ID: 1186751769

View in Genome Browser
Species Human (GRCh38)
Location X:12628820-12628842
Sequence CTTTATTAGGAGTGTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3756
Summary {0: 1, 1: 2, 2: 136, 3: 1477, 4: 2140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186751769_1186751776 23 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG 0: 1
1: 2
2: 136
3: 1477
4: 2140
Right 1186751776 X:12628866-12628888 ATAAAGAAAAAGAGGTTTAATGG 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
1186751769_1186751772 -6 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG 0: 1
1: 2
2: 136
3: 1477
4: 2140
Right 1186751772 X:12628837-12628859 ATAAAGCCATACCTGAGACTGGG 0: 10
1: 2932
2: 6503
3: 11156
4: 11641
1186751769_1186751775 15 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG 0: 1
1: 2
2: 136
3: 1477
4: 2140
Right 1186751775 X:12628858-12628880 GGCAGTTTATAAAGAAAAAGAGG 0: 4
1: 78
2: 1556
3: 1690
4: 1888
1186751769_1186751771 -7 Left 1186751769 X:12628820-12628842 CCGTCTTCACACTCCTAATAAAG 0: 1
1: 2
2: 136
3: 1477
4: 2140
Right 1186751771 X:12628836-12628858 AATAAAGCCATACCTGAGACTGG 0: 5
1: 1146
2: 3819
3: 7464
4: 11270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186751769 Original CRISPR CTTTATTAGGAGTGTGAAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr