ID: 1186753929

View in Genome Browser
Species Human (GRCh38)
Location X:12650012-12650034
Sequence CAGTAGGCCTGGAGGCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186753914_1186753929 30 Left 1186753914 X:12649959-12649981 CCCATCTGCCCCTGCAGAGCTGT 0: 1
1: 0
2: 3
3: 24
4: 250
Right 1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1186753917_1186753929 22 Left 1186753917 X:12649967-12649989 CCCCTGCAGAGCTGTTTGTGGAT 0: 1
1: 1
2: 1
3: 13
4: 189
Right 1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1186753919_1186753929 20 Left 1186753919 X:12649969-12649991 CCTGCAGAGCTGTTTGTGGATGT 0: 1
1: 0
2: 2
3: 16
4: 200
Right 1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1186753918_1186753929 21 Left 1186753918 X:12649968-12649990 CCCTGCAGAGCTGTTTGTGGATG 0: 1
1: 1
2: 1
3: 19
4: 216
Right 1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120
1186753915_1186753929 29 Left 1186753915 X:12649960-12649982 CCATCTGCCCCTGCAGAGCTGTT 0: 1
1: 0
2: 8
3: 36
4: 325
Right 1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186753929 Original CRISPR CAGTAGGCCTGGAGGCACGT GGG Intronic
900487660 1:2931119-2931141 GTGTAGGCCTGGAGGGACCTCGG + Intergenic
900874434 1:5331363-5331385 CAGGAGGCCTGCAGGCACCACGG - Intergenic
901972611 1:12919847-12919869 AAGGAGGCCTGGAGACACCTGGG - Exonic
902012570 1:13281915-13281937 AAGGAGGCCTGGAGACACCTGGG + Exonic
903294050 1:22332473-22332495 CAGTAGGCTTTGAGGAAAGTAGG - Intergenic
903919513 1:26789296-26789318 CAGGAGGCCTGGAGGAAGGGAGG - Intronic
904299320 1:29543911-29543933 AAGTAGGCCTGGAGCAAGGTTGG - Intergenic
905902689 1:41592194-41592216 CAGGAGGCCTGGAGTCACCTTGG + Intronic
909079994 1:71098604-71098626 CAGAATGCCTGGAGGCATTTGGG + Intergenic
913278468 1:117162407-117162429 CAGTAGGCCTGGAGAGTCATAGG - Intronic
915493525 1:156265458-156265480 CAGAAGCCCTGGAGGGACTTGGG + Intronic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
920198428 1:204244749-204244771 CACTAGGGCTGGAGGCCTGTGGG + Intronic
920232813 1:204481763-204481785 CAGAAGGCCTGGGGGCATTTGGG - Intronic
920825834 1:209423648-209423670 CAGAAGGCTTGCAGGCAAGTTGG + Intergenic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
923686029 1:236154427-236154449 CAGTATTCCTGGAGGAACGTGGG + Intronic
1063120861 10:3104969-3104991 CAGGAGGCCTGCAGGGACCTAGG - Intronic
1064063361 10:12158808-12158830 GAGGAGGCCTGGAGGCAGGGTGG - Intronic
1071685349 10:87749150-87749172 CAGTAGGGCTGGAAGCAGTTGGG + Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1078457432 11:11486154-11486176 GAGTAGGCCTGCTGGCACCTGGG + Intronic
1080346166 11:31328169-31328191 AAGTAGCCCTGAAGGCACTTTGG - Exonic
1080600718 11:33818884-33818906 AAGTAGGCCTGGAGGACGGTGGG - Intergenic
1087011440 11:93517768-93517790 CACTTGGCCTGGGGGCAAGTTGG - Intronic
1093114714 12:15195209-15195231 CAGTATTCCTGGAGGCATTTTGG - Intronic
1095944265 12:47745220-47745242 GAGGAGGGCTGGAGGCACCTGGG - Intronic
1103332381 12:120163179-120163201 CAGGACCCGTGGAGGCACGTAGG + Exonic
1103524235 12:121557081-121557103 CAGTACCCCTTGAGGTACGTGGG - Intronic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1104918273 12:132277707-132277729 CAGCCGCCCTGAAGGCACGTAGG + Intronic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113609488 13:111633136-111633158 CAGGAGGCCTGGAGCCACTCTGG - Intronic
