGTTGG - Intergenic
1189450200 X:41122072-41122094 AAATTTTACCAGAGGTTTTTGGG + Intronic
1189833820 X:45001039-45001061 AACTTTTACTATAGCTATCTTGG + Intronic
1189977865 X:46480348-46480370 ACATTTTTCCATATGTCTGTTGG + Intronic
1190036105 X:47025713-47025735 AAGTTTTCCTGTAGATCTGTGGG + Intronic
1191670883 X:63747442-63747464 AAATTTTATTCTAGGACTGTGGG - Intronic
1192083375 X:68069999-68070021 AAATTTTATTCTAGGTATGAAGG + Intronic
1192347568 X:70323637-70323659 TAATTTTACTATAGGTATAGGGG - Intronic
1192380038 X:70606654-70606676 ACATTTTAATATAGGACTTTGGG + Intronic
1193495775 X:82210813-82210835 AACTTTTACTATAGTTCTTCAGG + Intergenic
1193732880 X:85122662-85122684 AACTTTTATTTTAGGTTTGTGGG + Intergenic
1193846278 X:86475074-86475096 AAATTATACTACAGAGCTGTAGG - Intronic
1193994717 X:88351308-88351330 GAATTTTGTTATATGTCTGTTGG - Intergenic
1194456065 X:94105273-94105295 AACTTTTACTTTAGGTTTGGGGG + Intergenic
1194902202 X:99526236-99526258 AAATTATACTATAAGGCTATGGG + Intergenic
1194902796 X:99534990-99535012 AAATTTTACCATAACTATGTAGG - Intergenic
1195484881 X:105392880-105392902 AAATCTTAGTAAATGTCTGTTGG + Intronic
1195535607 X:106005946-106005968 AAATTTGACTATATATGTGTTGG + Intergenic
1196666625 X:118324075-118324097 AAATTTTAATATAAGTATGATGG - Intergenic
1197243768 X:124147371-124147393 AACTTTTTTTATATGTCTGTTGG - Intronic
1197488343 X:127083102-127083124 GTATTTTTCTATAGGTTTGTTGG - Intergenic
1199246298 X:145608714-145608736 AAATTTAACTATAGTTTTGGTGG + Intergenic
1199424799 X:147688712-147688734 AATTTATACTACAGTTCTGTAGG - Intergenic
1200878604 Y:8187331-8187353 CCATTTTACTGTAAGTCTGTTGG + Intergenic
1202072121 Y:21002821-21002843 ATATTTTACAATAGTCCTGTGGG + Intergenic
1202190460 Y:22238086-22238108 CCATTTTACTATAAGTCTTTTGG + Intergenic