ID: 1186751769

View in Genome Browser
Species Human (GRCh38)
Location X:12628820-12628842
Sequence CTTTATTAGGAGTGTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186751769_1186751771 -7 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG No data
Right 1186751771 X:12628836-12628858 AATAAAGCCATACCTGAGACTGG No data
1186751769_1186751775 15 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG No data
Right 1186751775 X:12628858-12628880 GGCAGTTTATAAAGAAAAAGAGG No data
1186751769_1186751776 23 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG No data
Right 1186751776 X:12628866-12628888 ATAAAGAAAAAGAGGTTTAATGG No data
1186751769_1186751772 -6 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG No data
Right 1186751772 X:12628837-12628859 ATAAAGCCATACCTGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186751769 Original CRISPR CTTTATTAGGAGTGTGAAGA CGG (reversed) Intronic
No off target data available for this crispr