1113660611 13:112104511-112104533 CAGTAGGCCACGCGGCGCGTGGG + Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1114539928 14:23447511-23447533 CAGTAGGCCTGGAAGGACCTGGG - Intergenic
1121469174 14:94138743-94138765 CAGGAGGCCTGGAGGGTCTTCGG - Intergenic
1121742851 14:96266255-96266277 AAGTAGGCCCAGAGGCAGGTGGG + Intronic
1122941799 14:104984831-104984853 CAGAAGGCCTGGAAGCCCGGAGG + Intergenic
1123476914 15:20597087-20597109 CTGGAGGCCTGGAGGCACTCAGG + Intergenic
1123641097 15:22403277-22403299 CTGGAGGCCTGGAGGCACTCAGG - Intergenic
1124588840 15:31035835-31035857 CAGAAGACCTGGAGGCAGGACGG + Intronic
1127482405 15:59389828-59389850 TAGTTAGCCTGGATGCACGTGGG + Intronic
1129136316 15:73555391-73555413 CAGGAGGTCTGGAGGCATGAAGG - Intronic
1131797595 15:96035264-96035286 CAGTGGGCCATGAGGCACCTGGG - Intergenic
1131817201 15:96234073-96234095 CAGCAGGCCTGAAGGCACTGGGG - Intergenic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1135228990 16:20687249-20687271 CATCAGACCTGCAGGCACGTAGG + Intronic
1135304030 16:21353762-21353784 CAGCAGGCATGGAGGCCCATTGG + Intergenic
1136300764 16:29332899-29332921 CAGCAGGCATGGAGGCCCATTGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138194985 16:55045377-55045399 CAGAGGGCCTGGAGGTACCTGGG - Intergenic
1139559841 16:67735004-67735026 CCGTAGGCCTGCAGACACCTGGG - Exonic
1141689162 16:85586793-85586815 CAGGGGGCCTGGGGGCACGGAGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142062489 16:88039689-88039711 CAGCAGGCATGGAGGCCCGTTGG + Intronic
1142154737 16:88527827-88527849 AAGGAGGCCTGGAGGCAGGCAGG + Intronic
1143107511 17:4536951-4536973 GTGCAGGCCGGGAGGCACGTGGG + Intronic
1146055282 17:29577824-29577846 CAGTAGGCGTGGGGGCAGCTAGG - Intronic
1147843427 17:43388666-43388688 CAGAAGGCCTGGAGGAGCTTCGG + Intergenic
1149457156 17:56797314-56797336 CATTAGGCCTGGGGCCAGGTGGG + Intronic
1152475310 17:80513995-80514017 CAGGTGTCCTGGTGGCACGTGGG + Intergenic
1159172642 18:64791390-64791412 CAGCAGCCCTAGATGCACGTTGG - Intergenic
1160916209 19:1497850-1497872 CAGTAGTGCTGCAGGCACGGGGG - Exonic
1162312717 19:9916599-9916621 CAGGAGGCCTGGAGCCCAGTTGG - Intronic
1162547364 19:11338933-11338955 CAGAAGGCCTGGATGCAGGCGGG + Intronic
1162915822 19:13873886-13873908 CTGTAGGCCTGGGGGCACCCGGG + Intronic
1164386079 19:27771456-27771478 TAGGAGGCCTGGAGTCACGTAGG + Intergenic
1165109890 19:33496176-33496198 CAGAAAGCCAGGAGGCACTTGGG + Intronic
1165798664 19:38534456-38534478 CAGATGGCCTGGAGGCCCATGGG + Intronic
925799275 2:7581632-7581654 CAGTATGTCAGGAGGCACCTTGG - Intergenic
926206167 2:10835512-10835534 CTGGAGGCCTGAAGGCAGGTGGG + Intronic
930416017 2:51092530-51092552 CAGCAGGCCTGGACCCAAGTTGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
937279194 2:120705766-120705788 CAGTAGGCCTGGAAGCATCAGGG - Intergenic
940341656 2:152587965-152587987 AAGTAGGGCTGGAGGCAGATGGG + Intronic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
948644663 2:239396919-239396941 CAGGACGCCTGGAGGCAGGTGGG - Intronic
948667396 2:239545292-239545314 CAGTGGGTCTGGTGTCACGTGGG + Intergenic
948802444 2:240439001-240439023 CAGGAGGCCTGCTGGCACGCGGG - Intronic
948900814 2:240956102-240956124 CAGGAGCCCTGGAGGCACCTGGG - Intronic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1175135335 20:56819178-56819200 CAGTAGGCGTTGTGGCAAGTGGG - Intergenic
1175973977 20:62701233-62701255 GAGAAGGCCTGGAGTCACCTTGG - Intergenic
1176019207 20:62953942-62953964 CGGCAGGCCTGGATGAACGTGGG - Intronic
1182443068 22:30375408-30375430 CAGGTGGCCTGGAGGCACAAAGG - Intronic
1184485590 22:44776878-44776900 CAGTGGGCCTTGAGGCAGGGGGG - Intronic
1184645353 22:45892084-45892106 CGGCAGGCCTGGAGGCACCCCGG - Intergenic
1184656930 22:45946607-45946629 CAGGAGGCCTCCAGGCACGAGGG + Intronic
1184762529 22:46552670-46552692 CAGTGGGCCTGGAGGCTCACGGG + Intergenic
952857281 3:37782665-37782687 CGGGAGGCCTGGAGCCATGTGGG - Intronic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
960653685 3:119979439-119979461 CTGAAGGCTTGGAGGCAGGTAGG - Intronic
961307382 3:125968332-125968354 CAGAAGACCTGGAGACAAGTTGG + Intergenic
962398982 3:135040966-135040988 CAGAAGGCCTGGAGCCCCTTAGG + Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
968771853 4:2512601-2512623 CAGCAGAGCTGGGGGCACGTTGG - Intronic
969606682 4:8205451-8205473 CAAGAGGCCTGGAGGCAGGCAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
977431855 4:96940040-96940062 CAGTCGGCCTGGAGACACACGGG - Intergenic
977898210 4:102387949-102387971 AAGAATGCCTGGAGGCAAGTTGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985579292 5:688629-688651 CAGGCGGCCTGGGGACACGTGGG + Intronic
985594136 5:780688-780710 CAGGCGGCCTGGGGACACGTGGG + Intergenic
987966781 5:24887628-24887650 CAGCAGGCCTGTTGGCAGGTGGG + Intergenic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
989730950 5:44647994-44648016 CAGTAGGTCTGGAGGAGCCTGGG + Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
997362880 5:133306266-133306288 CTGTAGGCCAGCAGGCACGCAGG + Intronic
1003005430 6:2376697-2376719 CAGGTAGCCTGGAGGGACGTGGG + Intergenic
1004221799 6:13753704-13753726 CTGTAGGCCTGGAGGTACCTGGG + Intergenic
1015697304 6:135995149-135995171 CAGAGGGCCTGGAGGCCTGTAGG - Intronic
1015811304 6:137164379-137164401 AAGTAGGCCTGCAGCCACTTAGG - Intronic
1018339062 6:162830352-162830374 CAGTATGGCTGGAGCCATGTGGG - Intronic
1019328145 7:449485-449507 CAGGAGGCCTGTGGGCACCTGGG - Intergenic
1019590668 7:1829143-1829165 CAGGAGTCCTGGAGGCAGGCTGG + Intronic
1022427660 7:30284545-30284567 CAATCGGCCTGGCGGCACGAGGG + Exonic
1028165882 7:87538191-87538213 CAGTTGGCCTGGAGGCTGGTTGG + Intronic
1036196780 8:6724284-6724306 CAGTAACCCTGGAGGCCTGTTGG - Intronic
1036965267 8:13290359-13290381 CAGCAGGCCTGGAGGCATCCAGG + Intronic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1061014218 9:127972640-127972662 CTGCAGGCCTGGAGGCAGGGAGG + Intronic
1185893885 X:3842364-3842386 CAGCAGGCCTGAAGGCTCCTGGG + Intronic
1185899000 X:3880788-3880810 CAGCAGGCCTGAAGGCTCCTGGG + Intergenic
1185904117 X:3919217-3919239 CAGCAGGCCTGAAGGCTCCTGGG + Intergenic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1196194398 X:112824714-112824736 CAGGAGTCCTGGAGGCACATTGG - Intronic
1200000463 X:153057173-153057195 CAGGAGGCTTGCAGGCACCTGGG + Exonic
1200783459 Y:7237858-7237880 TAGAAGGCTTGGAGGCAAGTGGG + Intergenic
1202080639 Y:21080640-21080662 CAGTAGGGATAGAGGCTCGTAGG + Intergenic