ID: 1186750751

View in Genome Browser
Species Human (GRCh38)
Location X:12619432-12619454
Sequence ATGGACAAAAGTGGCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 4, 2: 15, 3: 37, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186750737_1186750751 22 Left 1186750737 X:12619387-12619409 CCCCCACTGGTATCCCCCATAGC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750743_1186750751 8 Left 1186750743 X:12619401-12619423 CCCCATAGCAACTATAATTTGGC 0: 2
1: 1
2: 4
3: 14
4: 96
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750740_1186750751 19 Left 1186750740 X:12619390-12619412 CCACTGGTATCCCCCATAGCAAC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750744_1186750751 7 Left 1186750744 X:12619402-12619424 CCCATAGCAACTATAATTTGGCA 0: 1
1: 1
2: 2
3: 18
4: 136
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750745_1186750751 6 Left 1186750745 X:12619403-12619425 CCATAGCAACTATAATTTGGCAG 0: 1
1: 1
2: 5
3: 15
4: 109
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750738_1186750751 21 Left 1186750738 X:12619388-12619410 CCCCACTGGTATCCCCCATAGCA 0: 1
1: 0
2: 2
3: 19
4: 160
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750739_1186750751 20 Left 1186750739 X:12619389-12619411 CCCACTGGTATCCCCCATAGCAA 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229
1186750741_1186750751 9 Left 1186750741 X:12619400-12619422 CCCCCATAGCAACTATAATTTGG 0: 1
1: 1
2: 3
3: 13
4: 114
Right 1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG 0: 1
1: 4
2: 15
3: 37
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186750751 Original CRISPR ATGGACAAAAGTGGCTTTGT GGG Intronic
902912223 1:19608220-19608242 ATGGACAAAAGTGTCATTGAAGG - Intronic
903981685 1:27193261-27193283 ATGGAGAAAACTGGCTTAATTGG - Intergenic
904441767 1:30536379-30536401 AAGGACATGAGTGGCATTGTGGG + Intergenic
909087813 1:71188163-71188185 AGGTTCAAAAGTTGCTTTGTAGG - Intergenic
909794758 1:79719431-79719453 GTGAAAAAAAGTGGTTTTGTGGG - Intergenic
910233250 1:85008248-85008270 AGGGGAAAAAGTGGTTTTGTGGG - Intronic
911396119 1:97312938-97312960 ATGAAAGAAAGTGGCATTGTAGG + Intronic
915776914 1:158500504-158500526 ATAAAGAAAAGTGGTTTTGTTGG + Intergenic
916599141 1:166275764-166275786 ATGGACCGAGGTGGCTTTGGTGG - Intergenic
917782331 1:178411665-178411687 ATGGACAAAAGTGTCACTGAAGG - Intronic
918010206 1:180579905-180579927 AAGGACAAATGTGGATTTATAGG - Intergenic
918613086 1:186513912-186513934 ATGGTCAAAAGTGTCTCTGCAGG - Intergenic
919305206 1:195823525-195823547 ATGGACTAAAGTGTCATTGTGGG - Intergenic
920279592 1:204832636-204832658 ATGAACAAAAATGGGTGTGTGGG - Intronic
920530193 1:206696141-206696163 ATGGACAAAAGTGTCATTGAAGG + Intronic
922096138 1:222444622-222444644 TTGGACAAAAGTGTCTGTGGTGG - Intergenic
1063774998 10:9252860-9252882 AGGCACAGAATTGGCTTTGTGGG - Intergenic
1063845876 10:10126407-10126429 ATGGGCTAAAGTGGATGTGTGGG + Intergenic
1064189243 10:13191076-13191098 ATGGCCTCAAGTGGATTTGTAGG + Intronic
1065189087 10:23194439-23194461 ACAGACAAAAGTTGCTGTGTAGG - Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066518940 10:36194747-36194769 AGGGACACAAGAGGCTTAGTAGG + Intergenic
1066550278 10:36548263-36548285 CAGGACAAAAGAGGGTTTGTGGG - Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068193022 10:53678286-53678308 GTAGACAAAAGTGGCTGTGCTGG + Intergenic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1069281949 10:66665645-66665667 ATGGACAAATGTGGCCTTACTGG - Intronic
1069497184 10:68916053-68916075 ATGGTAAAAAGAAGCTTTGTGGG + Intronic
1069747891 10:70727337-70727359 GTGGACAATGGTTGCTTTGTGGG + Intronic
1071457340 10:85861188-85861210 AGGGACCCAAGGGGCTTTGTGGG - Intronic
1071989933 10:91091845-91091867 ATGTACATATGTGCCTTTGTGGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1076148848 10:128146910-128146932 GTGGAGAAAGGTGGGTTTGTGGG + Intergenic
1077795669 11:5489136-5489158 ATAGGCAGAATTGGCTTTGTTGG + Exonic
1079876292 11:25861268-25861290 ATGCCCAGAAGTGGGTTTGTTGG + Intergenic
1081630431 11:44685804-44685826 CTGGACATATGTGGTTTTGTCGG + Intergenic
1081850601 11:46272707-46272729 GAGGAAACAAGTGGCTTTGTTGG + Intergenic
1082714962 11:56600879-56600901 TTGGACAGAAATGGCTTTGGAGG + Intergenic
1083643190 11:64156692-64156714 CTGGAGAGAAGGGGCTTTGTGGG - Intronic
1086176730 11:83900426-83900448 AGAGAAAAAAGTGGTTTTGTGGG + Intronic
1087132901 11:94684261-94684283 ACGGACAAAAGTCTCCTTGTGGG + Intergenic
1087245910 11:95836527-95836549 ATGTACAAGAGTGGAATTGTTGG - Intronic
1090071222 11:123546225-123546247 ATGGACAGAAGTGTCTGTGGGGG + Intronic
1091799613 12:3316559-3316581 TAGGACAAAAGTGGCTATGGGGG + Intergenic
1093733885 12:22596541-22596563 ATGGACACATGTGACTTTGAAGG + Intergenic
1094243739 12:28261556-28261578 ATGGTCATAAGTGGCTTTTGAGG + Intronic
1095389219 12:41686075-41686097 ATGACAATAAGTGGCTTTGTAGG + Intergenic
1095413221 12:41946590-41946612 AGGGGGAAAAATGGCTTTGTGGG - Intergenic
1095539168 12:43288237-43288259 AAGGACTAAAATGGCTGTGTAGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1098504869 12:71237737-71237759 ATGGACAAAAGAGGGCTTGGGGG - Intronic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098730578 12:74032118-74032140 ATTCAAAAAAGTGGCTTTTTGGG - Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1099644874 12:85340160-85340182 ATGAAAAAAAGTGACTTTTTGGG + Intergenic
1101527784 12:105547510-105547532 ATGGACCATGGTGTCTTTGTTGG + Intergenic
1102230905 12:111261568-111261590 ATGGACAAGAGTGAGTTTCTGGG - Intronic
1103996450 12:124833510-124833532 CTCAGCAAAAGTGGCTTTGTAGG - Intronic
1105399684 13:20078637-20078659 ATGGATAAAAAATGCTTTGTAGG - Intronic
1108405459 13:50096448-50096470 ATGGCTTAAAGTGGTTTTGTGGG - Intronic
1110787550 13:79548356-79548378 ATGGACAGTATTGGCTTTGGTGG + Exonic
1111733562 13:92108074-92108096 ATGGAACAAAGTGGCTGGGTTGG - Intronic
1112142775 13:96664031-96664053 ATGGTCTAAAATTGCTTTGTGGG + Intronic
1113128217 13:107004452-107004474 ATGGACAGAAGTAGCTGTATTGG + Intergenic
1114305309 14:21418031-21418053 ATATACAAACGTGACTTTGTAGG - Intronic
1114794921 14:25702826-25702848 ATGGGAAGAAGTGGCTTTCTAGG - Intergenic
1115529138 14:34310758-34310780 ATGGAGAAAATTGGGTTTGGAGG - Intronic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1118406358 14:65427799-65427821 ATGGACAAGAATGGGTTTTTTGG - Intronic
1120708106 14:87765577-87765599 ATCTACAAAAGAGGATTTGTTGG + Intergenic
1122247026 14:100410517-100410539 ATGGAGAAAAATGGCTGGGTGGG + Intronic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1125390475 15:39186922-39186944 ATTTACAAAAGTGGGATTGTAGG - Intergenic
1127722483 15:61716574-61716596 ATGGACAAAGGCAGCTGTGTTGG - Intergenic
1127948005 15:63774804-63774826 ATGGATAGAAATGGCTTTGGGGG - Exonic
1127951734 15:63814423-63814445 ATAGACAACATTAGCTTTGTGGG + Intronic
1128591904 15:68905503-68905525 GGGGACAACAGTGGCTTTCTGGG - Intronic
1129462821 15:75708379-75708401 AGAGACAAAAGTGGCTTCATTGG + Intronic
1129722053 15:77883037-77883059 AGAGACAAAAGTGGCTTCATTGG - Intergenic
1130625043 15:85505704-85505726 ATTTATAAAAATGGCTTTGTTGG + Intronic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1134233961 16:12451076-12451098 AAGGACAAAAGTGGCTACTTTGG - Intronic
1134512355 16:14858792-14858814 ATGGAGTAGAGTGGCTTTGAAGG + Intronic
1134622493 16:15700049-15700071 AGGGACAAAAGGGGCTCTCTGGG + Intronic
1134699992 16:16257292-16257314 ATGGAGTAGAGTGGCTTTGAAGG + Intronic
1134971833 16:18537367-18537389 ATGGAGTAGAGTGGCTTTGAAGG - Intronic
1135541371 16:23332769-23332791 GTGTAGAAAAGTGGCCTTGTTGG + Intronic
1138238913 16:55410791-55410813 ATAGACAAAATTGGCTTTTCAGG - Intronic
1138905288 16:61324123-61324145 ATTGCCAAAAGTGGCTTATTTGG - Intergenic
1139953189 16:70681667-70681689 GTGGAGAAAGGTGGCTCTGTTGG - Intronic
1142330273 16:89447635-89447657 AGGGCCAAAGGTGGCTGTGTAGG - Intronic
1142525710 17:539088-539110 ATGGACATGATTGGCTTTGGGGG - Intronic
1144726904 17:17506749-17506771 GTGGACCAAACTGGCTTTGGGGG - Intronic
1145975053 17:28979035-28979057 CTGGACAGGAGTGGCTTTGGGGG + Intronic
1146255160 17:31388005-31388027 ATGGACAAATATGGCATGGTAGG - Intergenic
1146782451 17:35687044-35687066 GTGAACGAAATTGGCTTTGTGGG - Intronic
1147481038 17:40762834-40762856 ACAGGCAAAAGTGCCTTTGTAGG - Intergenic
1147517334 17:41133017-41133039 ATGGATAAAAATTGCTTTATAGG + Intergenic
1148987252 17:51633776-51633798 ATGGAAAAAAGGGACTCTGTGGG - Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1153294930 18:3536092-3536114 CTGGAAAAATGTGGCTTTGCAGG - Intronic
1157244618 18:46042230-46042252 GTGGACAAATGAGGCTTTGGTGG - Intronic
1157259765 18:46167824-46167846 GTGGAGAGAAGTGACTTTGTGGG - Intergenic
1159125552 18:64220140-64220162 ATGTTCAAAAATGGCTTTGGGGG + Intergenic
1159460871 18:68721321-68721343 AGGGACAAGGGTGGTTTTGTGGG - Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159765192 18:72480701-72480723 AAGGAAAAAAGTGGCTTCTTGGG + Intergenic
1159843037 18:73423068-73423090 TTGTACAAAAGTGTCTTTTTAGG + Intergenic
1160971951 19:1773223-1773245 ATGGAGAAAAATGGTTTGGTGGG - Intronic
1163374933 19:16924241-16924263 ATGAACACAAGTGGGTTTGGGGG + Intronic
1166205696 19:41267332-41267354 CTGGGGAAAAGAGGCTTTGTGGG + Intronic
1167869170 19:52353359-52353381 ATGGACAAAAGTGTATTTATAGG + Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
1168590668 19:57632032-57632054 ATGAACAAAACTGACTTTGCAGG + Intronic
925105901 2:1290852-1290874 ATACACAAAAGTGGGATTGTTGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
926775724 2:16420634-16420656 TTGGACAAGAGTGGCATTGGTGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930104717 2:47630935-47630957 ATGGACAAAAAAGGTTTAGTGGG + Intergenic
931110023 2:59100385-59100407 ATGGTGAAAACTGGATTTGTTGG + Intergenic
931148626 2:59547638-59547660 ATGGAAAAAAGTGGCTTGCTAGG + Intergenic
931635208 2:64334345-64334367 ATGGACAGAAGAGGCTTGGGTGG - Intergenic
933350583 2:81147304-81147326 ATGTACAAAAGGGTCTTCGTGGG - Intergenic
933463558 2:82621137-82621159 CTGTCCAAAATTGGCTTTGTTGG - Intergenic
933994057 2:87654996-87655018 ATGGACAAATGTGTCATTGAAGG - Intergenic
934168724 2:89321229-89321251 AAAGAGAAAAGTGGCTTTGATGG - Intergenic
934198566 2:89861354-89861376 AAAGAGAAAAGTGGCTTTGATGG + Intergenic
935618746 2:105110885-105110907 GAGGACAAAAGTGGCTCTGAAGG + Intergenic
935839132 2:107089863-107089885 ATTGACAAAAGTTGTATTGTTGG + Intergenic
936299807 2:111295918-111295940 ATGGACAAATGTGTCATTGAAGG + Intergenic
937429165 2:121824322-121824344 AGGGACAAATGGGGATTTGTAGG + Intergenic
938680252 2:133682299-133682321 AAGGTAAAATGTGGCTTTGTAGG + Intergenic
939166275 2:138644496-138644518 AGGGACTAATGTGGCTTAGTGGG + Intergenic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
941547905 2:166876914-166876936 ATGGAGAAGAGTGGCCATGTGGG + Intergenic
942519738 2:176790986-176791008 ATGCACAAGAGTGGCCATGTTGG + Intergenic
943348388 2:186769114-186769136 AAAGGCAAAAGTGGCTTTGTGGG + Intergenic
943595974 2:189856975-189856997 GTAGACAAAAGAGGCTTTGATGG + Intronic
944356827 2:198800022-198800044 TTGGATAAAAGTGGGATTGTTGG + Intergenic
945896093 2:215483147-215483169 ATGTAAAATAGTGGCTTTGAAGG + Intergenic
946787578 2:223263727-223263749 ATGGACAAAGATGGCAGTGTGGG - Intergenic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169721055 20:8676826-8676848 AGGGAAAAAAGTAACTTTGTAGG + Intronic
1169884121 20:10378882-10378904 TATGACAAAAGTGGCTTTGCAGG + Intergenic
1173412720 20:42828564-42828586 AGGAAGAAAAATGGCTTTGTGGG + Intronic
1175228948 20:57461403-57461425 CTGAACGAAGGTGGCTTTGTGGG + Intergenic
1176980923 21:15380055-15380077 TAAGACAAAAGTGGCTTTGTAGG + Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1182293505 22:29299733-29299755 ATGGACCGAGGTGGCTTTGGTGG + Exonic
1183783169 22:40011881-40011903 ACGGCCAAGAGTGGCTTTGCTGG + Intronic
949575911 3:5339133-5339155 ATGTACAGGAGTGGCTTTGCTGG - Intergenic
951698746 3:25472936-25472958 ATGGCAAGAACTGGCTTTGTAGG - Intronic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
956512039 3:70004908-70004930 ATGAAAAAAAGTGGCTAAGTGGG - Intergenic
959816951 3:110684824-110684846 AAGGACAAAACTGACTTTTTCGG - Intergenic
960331762 3:116368347-116368369 ATTAACAAAAGTGGTTTTGGGGG - Intronic
961935235 3:130575857-130575879 TTAGACAAAGGTGGCTTGGTTGG - Intronic
962871100 3:139493860-139493882 ATGTACAAAGCTGGCTTTGCTGG + Intergenic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
965823650 3:172709563-172709585 AGAGACAAAAGGGGCTTTGGAGG + Intronic
966497075 3:180593281-180593303 ATGGACGTATGGGGCTTTGTAGG - Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
970893896 4:21079181-21079203 GTTGTCAAAAGTGGCCTTGTTGG - Intronic
971478877 4:27096817-27096839 CTGGACAGAAGTGGCATTCTTGG + Intergenic
971735476 4:30443893-30443915 ATGAACAAGAGTAGTTTTGTGGG - Intergenic
972512917 4:39786338-39786360 AAGGATAAAAGTGCCTATGTGGG + Intergenic
972756985 4:42057568-42057590 AGGAAGAAAAGTGGTTTTGTGGG - Intronic
973235515 4:47898990-47899012 GTGGACAGAAGTTGCTTTGTGGG - Exonic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
979869142 4:125794704-125794726 ATGGGCAAAATTGGCTTGGTTGG + Intergenic
980626611 4:135381436-135381458 AGGGACTAAACTGCCTTTGTAGG + Intergenic
980813180 4:137910276-137910298 GTGGAGAAAAGTGGCTTAGTTGG - Intergenic
980851034 4:138381746-138381768 ATGGACCAAAGTGGCTTCCCAGG - Intergenic
982166009 4:152614206-152614228 ATGGACAAAGGTGTCATTGAAGG + Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
984136736 4:175950560-175950582 GTGGAAAAAAGTAGCTTTGGGGG + Intronic
985992825 5:3577467-3577489 ATGAACAAAAGAGGCTTAATTGG - Intergenic
986135460 5:4973541-4973563 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986135470 5:4973607-4973629 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986747172 5:10754871-10754893 ATGGGGAAAAGTGACTTTGGTGG + Intronic
988035049 5:25817129-25817151 CTGGACAAAAAGGGCTTTCTGGG + Intergenic
989310324 5:40009213-40009235 ATGGATAAAAGTACCATTGTGGG - Intergenic
991291543 5:65037728-65037750 ATGGAGAAAACTGGCTTGGTTGG - Intergenic
991520643 5:67493661-67493683 ATGGTAAAACGTGGCTTTCTTGG - Intergenic
992190005 5:74282781-74282803 TAGGACCAAAGTGGCTTTATGGG + Intergenic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
995852684 5:116562665-116562687 ATGGACAAAAGTGTCATTGAAGG - Intronic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
997421365 5:133769520-133769542 ATGGACCAGAGTAGCTTTATGGG - Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
998454184 5:142258182-142258204 ATGGAAAAAAGTGGATGGGTTGG - Intergenic
999294140 5:150447605-150447627 ATGGACAAAAGTGTCATTGAAGG + Exonic
999879879 5:155850526-155850548 ATGATCAAAAGTGACATTGTGGG + Intergenic
1001947395 5:175791255-175791277 ATAGAGAAAAGTGGCTTATTTGG - Intergenic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003703248 6:8494367-8494389 ATGCAGAAAAGTGAATTTGTGGG - Intergenic
1004457471 6:15804299-15804321 ATTGACAAATGTGGCCTTGGAGG + Intergenic
1005529457 6:26688232-26688254 ATATACAAAAGTGGTTTTCTGGG - Intergenic
1005541339 6:26813414-26813436 ATATACAAAAGTGGTTTTCTGGG + Intergenic
1005839187 6:29730043-29730065 ATGCCCAAAAGTGGAATTGTTGG - Intronic
1005876685 6:30015906-30015928 ATGCCCAAAAGTGGAATTGTTGG - Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1007536613 6:42596836-42596858 ATGGAGAGAAATGGCTTAGTAGG + Intronic
1009012142 6:57855478-57855500 ATATACAAAAGTGGTTTTCTGGG + Intergenic
1010464990 6:76157296-76157318 ATGGACAAAGGTGACTTGGGGGG - Intergenic
1011411246 6:87068907-87068929 ATGGACAGATGTGACTTTGAAGG - Intergenic
1011781912 6:90799250-90799272 ATAAAGAAAAGTGGTTTTGTTGG + Intergenic
1012380305 6:98612923-98612945 CAGGACAAAACTGGCTTTGCTGG - Intergenic
1014029334 6:116682454-116682476 CTGTACAAAAGTGGTTTTCTTGG + Intronic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1019645954 7:2129055-2129077 GAGGACAAAATTGGGTTTGTGGG + Intronic
1020840254 7:13208807-13208829 AAAGACAAAAGTGCCTTTCTGGG - Intergenic
1022837986 7:34135200-34135222 ATGAACAAAAATGGTTTGGTAGG + Intronic
1023294273 7:38698957-38698979 ATGGAACAAAGTGGATTTGGTGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1024810344 7:53203608-53203630 ATGTACAGATGTGGATTTGTTGG + Intergenic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1028897428 7:96057955-96057977 ATGGACTGAGGTGTCTTTGTAGG - Intronic
1030430983 7:109448400-109448422 ATGGGCAAAAGTGGGATTGCTGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1033278253 7:139988652-139988674 ATGGTCAAAGGAGGCTTTGGAGG - Intronic
1033611571 7:142968082-142968104 GTGGAGAAAAGTGGCCATGTCGG + Intergenic
1035600042 8:891999-892021 AGGGGCAAAAGGGGCTTTCTCGG - Intergenic
1036344765 8:7953739-7953761 ATGGAAACAAGTGGTTTTGGTGG - Intergenic
1036840106 8:12114506-12114528 ATGGAAACAAGTGGTTTTGGTGG - Exonic
1036861894 8:12360743-12360765 ATGGAAACAAGTGGTTTTGGTGG - Intergenic
1037662883 8:20942210-20942232 TTGGACCAAAGTGCCTTGGTTGG - Intergenic
1037987370 8:23298431-23298453 AAGGAAAAAAGTGTCTTTATTGG + Intronic
1039222220 8:35345128-35345150 ATGGAGAAAAGTGTATTTTTAGG - Intronic
1042417501 8:68540435-68540457 ATTGTCAAAAGAGGATTTGTTGG + Intronic
1042872115 8:73408745-73408767 GAGGACAAAAGTGGCTTCCTTGG - Intergenic
1043508861 8:80930519-80930541 AGGAACCAAAGTAGCTTTGTGGG - Intergenic
1043885008 8:85588855-85588877 AGGGACAAAACTAGCTTTGTGGG - Intergenic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1046017125 8:108618272-108618294 ATGGGCAAAAAGGGTTTTGTTGG + Intronic
1048634497 8:136281220-136281242 ATTTACAAATGTGGCTCTGTTGG - Intergenic
1050113556 9:2241198-2241220 ATCGATAAAAGAGGCTTTGCTGG - Intergenic
1050116390 9:2267869-2267891 ATGGACAACTTTTGCTTTGTGGG + Intergenic
1050601626 9:7258558-7258580 AGGGACAAAGATGGCTTTGCTGG + Intergenic
1050935716 9:11392589-11392611 AAGGAAAAAAATGGTTTTGTGGG + Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052210213 9:25894364-25894386 AAGGAAAAAAATGGTTTTGTGGG - Intergenic
1053597142 9:39574227-39574249 AGGGACTAGACTGGCTTTGTAGG - Intergenic
1055175618 9:73314155-73314177 GAGAAAAAAAGTGGCTTTGTGGG - Intergenic
1055813448 9:80178222-80178244 AGAGAAAAAAGTGGTTTTGTGGG - Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1060437893 9:123610739-123610761 ATGGACAAGAATGGCTCTTTGGG + Intronic
1061681397 9:132244136-132244158 TTGGACAACTGAGGCTTTGTGGG - Exonic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1062434581 9:136541256-136541278 ATTGGAAAAAGTGGTTTTGTTGG - Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1188049665 X:25469184-25469206 ATGGAAAGTAGTGGCTTTGTAGG + Intergenic
1189129210 X:38480758-38480780 ATGGACAAGAATGGCCTTGAAGG - Intronic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190767639 X:53488681-53488703 ATGGACCACAATGGCATTGTGGG + Intergenic
1190774699 X:53543427-53543449 ACAGACAGAAGTGGCTGTGTGGG + Intronic
1190870397 X:54420198-54420220 AGGGCCAGAAGTGGCTTTGTAGG + Intergenic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1196498531 X:116350795-116350817 ATGGGGAAAAATGGTTTTGTGGG + Intergenic
1197327505 X:125111908-125111930 ATGAACAAAAATGGATTTGAGGG + Intergenic
1199200416 X:145081183-145081205 ATGGACAAAAGTGGCTGAGTTGG - Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic