ID: 1186760869

View in Genome Browser
Species Human (GRCh38)
Location X:12720653-12720675
Sequence AAATCATTAGGGTCTTGATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 0, 2: 9, 3: 444, 4: 700}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186760869_1186760873 1 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760873 X:12720677-12720699 TCCCAAGCAAATCAGGCATACGG 0: 1
1: 0
2: 1
3: 15
4: 144
1186760869_1186760877 17 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760877 X:12720693-12720715 CATACGGAGAGGCTGTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 112
1186760869_1186760879 27 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760879 X:12720703-12720725 GGCTGTGAGCTGGCGGCCACCGG 0: 1
1: 0
2: 0
3: 26
4: 236
1186760869_1186760872 -6 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760872 X:12720670-12720692 TGATTTCTCCCAAGCAAATCAGG 0: 1
1: 0
2: 1
3: 18
4: 176
1186760869_1186760876 6 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760876 X:12720682-12720704 AGCAAATCAGGCATACGGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 87
1186760869_1186760878 20 Left 1186760869 X:12720653-12720675 CCAAATCAAGACCCTAATGATTT 0: 1
1: 0
2: 9
3: 444
4: 700
Right 1186760878 X:12720696-12720718 ACGGAGAGGCTGTGAGCTGGCGG 0: 1
1: 0
2: 0
3: 25
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186760869 Original CRISPR AAATCATTAGGGTCTTGATT TGG (reversed) Exonic
900016511 1:154223-154245 AAATCACAAGGGTATTGATTGGG - Intergenic
900046771 1:512815-512837 AAATCACAAGGGTATTGATTGGG - Intergenic
900068976 1:754533-754555 AAATCACAAGGGTATTGATTGGG - Intergenic
900939522 1:5789351-5789373 AAATCACAAGGGTATTGATTGGG - Intergenic
901709785 1:11104781-11104803 AAATCACAAGGGTATTGATTGGG - Intergenic
902059857 1:13633012-13633034 AAATCACAAGGGTATTGATTGGG + Intergenic
902300343 1:15497752-15497774 ACATCATTGGGGTTTTGATAGGG - Intronic
902964517 1:19989828-19989850 AAATCACAAGGGTATTGATTGGG - Intergenic
903599037 1:24520912-24520934 AAATCATTGGGATTTTGATAGGG - Intronic
906352729 1:45078098-45078120 AAAGCACAAGGGTATTGATTGGG + Intronic
906410703 1:45576584-45576606 AAATCACAAGGGTATTGATTGGG - Intergenic
906577874 1:46907185-46907207 AAATTATAAGAGTATTGATTGGG - Intergenic
906623732 1:47307501-47307523 AAATCACAAGGGTATTGATTGGG - Intronic
906840643 1:49134833-49134855 AAATTATAAGAGTATTGATTGGG + Intronic
907329165 1:53660167-53660189 AAAGCATCAGGGCCTTGCTTAGG + Intronic
907506783 1:54924915-54924937 AAATCCCAAGGGTATTGATTGGG + Intergenic
907508230 1:54937898-54937920 AAACCAGTAGGGTCCTGATGGGG + Intergenic
907622607 1:55996672-55996694 AAATCACAAGGGTATTGACTGGG + Intergenic
908019678 1:59886859-59886881 AAATCACAAGGGTATTGATTGGG - Intergenic
908045342 1:60162388-60162410 AAATCACAAGGGTATTGATTGGG + Intergenic
908930064 1:69307135-69307157 ACCTCATTATGGTTTTGATTTGG + Intergenic
909136295 1:71804639-71804661 AAATCACAAGGGTATTGACTGGG - Intronic
909254863 1:73407503-73407525 AAATCACAAGGGTGTTGATTGGG - Intergenic
909420180 1:75455787-75455809 ATCTCATTACGGTTTTGATTTGG - Intronic
909556613 1:76961003-76961025 AAATCACAAGGGTATTGATTGGG + Intronic
909558291 1:76980788-76980810 AAATCTTTATGACCTTGATTAGG + Intronic
909577213 1:77187965-77187987 AAATCACAAGGGTATTGATTGGG - Intronic
909749210 1:79137893-79137915 AAATTATAAGAGTATTGATTGGG - Intergenic
909812945 1:79954067-79954089 AAATCACAAGGGTATTGATTGGG + Intergenic
910015938 1:82523532-82523554 AAATCTTTAGAGACTTGATAGGG - Intergenic
910164935 1:84316751-84316773 ATATCATTAGGATTTTGATGGGG + Intronic
910605547 1:89079875-89079897 AAATCACAAGAGTATTGATTAGG - Intergenic
910833582 1:91484683-91484705 AAATCACAAGGGTATTGATTGGG + Intergenic
911083107 1:93952561-93952583 AAATCACAGGGGTATTGATTGGG + Intergenic
911279882 1:95911499-95911521 AAATTATAAGAGTATTGATTGGG - Intergenic
911387853 1:97199518-97199540 AAATCATTAGGGCATGAATTAGG + Intronic
911826797 1:102497570-102497592 AAATTATAAGAGTATTGATTGGG - Intergenic
911893631 1:103402746-103402768 AAATCACAAGGGTATTGATTGGG - Intergenic
911896144 1:103437241-103437263 AAATCAGAAGGGTATTGATTGGG + Intergenic
911940848 1:104045399-104045421 AAATCACAAGGGTATTAATTGGG + Intergenic
912010020 1:104947852-104947874 AAATCACAAGGGTATTGATTGGG - Intergenic
912303404 1:108540149-108540171 AAATCACAAGGGTATTGACTGGG - Intergenic
912807109 1:112765836-112765858 AAATCACAAGGGTATTGACTGGG - Intergenic
912854836 1:113158427-113158449 AAATCACAAGGGTATTGATTGGG - Intergenic
913024531 1:114823908-114823930 AAATCACAAGGGTATTGATTGGG - Intergenic
913356049 1:117923304-117923326 AAATCACAAGAGTATTGATTGGG + Intronic
913962050 1:143347575-143347597 AAATCATTACAGTCCTGATTTGG + Intergenic
914056406 1:144173150-144173172 AAATCATTACAGTCCTGATTTGG + Intergenic
914122740 1:144793212-144793234 AAATCATTACAGTCCTGATTTGG - Intergenic
915055422 1:153124331-153124353 AAATCATAAGGGTATTGATTGGG + Intergenic
915410535 1:155698246-155698268 AAATTATAAGAGTATTGATTGGG + Intronic
915448350 1:155987787-155987809 AAATCACAAGGGTATTGATTGGG - Intronic
915651989 1:157320157-157320179 AAATCACAAGAGTATTGATTAGG + Intergenic
915749438 1:158192438-158192460 AAATCACAAGGATATTGATTGGG - Intergenic
915886207 1:159723732-159723754 AAATCACAAGAGTATTGATTAGG + Intergenic
915999377 1:160600152-160600174 AAATCACAAGAGTATTGATTGGG - Intergenic
916008993 1:160687417-160687439 AAATCACAAGGGTATTGACTGGG + Intronic
916055094 1:161063442-161063464 AAATCACAAGGGTATTGATTGGG - Intronic
916122000 1:161536887-161536909 AAATTATAAGAGTATTGATTGGG - Intergenic
916131893 1:161618312-161618334 AAATTATAAGAGTATTGATTGGG - Intronic
916318861 1:163480351-163480373 AAATCACAAGGGTATTGACTGGG - Intergenic
916359960 1:163957522-163957544 AAATCACAAGGGTGTTGATTGGG - Intergenic
916626968 1:166568380-166568402 AAATCACGACGGTATTGATTGGG + Intergenic
917164677 1:172098600-172098622 AAATCACAAGGGTATTGATTGGG + Intronic
917278209 1:173353223-173353245 AAATTATAAGAGTATTGATTGGG + Intergenic
918281582 1:183011265-183011287 AAATCACAAGGGTATTGACTGGG + Intergenic
918532410 1:185538131-185538153 AAATCACAAGGATATTGATTGGG - Intergenic
918949761 1:191122285-191122307 AAATGATTAGTGTTGTGATTTGG - Intergenic
919025534 1:192164770-192164792 AAATTATAAGAGTATTGATTGGG - Intronic
919190043 1:194204375-194204397 AAATCACAAGGGTATTGATTGGG + Intergenic
919296163 1:195703065-195703087 AAATCACAAGGGTATTGATTGGG + Intergenic
919318609 1:196005136-196005158 AAATCACAAGGGTATTGATTGGG + Intergenic
920213736 1:204347565-204347587 AAATCACAAGGGTATTGATTGGG + Intronic
920599109 1:207304325-207304347 AAATCACAAGGGTATTGATTAGG + Intergenic
921854734 1:219969706-219969728 AAATCCTAAGTATCTTGATTCGG - Intronic
921897268 1:220413625-220413647 AAATCACAAGGGTATTGATTGGG + Intergenic
922104335 1:222499921-222499943 AAATCACAAGGGTATTGATTAGG - Intergenic
922264652 1:223972443-223972465 AAATCACAAGGGTATTGATTGGG - Intergenic
922303239 1:224321795-224321817 AAATAATGAGGCTCTGGATTAGG + Intronic
922361111 1:224822306-224822328 AAATCACAAGAGTATTGATTGGG + Intergenic
922379299 1:225006147-225006169 AAATTATAAGAGTATTGATTAGG - Intronic
922380782 1:225022527-225022549 AACTCATTTTGGTTTTGATTTGG - Intronic
922694562 1:227722455-227722477 AAATCACAAGGGTATTGATTGGG - Intergenic
922938612 1:229440708-229440730 ACAGCATTAGGGTCTGGGTTAGG - Intergenic
923274172 1:232382591-232382613 ATATCTTTAGAGTCTTGATGAGG - Intergenic
923419642 1:233799723-233799745 AAATCACAAGAGTATTGATTGGG + Intergenic
923884458 1:238139279-238139301 AAATGATGAGGGTCTGGATTAGG + Intergenic
924120136 1:240789197-240789219 AAATCACAAGGGTATTGATTGGG - Intronic
924346511 1:243077439-243077461 AAGTCACAAGGGTATTGATTGGG - Intergenic
924490073 1:244527634-244527656 AAATCACAAGCGTATTGATTGGG + Intronic
924731915 1:246720098-246720120 AAATCACAAGGGTATTGACTGGG - Intergenic
924869570 1:248026771-248026793 AAATCACAAGCGTATTGATTGGG - Intronic
1062876551 10:947590-947612 ATTTCATTAAGGTCATGATTTGG - Intergenic
1064490421 10:15850145-15850167 AAATTATAAGAGTATTGATTGGG - Intronic
1064680292 10:17804928-17804950 AAATCATTGGGATTTTGATAGGG + Intergenic
1064688065 10:17884787-17884809 GAATCATTAGGCTGTTGATATGG - Intronic
1064893734 10:20209831-20209853 AAATCACAAGGGTATTGACTGGG + Intronic
1065053333 10:21817847-21817869 AAATCACAAGGGTATTGATTGGG - Intronic
1065124971 10:22565474-22565496 AAAGCACAAGGGTATTGATTGGG - Intronic
1065432447 10:25673433-25673455 AAATCACAAGGGTATTGATTGGG - Intergenic
1065512532 10:26493368-26493390 AAATCACAAGAGTATTGATTGGG + Intronic
1066331347 10:34426979-34427001 AAATCACAAGAGTATTGATTGGG - Intronic
1066431695 10:35358068-35358090 AAATCATTTTTCTCTTGATTTGG + Intronic
1066626627 10:37413464-37413486 AAATCACAAGAGTATTGATTGGG + Intergenic
1066698534 10:38100789-38100811 AAATCACAAGGGTATTGATTGGG + Intronic
1066729834 10:38427406-38427428 AAATCACAAGGGTATTGATTGGG + Intergenic
1067075903 10:43181926-43181948 CAATCACAAGGGTATTGATTGGG + Intronic
1067303107 10:45032480-45032502 AAATCATAAAGATATTGATTGGG + Intergenic
1067403599 10:46000201-46000223 AAATCACAAGGGTATTGATTGGG + Intronic
1067543099 10:47170851-47170873 AAATCACAAGGGTATTGATTGGG + Intergenic
1067841719 10:49686239-49686261 AAATTATAAGAGTATTGATTGGG - Intronic
1067920008 10:50445590-50445612 AAATCACTAGAGTATTGATTGGG - Intronic
1067995531 10:51268786-51268808 AAATCACAAGGGTATTGACTGGG + Intronic
1068071702 10:52204619-52204641 AAATCACAAGAGTATTGATTGGG - Intronic
1068247813 10:54395149-54395171 AAATCACAAGGGTATTCATTGGG + Intronic
1068290899 10:55000604-55000626 AAATCACAAGGGTATTGATTGGG + Intronic
1068515571 10:58021612-58021634 AAATCACAAGGGTATTGATTGGG - Intergenic
1068662642 10:59638206-59638228 AAATCACAAGGGTATTGATTGGG + Intergenic
1069106289 10:64386776-64386798 AAATCTTTATGATCTTGAATAGG + Intergenic
1069132727 10:64726988-64727010 AAATCACAAGGGTATTGATTGGG - Intergenic
1069288071 10:66741830-66741852 AAATCACAAGGGTATTGATTGGG - Intronic
1069650184 10:70041568-70041590 AAATCACAAGGGTATTGATTGGG - Intergenic
1069737661 10:70667913-70667935 AAATCACAAGGGTATTGATTAGG - Intergenic
1070050266 10:72882134-72882156 AAATCACAAGGGTATTGACTGGG - Intronic
1070088330 10:73258380-73258402 AAATTATAAGAGTATTGATTGGG - Intronic
1070314881 10:75300470-75300492 AAATCACAAGGGTATTGATTGGG + Intergenic
1070582873 10:77736427-77736449 AAATCACAAGGGTATTGATTGGG - Intergenic
1071049609 10:81430371-81430393 AAATCACAGGGGTATTGATTGGG + Intergenic
1071102419 10:82054499-82054521 AGCACATAAGGGTCTTGATTTGG + Intronic
1071380607 10:85055693-85055715 AAATCACAAGAGTATTGATTAGG - Intergenic
1071855457 10:89620042-89620064 AAATTATAAGAGTATTGATTGGG - Intronic
1072200573 10:93154368-93154390 AAATCTTTATGACCTTGATTTGG + Intergenic
1072387322 10:94944276-94944298 AAATCACAAGAGTATTGATTGGG + Intronic
1072473208 10:95733481-95733503 AAATCACAAGAGTATTGATTAGG + Intronic
1072479924 10:95800969-95800991 AAATTATAAGAGTATTGATTGGG + Intronic
1072883953 10:99257070-99257092 AAATCACAAGGGTATTGATTGGG - Intergenic
1073003337 10:100301800-100301822 AAATTATAAGGGTATTGATTGGG + Intronic
1073073032 10:100806782-100806804 AAATCATTATGGTCTGTATATGG + Intronic
1073678528 10:105677371-105677393 AAATCACAAGGGTATTGATTGGG - Intergenic
1074494736 10:113969883-113969905 AAATCACAAGGGTATTGATTGGG + Intergenic
1074646488 10:115459083-115459105 AAATCACAAGGGTATTGACTGGG - Intronic
1075459095 10:122604093-122604115 AAATCACAAGAGTATTGATTGGG + Intronic
1075459727 10:122608152-122608174 AAATCACAAGAGTATTGATTGGG + Intronic
1075460359 10:122612211-122612233 AAATCACAAGAGTATTGATTGGG + Intronic
1075460991 10:122616270-122616292 AAATCACAAGAGTATTGATTGGG + Intronic
1075931959 10:126305536-126305558 AAATATTTAATGTCTTGATTTGG + Intronic
1075997545 10:126890819-126890841 AAATCACAAGGGTATTGATTGGG - Intergenic
1076973101 11:149292-149314 AAATCACAAGGGTATTGATTGGG - Intergenic
1077449338 11:2626960-2626982 ACATCATTAGGATTTTTATTGGG + Intronic
1077588373 11:3472167-3472189 AAATCACAAGGATATTGATTGGG + Intergenic
1077851264 11:6076241-6076263 AAATTATAAGAGTATTGATTGGG - Intergenic
1078385233 11:10884924-10884946 AAATTATAAGAGTATTGATTGGG + Intergenic
1078714928 11:13830814-13830836 AAATCACAAGGGTATTGATTGGG + Intergenic
1078777457 11:14406923-14406945 AAATCACAAGGGTATTGATTGGG - Intergenic
1078840097 11:15070334-15070356 AAATCACAAGAGTATTGATTGGG + Intronic
1079272717 11:19003721-19003743 AAATCACAAGGGTATTGATTGGG + Intergenic
1079308239 11:19343616-19343638 AAATCAGTAGGGTCATGGTAGGG - Intergenic
1079585960 11:22127197-22127219 AAATCACAAGGGTATTGATTGGG - Intergenic
1079942991 11:26705140-26705162 AATTAATTAAGGTCTGGATTGGG + Intronic
1079979556 11:27135593-27135615 AAATTATAAGAGTATTGATTGGG - Intergenic
1080203606 11:29704546-29704568 AAATCACAAGGGTATTGATTGGG - Intergenic
1081009980 11:37798625-37798647 AAATCACAAGGGTATTGATTGGG + Intergenic
1081150658 11:39626732-39626754 AAATCATTAAGTTCCTGAATTGG - Intergenic
1081254027 11:40870638-40870660 AAATCACAAGGGTATTGATTGGG - Intronic
1081461296 11:43275072-43275094 AAATCATAAGAGTATTGATTGGG + Intergenic
1081510201 11:43763228-43763250 AAATGATTATAGTCTTAATTTGG + Intronic
1081653874 11:44844017-44844039 AAATCACAAGGGTATTGATTGGG + Intronic
1082116006 11:48328808-48328830 AAATTATAAGAGTATTGATTGGG + Intergenic
1082296558 11:50447125-50447147 AAATCACAAGAGTATTGATTGGG - Intergenic
1082310281 11:50637369-50637391 AAATCACAAGGGTATTGATTGGG + Intergenic
1082662140 11:55924782-55924804 AAATCACAAGGGTATTGATTGGG + Intergenic
1082733460 11:56827972-56827994 AAATTATAAGAGTATTGATTTGG + Intergenic
1082780346 11:57282639-57282661 AAATCACAAGGGTATTGATTGGG + Intergenic
1082919146 11:58473440-58473462 AAATCACAAGGGTATTGATTGGG - Intergenic
1084098066 11:66925706-66925728 AAATCACAAGGGTATTGATTGGG + Intronic
1084204068 11:67581154-67581176 AAATCACAAGAGTATTGATTGGG - Intergenic
1084244072 11:67843796-67843818 AAATCACAAGGATATTGATTGGG + Intergenic
1084344999 11:68541036-68541058 AAAGCACAAGGGTATTGATTTGG + Intronic
1084828616 11:71750768-71750790 AAATCACAAGGATATTGATTGGG - Intergenic
1085212896 11:74797988-74798010 AAATCACAAGGGTATTGACTGGG - Intronic
1085615027 11:77991011-77991033 AAATAAATAGGGTATTCATTAGG - Intronic
1085959529 11:81443994-81444016 AAATTATAAGAGTATTGATTGGG + Intergenic
1086261934 11:84949878-84949900 AAATCACAAGGGTATTGACTGGG + Intronic
1087086119 11:94220381-94220403 AAATTATAAGAGTATTGATTGGG + Intergenic
1087393972 11:97573398-97573420 AAATTATCAGAGTATTGATTGGG - Intergenic
1087408465 11:97759598-97759620 AAATCATCAGAGTCCTGAATGGG - Intergenic
1087529159 11:99356835-99356857 AAATAATTAGGTTCTGTATTTGG + Intronic
1088380604 11:109188435-109188457 AAATCACAAGGGTATTGATTGGG + Intergenic
1088458181 11:110054418-110054440 AAATCACAAGAGTATTGATTTGG + Intergenic
1088494821 11:110422228-110422250 AAATAATAAGAGTATTGATTGGG + Intergenic
1088504878 11:110517829-110517851 AAATCACAAGGGTATTGACTGGG - Intergenic
1088967308 11:114736701-114736723 AAATCACAAGGGTATTGATTGGG + Intergenic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1089858595 11:121569137-121569159 AAATCACAAGGGTATTGATTGGG - Intronic
1089885030 11:121812404-121812426 AGAAAATTAGGTTCTTGATTTGG + Intergenic
1089924151 11:122239737-122239759 AAATGATTGGGGCCTTGATCAGG + Intergenic
1090222817 11:125045481-125045503 AAATCACAAGGGTATTGACTGGG - Intergenic
1090591212 11:128271570-128271592 AAAATATTTGGGTCTTGTTTTGG - Intergenic
1091199979 11:133770760-133770782 AAATCATTATGGTTTAAATTTGG - Intergenic
1092678243 12:10946160-10946182 AAATCACAAAGGTATTGATTGGG + Intronic
1092914925 12:13180999-13181021 AAATCACAAGGGTATTGACTGGG + Intergenic
1093074787 12:14746514-14746536 AAATCACAAGGGTATTGATTGGG + Intergenic
1093307150 12:17535020-17535042 ATATCATTAGTGTTTTGATAGGG + Intergenic
1093837892 12:23858952-23858974 AAATTATAAGAGTATTGATTAGG - Intronic
1094132889 12:27094005-27094027 AAATCTTTAGTTTCTTGATCAGG + Intergenic
1094326807 12:29249117-29249139 AAATCACCAGGGTATTGATTGGG + Intronic
1094328748 12:29269555-29269577 AAATCACCAGGGTATTGACTGGG + Intronic
1094385127 12:29885650-29885672 AAATCACAAGAGTATTGATTGGG + Intergenic
1094411686 12:30173842-30173864 AAATCACAAGGGTATTGACTGGG - Intergenic
1094416523 12:30222143-30222165 AAATCACAAGGGTATTGATTGGG - Intergenic
1094720224 12:33055521-33055543 AAATCACAAGGGTATTGACTGGG - Intergenic
1094740420 12:33282173-33282195 AAATTATAAGAGTATTGATTGGG + Intergenic
1094860609 12:34461930-34461952 AAATCACAAGGGTATTGATTGGG + Intergenic
1094864924 12:34521295-34521317 AAATCACAAGGATATTGATTGGG - Intergenic
1095087097 12:38068989-38069011 AAATCACAAGGGTATTGATTGGG - Intergenic
1095172667 12:39054481-39054503 AAATCACAAGGGTATTGATTGGG - Intergenic
1095363534 12:41373769-41373791 AAATCACAAGGGCATTGATTGGG + Intronic
1096035869 12:48469640-48469662 AAATTATAAGAGTATTGATTGGG + Intergenic
1096431113 12:51543865-51543887 AAATCACAAGGGTATTGATTGGG - Intergenic
1096453679 12:51767768-51767790 AATTGATAAGGGTCTGGATTAGG - Intronic
1096605434 12:52761759-52761781 AAATCACAAGAGTATTGATTAGG + Intergenic
1096943811 12:55381379-55381401 AAATCACAAGAGTATTGATTGGG + Intergenic
1097082472 12:56442921-56442943 AAATTATAAGAGTATTGATTGGG - Intronic
1097110378 12:56653589-56653611 AAATTATAAGAGTATTGATTGGG - Intergenic
1097180938 12:57171540-57171562 AAATCGTGAGAGGCTTGATTTGG + Intronic
1097515805 12:60604162-60604184 AAATTATAAGAGTATTGATTGGG + Intergenic
1098333820 12:69381566-69381588 AAATCACAAGGGTATTGATTGGG + Intronic
1098459445 12:70715924-70715946 AAATCACAAGGGTATTGATTGGG + Intronic
1098467779 12:70807741-70807763 AAATCACAAGAGTATTGATTGGG - Intronic
1098781208 12:74688476-74688498 AAATCACAAGGGTATTGATTGGG + Intergenic
1098839183 12:75458527-75458549 AAATTATAAGAGTATTGATTGGG + Intergenic
1098960508 12:76735338-76735360 AAATCACAAGGGTATTGACTGGG - Intergenic
1099555135 12:84101285-84101307 AAATCACAAGGGTATTGATTGGG - Intergenic
1099556067 12:84109207-84109229 AAATCACAAGGGTATTGATTGGG + Intergenic
1099721378 12:86365463-86365485 AAATCACAAGGCTATTGATTGGG + Intronic
1100142070 12:91631567-91631589 AAATCCATAGGGTCTGGATAGGG + Intergenic
1100183777 12:92114357-92114379 AAATCATTGTGATTTTGATTAGG + Intronic
1100499052 12:95155979-95156001 AAATCACAAGGGTATTGACTGGG - Intronic
1101500469 12:105299432-105299454 AAATCACAAGAGTATTGATTGGG - Intronic
1101502078 12:105313557-105313579 AAATCACAAGAGTATTGATTGGG - Intronic
1101890414 12:108709324-108709346 TAATCAGTAGGGACTTGCTTAGG - Intronic
1103218136 12:119219438-119219460 AAATCACAAGAGTATTGATTGGG + Intronic
1103485553 12:121280304-121280326 AAATCACGAGGGTATTGACTGGG - Intronic
1104128039 12:125865896-125865918 AAATTATAAGAGTATTGATTGGG + Intergenic
1104693127 12:130841365-130841387 AAATCACAAGGGTATTGACTGGG - Intergenic
1104877765 12:132048233-132048255 AAATCACAAGGGTATTGACTGGG + Intronic
1105227713 13:18451860-18451882 AAATCACAAGGGTATTGATTGGG + Intergenic
1105444716 13:20443168-20443190 AACTCATTAGGGCCCTGATGTGG + Intronic
1105521617 13:21136175-21136197 AAATCACAAGGGTATTGACTGGG + Intergenic
1105804184 13:23940343-23940365 AAATTATAAGAGTATTGATTGGG + Intergenic
1106390876 13:29334844-29334866 AAATCACAAGAGTATTGATTGGG - Intronic
1106610964 13:31280178-31280200 AAATCACAAGAGTATTGATTGGG + Intronic
1106746570 13:32714904-32714926 AAATCACAAGAGTATTGATTGGG + Intronic
1106961104 13:34998873-34998895 AAATCACAAGGGTATTGATTGGG + Intronic
1107520542 13:41176169-41176191 AAATCATAAGAGTATTGATTAGG + Intergenic
1108294590 13:49001257-49001279 AAATCACAAGGGTATTGATTGGG - Intronic
1108799080 13:54070554-54070576 AAATTATAAGAGTATTGATTGGG + Intergenic
1108902237 13:55425595-55425617 AAATTATAAGAGTATTGATTGGG + Intergenic
1109081202 13:57903529-57903551 AAATCACAAGGATATTGATTGGG + Intergenic
1109159053 13:58949427-58949449 AAATTATAAGAGTATTGATTGGG - Intergenic
1109290698 13:60471551-60471573 AAATCATTGGGGTTTTGATAAGG + Intronic
1109683292 13:65782005-65782027 AAATCATGAGGCTATTGGTTTGG - Intergenic
1109722042 13:66287386-66287408 AAATTATAAGAGTATTGATTGGG + Intergenic
1109911945 13:68923735-68923757 AAATTATAAGAGTATTGATTGGG + Intergenic
1110724489 13:78803776-78803798 GAATCATTAGGTTATTTATTTGG - Intergenic
1110934863 13:81275454-81275476 AAATTATAAGAGTATTGATTGGG - Intergenic
1111429560 13:88133846-88133868 AAATCACAAGGGTATTGATTGGG + Intergenic
1111509516 13:89242734-89242756 AAATCACAAGGGTATTGACTGGG - Intergenic
1111684788 13:91488598-91488620 AAATCACAAGGGTATTGATTGGG - Intronic
1111712182 13:91830485-91830507 AAATCACAAGGGTATTGATTGGG + Intronic
1112093496 13:96107818-96107840 AAATTATAAGAGTATTGATTGGG - Intronic
1112449383 13:99495139-99495161 AAATCACAAGAGTATTGATTGGG + Intergenic
1112693851 13:101926011-101926033 AAATCACTAGGATCTTGAAGAGG - Intronic
1112746514 13:102533267-102533289 AAATCACAAGGGTATTGATTGGG - Intergenic
1112850567 13:103700967-103700989 AAATTATTTAGGTTTTGATTTGG + Intergenic
1112960618 13:105120861-105120883 AAATCACAAGAGTATTGATTGGG + Intergenic
1113290488 13:108900600-108900622 AAATCACAAGGGTATTGATTGGG - Intronic
1114012146 14:18380322-18380344 AAATCACAAGGGTATTGACTGGG + Intergenic
1114148987 14:20013300-20013322 AAATCAATAGGATCTTGAAATGG + Intergenic
1114157337 14:20119384-20119406 AAATCACAAGAGTATTGATTGGG + Intergenic
1114215542 14:20655217-20655239 AAATCACAAGGGTATTGATTGGG + Intergenic
1114355480 14:21903516-21903538 AAATCACAGGGGTATTGATTGGG - Intergenic
1114426943 14:22631693-22631715 AAATCACAAGGGTATTCATTGGG + Intergenic
1114519294 14:23322733-23322755 CATTCATTAGGGATTTGATTTGG + Intronic
1114638401 14:24202153-24202175 AAATCACAAGGGTATTGACTGGG - Intronic
1114687065 14:24543347-24543369 AAATCACAAGGGTGGTGATTGGG - Intergenic
1114753116 14:25228060-25228082 AAATCACAAGGGTATTGATTGGG + Intergenic
1115002048 14:28434857-28434879 AAATCACAAGGGTATTGATTGGG - Intergenic
1115884653 14:37958004-37958026 AAATCACAAGGGTATTGATTGGG - Intronic
1115958841 14:38811563-38811585 AAACCACAAGGGTATTGATTGGG + Intergenic
1116181434 14:41541256-41541278 AAATCACAAGGGTATTGATTGGG + Intergenic
1116237520 14:42297843-42297865 AAATCACAAGAGTATTGATTGGG + Intergenic
1116301837 14:43192887-43192909 AAATCATAAGGGTATTGACTGGG + Intergenic
1116562693 14:46401812-46401834 AAATCACAAGGGTATTGACTGGG - Intergenic
1116725870 14:48561098-48561120 AAATTATAAGAGTATTGATTGGG - Intergenic
1116795913 14:49389910-49389932 AAATCACAAGGGTATTGATTGGG + Intergenic
1117381993 14:55173806-55173828 AAATCACAAGGGTATTGACTGGG - Intronic
1118116410 14:62781890-62781912 AAATCACAAGGGTATTGAATGGG + Intronic
1118372242 14:65147218-65147240 AAATCACAAGGGTATTGATTCGG + Intergenic
1118376228 14:65179502-65179524 AAATCACAAGGGTATTGATTGGG + Intergenic
1118645036 14:67830155-67830177 AGATTATTAGGGCTTTGATTTGG + Intronic
1119224083 14:72930698-72930720 AAATCATCATGATCTTGATTAGG - Intronic
1119573210 14:75694823-75694845 AAATCACAAGAGTATTGATTAGG - Intronic
1119762664 14:77162801-77162823 AAATCATCAGGGTCTAGACTTGG - Intronic
1119959887 14:78843088-78843110 AAATCACAAGGGTATTGATTGGG + Intronic
1120295341 14:82633437-82633459 AAATTATAAGAGTATTGATTGGG - Intergenic
1121099486 14:91240613-91240635 AAATCATAAGAGTATTGATGAGG + Intronic
1121191226 14:92032093-92032115 TCATTATTAGGGTCTAGATTGGG - Intronic
1121988620 14:98532421-98532443 AAATCATTCGGCCCTTGCTTTGG + Intergenic
1123664227 15:22595358-22595380 AAATCACAAGGGTATTGATTGGG - Intergenic
1123839230 15:24229742-24229764 AAATCACAAGGGTATTGATTGGG + Intergenic
1123849099 15:24335553-24335575 AAATCACAAGGGCATTGATTGGG + Intergenic
1123864653 15:24505857-24505879 AAATCACAAGGGTATTGATTGGG + Intergenic
1123868157 15:24543065-24543087 AAATCACAAGGGCATTGATTGGG + Intergenic
1123931630 15:25174730-25174752 AAATAATAAGAGTATTGATTTGG + Intergenic
1124248255 15:28089346-28089368 AAATCACAAGGGTATTGACTGGG + Intronic
1124318058 15:28689794-28689816 AAATCACAAGGGTATTGATTGGG - Intergenic
1124566924 15:30824571-30824593 AAAGCATTTGGGACTTGAGTAGG + Intergenic
1124572413 15:30877002-30877024 AATTCATTGGGGCATTGATTAGG - Intergenic
1125567369 15:40686938-40686960 AAATCACAAGGGTATTGATTGGG + Intergenic
1125856564 15:42955469-42955491 AAATCAATAAAGTCTTGAATAGG + Intronic
1126143058 15:45453288-45453310 AAATCACAAGGGTATTGATTAGG + Intergenic
1126267123 15:46768049-46768071 AAATTATAAGAGTATTGATTGGG - Intergenic
1126275455 15:46874029-46874051 AAATTATTATGATCTTGAGTTGG + Intergenic
1126276221 15:46884435-46884457 AAATCACAAGGGTATTGATTGGG + Intergenic
1126724101 15:51613233-51613255 AAATCATAAGAGTATTGACTGGG + Intronic
1127072352 15:55299102-55299124 AAATCACAACGGTATTGATTGGG + Intronic
1127145974 15:56024460-56024482 AAATCACAAGAGTATTGATTGGG - Intergenic
1127676408 15:61243433-61243455 AAATCACAAGGGTATTGATTAGG + Intergenic
1127755155 15:62084934-62084956 AAATCACAAGGGTATTGATTGGG + Intergenic
1128477140 15:68006886-68006908 AAATCAGAAGGGTATTGATTGGG - Intergenic
1128858423 15:71042058-71042080 AAATCTTTATGATCTTGATTGGG + Intronic
1129981451 15:79875058-79875080 AAATCACAAGAGTATTGATTGGG + Intronic
1130306670 15:82716387-82716409 AAATCACAAGGGTATTGATTGGG - Intergenic
1130583906 15:85164477-85164499 AAATTATAAGAGTATTGATTGGG - Intergenic
1130728417 15:86465245-86465267 AAATTATAAGAGTATTGATTGGG - Intronic
1131000368 15:88935026-88935048 AAATTATAAGAGTATTGATTGGG + Intergenic
1131589646 15:93734780-93734802 AAATCACAAAGGTATTGATTAGG - Intergenic
1132213660 15:100046703-100046725 AAATCACAAGGGTATTGATTGGG - Intronic
1132226513 15:100146425-100146447 AAATCACAAGGGTATTGATTGGG - Intronic
1132273998 15:100550632-100550654 AAATCACAAGAGTATTGATTGGG - Intergenic
1133162020 16:3918228-3918250 AAATCACAAGGGTATTGATTGGG - Intergenic
1134406619 16:13965045-13965067 AAATCACAAGGTTATTGATTGGG + Intergenic
1135813560 16:25611448-25611470 AAATCACAAGGGTATTGATTGGG + Intergenic
1136595481 16:31246234-31246256 AAATCACAAGGGTATTGATTGGG + Intergenic
1136635220 16:31516921-31516943 AAATCACGAGGGTATTGATTGGG - Intergenic
1138011410 16:53384352-53384374 AAATTATAAGAGTATTGATTGGG - Intergenic
1138327123 16:56183450-56183472 AAATCAATTGGGTGATGATTAGG + Intergenic
1138767575 16:59622806-59622828 AAATCACAAGGGTATTGATTGGG + Intergenic
1138767878 16:59625692-59625714 AAATCACAAGGGTATTGATTGGG + Intergenic
1139000923 16:62508776-62508798 AAATCACAAGGGTATTGATTGGG + Intergenic
1139015999 16:62689793-62689815 AAATTATAAGAGTGTTGATTGGG - Intergenic
1139498037 16:67335603-67335625 AAATCACAAGAGTATTGATTGGG + Intronic
1141117577 16:81323629-81323651 ATATAATTAGGGTGTTGTTTAGG + Intronic
1141432169 16:83975926-83975948 AATTCATTAGGGCCGTGATCAGG + Intronic
1142447150 16:90148234-90148256 AAATCACAAGGGTATTGATTGGG + Intergenic
1142460342 17:87097-87119 AAATCACAAGGGTATTGATTGGG - Intergenic
1143940956 17:10540971-10540993 AAATCACAAGAGTATTGATTGGG - Intronic
1144162464 17:12573743-12573765 ACATCATTAGGAAATTGATTGGG + Intergenic
1145387578 17:22427181-22427203 AAATCACAAGAGTATTGATTGGG + Intergenic
1145802351 17:27696240-27696262 AAATTATAAGAGTATTGATTGGG + Intergenic
1145819702 17:27822682-27822704 AAATCACAAGAGTATTGATTGGG + Intronic
1145869500 17:28261908-28261930 AAATCACAAGAGTATTGATTGGG - Intergenic
1146067655 17:29649149-29649171 AAAAAATCAGGGTCCTGATTAGG + Intronic
1146166873 17:30596523-30596545 AAATCACAAGGGTATTGACTGGG + Intergenic
1146731781 17:35199404-35199426 AAATCACAAGGGTATTGATTGGG - Intergenic
1147058899 17:37858181-37858203 AAATCACAAGAGTATTGATTGGG - Intergenic
1147509039 17:41049900-41049922 AAATCACAAGGGTATTGATTGGG - Intergenic
1147591339 17:41685519-41685541 AAATCCCAAGGGTATTGATTGGG - Intergenic
1147840249 17:43366471-43366493 AAATCACAAGGGTATTGACTGGG + Intergenic
1149028139 17:52053878-52053900 AAATCACAAGGGTATTGATTGGG - Intronic
1150358904 17:64511722-64511744 AAATCACAAGGGTATTGATTGGG + Intronic
1150418871 17:65011696-65011718 AAATCTTTATGGTTATGATTTGG - Exonic
1150447307 17:65236945-65236967 AAATCACAAGGGTATTGATTGGG - Intergenic
1150661927 17:67088780-67088802 AAATCATTATGAATTTGATTTGG + Intronic
1150807740 17:68332492-68332514 AAATCACAAGAGTATTGATTGGG + Intronic
1151060188 17:71083186-71083208 AAATCATTACGATTTTTATTGGG + Intergenic
1151864735 17:76793637-76793659 AAATCACAAGGGTATTGATTGGG + Intergenic
1153485556 18:5594095-5594117 AAATCACAAGGGTATTGACTGGG + Intronic
1153796065 18:8623169-8623191 AAATCACAAGGGTATTGATTGGG + Intronic
1154107678 18:11536937-11536959 AAATCACAAGGGTATTGATTGGG + Intergenic
1154525668 18:15287616-15287638 AAATCACAAGGGTATTGATTGGG - Intergenic
1155013231 18:21804550-21804572 ATATCATTGGAGTCTTGACTGGG + Intronic
1155747454 18:29376685-29376707 AAATAATTAGTGTCTTCTTTTGG - Intergenic
1155854458 18:30815667-30815689 AAATCACAAGGGTATTGATTGGG - Intergenic
1156173704 18:34516934-34516956 AAATTATAAGAGTATTGATTGGG + Intronic
1156189327 18:34700213-34700235 ATATGATGAGGGTATTGATTGGG - Intronic
1156649967 18:39213783-39213805 AAATCACAAGGGTATTGATTGGG + Intergenic
1156761507 18:40596867-40596889 AAATCACAAGGGTATTGATTGGG + Intergenic
1156883845 18:42111763-42111785 AAATTATAAGGGTATTGATTGGG - Intergenic
1157153015 18:45238166-45238188 AGATGGTTATGGTCTTGATTGGG + Intronic
1157212789 18:45758373-45758395 AAATCACAAGGGTATTGATTGGG + Intergenic
1157467606 18:47960793-47960815 AAATCACAAGAGTATTGATTGGG - Intergenic
1157673936 18:49554136-49554158 AAATCACAAGGGTATTGATTGGG + Intergenic
1158112969 18:53962441-53962463 AAATCACAAGGGTATTGATTGGG - Intergenic
1158661206 18:59389632-59389654 AAAAAATAAGGGTCTTGATCAGG - Intergenic
1158865597 18:61635297-61635319 AAATCACAAGGGTATTGATTGGG + Intergenic
1159079073 18:63714886-63714908 AAATCACAAGAGTATTGATTAGG + Intronic
1159280091 18:66274092-66274114 AAATCACAAGAGTATTGATTGGG - Intergenic
1159686148 18:71423455-71423477 AAATCACAAGAGTATTGATTGGG - Intergenic
1160249286 18:77186892-77186914 AAATCACAAGAGTATTGATTGGG + Intergenic
1160650057 19:219597-219619 AAATCACAAGGGTATTGATTGGG - Intergenic
1162275312 19:9649183-9649205 AAATCACAAGGGTATTGACTGGG - Intronic
1162280962 19:9697635-9697657 AAATCACAAGGGTATTGATTGGG - Intronic
1163959666 19:20677244-20677266 AAATCACAAGGGTATTGACTGGG - Intronic
1164013392 19:21229753-21229775 AAATCACAAGAGTATTGATTGGG - Intronic
1164172065 19:22734085-22734107 AAATCACAAGGGTATTGATTGGG - Intergenic
1164217990 19:23167930-23167952 AAATCACAAGGGTATTGATTGGG - Intergenic
1164237311 19:23348464-23348486 AAATTATAAGAGTATTGATTGGG - Intronic
1164275919 19:23718747-23718769 AAATCACAAGGGTATTGATTGGG - Intergenic
1164291541 19:23873584-23873606 AAATTTTTAGTGTCTTGCTTTGG - Intergenic
1164301772 19:23968642-23968664 AAATTTTTAGTGTCTTGCTTTGG - Intergenic
1164329718 19:24242869-24242891 AAATCACAAGAGTATTGATTGGG - Intergenic
1164332882 19:24277534-24277556 AAATCACAAGGGTATTGATAGGG - Intergenic
1164339269 19:24371578-24371600 AAATCACAAGGGCATTGATTGGG - Intergenic
1164353039 19:27376129-27376151 AAATCATTGGTATCTTGATGGGG + Intergenic
1164377773 19:27704315-27704337 AAATCACAAGGGTATTGATTGGG + Intergenic
1164378778 19:27713102-27713124 AAATCACAAGGGTATTGATTGGG + Intergenic
1164430919 19:28188050-28188072 AAATCACAAGGGTATTGATTGGG - Intergenic
1164549668 19:29198685-29198707 AAATCACAAGGGTATTGATTGGG + Intergenic
1164771116 19:30809830-30809852 AAATCATTATGGTTTGGATGAGG - Intergenic
1164967647 19:32499283-32499305 AATTCTTTAGGGTCTTCATTGGG - Intergenic
1165057453 19:33186908-33186930 TAATCATTTGTGTATTGATTTGG - Intronic
1165300489 19:34965211-34965233 AAATCACAAGAGTATTGATTGGG - Intergenic
1165665363 19:37622905-37622927 AAATCACAAGGGTATTGACTGGG - Intronic
1165812927 19:38623102-38623124 AAATCACAAGGGTATTGATTGGG + Intronic
1166912205 19:46167029-46167051 AAATCACAAGGGTATTGATTGGG + Intergenic
1166912555 19:46170333-46170355 AAATTATAAGAGTATTGATTGGG - Intergenic
1167530092 19:50010164-50010186 CAATCATTAGAGTTTTTATTTGG + Intronic
1167799602 19:51731604-51731626 AAATCACAAGGGTATTGATTGGG + Intergenic
1167818711 19:51906894-51906916 AAATCACAAGGATATTGATTGGG - Intronic
926556367 2:14362761-14362783 AAATCACAAGGGTATTGAATGGG + Intergenic
926859167 2:17290874-17290896 AAATCACAAGGATATTGATTGGG + Intergenic
926874237 2:17457334-17457356 AAATCACAAGGGTATTGACTGGG + Intergenic
926995918 2:18735898-18735920 AAATCACAAGGGTATTGATTGGG - Intergenic
927195785 2:20545619-20545641 AAATCACAAGGGTATTGATTGGG + Intergenic
928897141 2:36279240-36279262 AAGTTATAAGGGTATTGATTGGG - Intergenic
928901525 2:36323378-36323400 AAATCACAAGGGTATTGATTGGG - Intergenic
929254115 2:39790986-39791008 AAATTATAAGAGTATTGATTGGG + Intergenic
929362789 2:41114285-41114307 AAATCACAAGGGTATTGATTGGG + Intergenic
929529462 2:42738434-42738456 AAATCACAAGGGTATTGACTGGG - Intronic
929976850 2:46643436-46643458 AAATTATAAGAGTATTGATTGGG + Intergenic
930161997 2:48167787-48167809 AAATCGCAAGGGTATTGATTGGG + Intergenic
930215163 2:48688696-48688718 ACTTCCTTAGGGTCCTGATTTGG - Exonic
930489471 2:52050421-52050443 AAATCACAAGGGTATTGACTGGG - Intergenic
930573134 2:53112248-53112270 AAATCACAAGGGTATTGATTGGG - Intergenic
930643443 2:53878274-53878296 AAATCACAAGAGTATTGATTGGG - Intronic
930895031 2:56435987-56436009 GAATCATTAGGTTGTTTATTTGG + Intergenic
930967786 2:57352612-57352634 ATATCATTGCGGTTTTGATTTGG + Intergenic
931470539 2:62534419-62534441 AAATCACAAGGGTATTGATTGGG + Intergenic
931562160 2:63573495-63573517 AAATCACAAGGGTATTGATTGGG - Intronic
931578442 2:63746238-63746260 AAATCACAAGAGTATTGATTGGG - Intronic
931583963 2:63807014-63807036 AAATCACAAGGGTATTGATTGGG + Intronic
931599376 2:63988631-63988653 AAATCATAAGATTGTTGATTGGG - Intronic
931600307 2:63996319-63996341 AAATTATAAGAGTATTGATTGGG - Intronic
932375690 2:71233683-71233705 AAATTATAAGAGTATTGATTGGG + Intergenic
932489503 2:72111515-72111537 AAATCACAAGGGTATTGATTGGG - Intergenic
932881719 2:75508050-75508072 AAATCACAAGGGTATTGATTGGG - Intronic
932910610 2:75802201-75802223 AAATCAAAAGGGTTTTGATTTGG - Intergenic
932942025 2:76178012-76178034 AAATCACAAGAGTATTGATTCGG + Intergenic
933333041 2:80919582-80919604 AAATCACAAGGGTATTGATTGGG - Intergenic
933459922 2:82569604-82569626 AAATCACAAGAGTATTGATTGGG - Intergenic
933598596 2:84306957-84306979 AAATTATAAGAGTGTTGATTGGG + Intergenic
933606223 2:84386956-84386978 AAATGATTTGGGTCTTGTGTGGG + Intergenic
933611914 2:84445108-84445130 AAATCACAAGGATATTGATTGGG + Intronic
934277052 2:91582872-91582894 AAATCATTACAGTCCTGATTTGG + Intergenic
934535635 2:95130884-95130906 AAATCACAAGGGTATTGATTGGG + Intronic
934932160 2:98435421-98435443 AAATCACAAGAGTATTGATTGGG - Intergenic
935486791 2:103666216-103666238 AACTCTTTAGGATTTTGATTGGG - Intergenic
936160723 2:110082372-110082394 AAATCACAAGGGTGTTGATTGGG - Intergenic
936183941 2:110288982-110289004 AAATCACAAGGGTGTTGATTGGG + Intergenic
936686820 2:114837152-114837174 AAATCACAAGGGTATTGATTGGG + Intronic
936874231 2:117168677-117168699 AAATCACAAGGGTATTGATTGGG + Intergenic
937613277 2:123889959-123889981 AAATTATAAGAGTATTGATTGGG - Intergenic
937614091 2:123899574-123899596 GCATCATTAGGGTGTTCATTTGG + Intergenic
937780671 2:125833509-125833531 AAATCATTTTGCTCTTTATTTGG + Intergenic
937794628 2:126002453-126002475 AAATTATAAGAGTATTGATTAGG - Intergenic
938524767 2:132118977-132118999 AAATCACAAGGGTATTGACTGGG - Intergenic
938616575 2:133005193-133005215 AAATTATAAGAGTATTGATTGGG + Intronic
938858507 2:135341365-135341387 AAATTATAAGAGTATTGATTGGG - Intronic
939146850 2:138425867-138425889 AAATTATAAGAGTATTGATTGGG - Intergenic
939246157 2:139625938-139625960 AAATCACAAGGGTATTGATTGGG + Intergenic
939248958 2:139661909-139661931 AAATCATTAGGGGGTTAATTAGG + Intergenic
939649906 2:144747371-144747393 AAATCACAAGAGTATTGATTGGG - Intergenic
939796881 2:146656116-146656138 AAATCACAAGGGTATTGATTGGG + Intergenic
939822134 2:146970284-146970306 AAATTATAAGAGTATTGATTGGG + Intergenic
940156562 2:150662748-150662770 AAATCACAAGGGTATTGATTGGG + Intergenic
940436678 2:153664590-153664612 AAATTATAAGAGTATTGATTGGG + Intergenic
940487318 2:154312109-154312131 AAATCACAAGGGTATTGATTGGG + Intronic
940923945 2:159342871-159342893 ATATCATTAGTGTTTTGATAGGG - Intronic
940948614 2:159646507-159646529 AAATCACAAGGGTATTAATTGGG + Intergenic
941016380 2:160362119-160362141 AAAGAATTAGGGTCTTGCTCTGG + Intronic
941202320 2:162526852-162526874 AAATCACAAGGATATTGATTGGG + Intronic
941571194 2:167172880-167172902 AAATCACAAGAGTATTGATTGGG + Intronic
941669327 2:168274442-168274464 AAATTATTAGGCTCTTGGGTAGG + Intergenic
942312823 2:174671292-174671314 AAATCACAAGAGTATTGATTGGG - Intronic
942380763 2:175387828-175387850 AAATCACAAGGGTATTGATTGGG - Intergenic
943606668 2:189984631-189984653 AAATCACAAGGGTATTGATTGGG + Intronic
943872951 2:193025386-193025408 AAATTATAAGAGTATTGATTGGG - Intergenic
944151218 2:196560819-196560841 AAATTATAAGAGTATTGATTGGG - Intronic
944178571 2:196861854-196861876 AAATCACAAGGGTATTGATTAGG - Intronic
944397047 2:199280223-199280245 AAATCACAAGGGTATTGATCGGG - Intronic
944722147 2:202434566-202434588 AAATCAATATAGTCCTGATTTGG + Intronic
944760675 2:202810435-202810457 AAATCACAAGGGTATTGACTGGG - Intronic
944780023 2:203008188-203008210 AAATCACAAGGTTATTGATTGGG - Intronic
945357155 2:208854476-208854498 AAATTATAAGAGTGTTGATTGGG - Intronic
945371044 2:209018384-209018406 AAATCACAAGAGTATTGATTGGG - Intergenic
945456545 2:210057815-210057837 AAATCACAAGGGTATTGATTGGG - Intronic
945692848 2:213063288-213063310 AAATCAGTACTGTCTTGATCTGG - Intronic
945897166 2:215496910-215496932 AAATCACAAGGGTATTGACTGGG - Intergenic
947311812 2:228811161-228811183 AAATCTCTAGGGCTTTGATTTGG - Intergenic
947589278 2:231376054-231376076 AAATCACAAGGGTATTGACTGGG - Intergenic
947719269 2:232359698-232359720 AAGTCATTAGTAGCTTGATTGGG - Intergenic
948012817 2:234663532-234663554 AAATCACAAGAGTATTGATTGGG - Intergenic
1169107198 20:3006467-3006489 AAATTTTTAGGGTCTAGATGTGG - Intronic
1169280759 20:4264995-4265017 AAATCACAAGGGTATTGATTGGG + Intergenic
1169317537 20:4605491-4605513 AAATCAATAGAAACTTGATTTGG - Intergenic
1169613809 20:7414907-7414929 AAATCACAAGGGTATTGATTGGG + Intergenic
1169731825 20:8794257-8794279 AAATCACAAGGGTATTGATTGGG + Intronic
1169796931 20:9473008-9473030 AAATCTTTAAGGTAATGATTTGG + Intronic
1170506086 20:17027143-17027165 AAATCACAAGAGTATTGATTGGG - Intergenic
1170996865 20:21369943-21369965 AAATCTTTAGGATATTGGTTTGG - Intronic
1171000721 20:21413143-21413165 ACATCATTAGGTTGTTTATTTGG + Intergenic
1171492511 20:25531413-25531435 AAATCACAAGGGTATTGACTGGG + Intronic
1171777385 20:29381824-29381846 AAATCACAAGGGTATTGATTGGG - Intergenic
1172264434 20:33598694-33598716 AAATCACAAGAGTATTGATTGGG + Intronic
1172470314 20:35188904-35188926 AAATTATAAGAGTATTGATTGGG - Intergenic
1172568065 20:35946562-35946584 AAATCTATAGGGTCTTGAAAAGG - Intronic
1174260791 20:49293507-49293529 AAATCACAAGGGTATTGATTGGG - Intergenic
1175093200 20:56521537-56521559 AAATTATAAGAGTATTGATTGGG + Intronic
1176771756 21:13080871-13080893 AAATCACAAGGGTATTGATTGGG + Intergenic
1177588893 21:23135856-23135878 AAATCACAAGAGTATTGATTGGG + Intergenic
1177823115 21:26053469-26053491 AAGGTAGTAGGGTCTTGATTGGG - Intronic
1177910497 21:27025518-27025540 AAATCACAAGGGTATTGATTAGG - Intergenic
1177993911 21:28072379-28072401 AAATTATAAGAGTATTGATTGGG - Intergenic
1178014619 21:28329558-28329580 AAATCACAAGGGTATTGACTGGG + Intergenic
1178836178 21:36099522-36099544 AAATCACAAGGGTATTGACTGGG - Intergenic
1179003192 21:37483117-37483139 AAATCACAAGGGTATTGATTGGG + Intronic
1179184661 21:39075859-39075881 AAATCACAAGGGTATTGATTGGG + Intergenic
1179425347 21:41273742-41273764 AAATCACAAGAGTATTGATTGGG + Intronic
1179660877 21:42874262-42874284 AAATCACAAGGGTATTGACTGGG - Intronic
1179950253 21:44705207-44705229 AAATCACAAGGGTATTGACTGGG - Intronic
1180155691 21:45976498-45976520 AAATCACAAGGGTATTGACTGGG + Intergenic
1180436637 22:15311130-15311152 AAATCACAAGGGTATTGACTGGG + Intergenic
1180721521 22:17912382-17912404 AAATCATTGGGATTTTGATAGGG + Intronic
1180894612 22:19320722-19320744 AAATCACAAGGGTATTGACTGGG + Intergenic
1181377161 22:22468634-22468656 AAATCACAAGAGTATTGATTGGG - Intergenic
1181601632 22:23955741-23955763 AAATCACAACGGTATTGATTGGG - Intergenic
1181606870 22:23985557-23985579 AAATCATAAGGGTGTTGATTGGG + Intergenic
1181959634 22:26613578-26613600 AAAGCACAAGGGTATTGATTGGG - Intronic
1182382956 22:29908366-29908388 AAATGATTCTGGTCTTGCTTTGG - Intronic
1182386129 22:29942969-29942991 AAATCACAAGGGTATTGGTTGGG + Intronic
1182689317 22:32146979-32147001 AAATCACAAGGGTATTGATGGGG - Intergenic
1182894310 22:33846342-33846364 AAATCACAAGGGTATTGATTGGG - Intronic
1183171394 22:36190859-36190881 AAATCACAAGGGTATTGATTGGG + Exonic
1183625471 22:38998936-38998958 AAATCACAAGGGTATTGATTGGG + Intergenic
1183844058 22:40525752-40525774 AAATCATTAGGATATTTTTTAGG - Intronic
1184062886 22:42095353-42095375 AAATCACAAGGCTATTGATTGGG - Intergenic
1184632616 22:45795786-45795808 AAATTATAAGAGTGTTGATTAGG - Intronic
1184977531 22:48073479-48073501 AGATCTTTTGGGTCTTGAGTTGG + Intergenic
950064147 3:10097747-10097769 AAATCACAAGGGTATTGACTGGG + Intronic
950198657 3:11027594-11027616 AAATCACAAGAGTATTGATTGGG + Intronic
951398499 3:22201084-22201106 AAATCACAAGGGTATTGATTGGG + Intronic
951571494 3:24067982-24068004 TAATCATTAGGCTCTAGACTTGG - Intergenic
951750670 3:26031974-26031996 AATTCATTATGGTCTTGCTCTGG - Intergenic
951842702 3:27051290-27051312 AAATTATAAGAGTATTGATTGGG - Intergenic
952131429 3:30368611-30368633 AAATAAAAAGGGTATTGATTGGG - Intergenic
952725411 3:36578977-36578999 AAATCATAAGAGTATTGATTGGG + Intergenic
952728222 3:36612064-36612086 ATATAATTATGTTCTTGATTTGG - Intergenic
952933986 3:38381279-38381301 AAATCACAAGGGTATTGATTGGG - Intronic
953002679 3:38950083-38950105 AAATCATAAGGTACTTCATTGGG - Exonic
953509185 3:43518307-43518329 AAATTATAAGAGTGTTGATTGGG - Intronic
953519543 3:43628352-43628374 AAATCACAAGGGTATTGACTGGG - Intronic
953900823 3:46842259-46842281 AAGTCATTGGGGTTTTGATAGGG - Intergenic
954219315 3:49143292-49143314 AAATCACAAGGGTATTGATTGGG + Intergenic
955514911 3:59716827-59716849 AAATTATAAGAGTATTGATTGGG + Intergenic
956234988 3:67059868-67059890 AAACCACAAGGGTATTGATTAGG - Intergenic
956337813 3:68184374-68184396 AAATTATTAGAGTCTGTATTTGG + Intronic
956362821 3:68467315-68467337 AAATTATAAGAGTATTGATTAGG + Intronic
956552579 3:70478483-70478505 AAATTATAAGGGTATTGATTGGG - Intergenic
956715521 3:72076437-72076459 AAATTATAAGAGTATTGATTGGG + Intergenic
957119368 3:76069971-76069993 AAATCACAAGGGTATTGATTGGG - Intronic
957354099 3:79059702-79059724 AAATTATAAGAGTATTGATTGGG - Intronic
957457262 3:80467531-80467553 ACATCACAAGGGTATTGATTGGG + Intergenic
957623129 3:82621317-82621339 AAATTATAAGAGTATTGATTGGG + Intergenic
957756210 3:84491720-84491742 AAATCACAAGAGTATTGATTGGG - Intergenic
957778882 3:84792916-84792938 AAATTATAAGGGTATTGATTGGG - Intergenic
957874874 3:86131875-86131897 AAATCACAAGGGTATTGATTGGG + Intergenic
957926651 3:86822531-86822553 AAACCACAAGGGTATTGATTGGG + Intergenic
958271174 3:91501565-91501587 AAATCACAAGGGTATTGACTGGG - Intergenic
958509044 3:95022012-95022034 AAATCACAAGGGTATTGATTGGG - Intergenic
958603324 3:96327313-96327335 AAATCACAAGGGTATTGATTGGG - Intergenic
958625318 3:96615333-96615355 AAATCACAAGGGTATTAATTGGG + Intergenic
958684160 3:97371468-97371490 AAATCACAAGGGTATTGATTGGG - Intronic
958722122 3:97856447-97856469 AAATCACAATGGTATTGATTGGG + Intronic
958752837 3:98212960-98212982 AAATCACAAGGGTATTGATTGGG - Intergenic
958964260 3:100541037-100541059 ATCTCATTATGGTTTTGATTTGG + Intronic
958999047 3:100940233-100940255 AAATCACAAGGGTACTGATTGGG + Intronic
959118874 3:102209243-102209265 AAATCACAAGGGTATTGATTGGG + Intronic
959126311 3:102294123-102294145 AAATCACAAGGGTATTGAATGGG - Intronic
959224598 3:103563885-103563907 AAATTATAAGGGTATTGATTGGG - Intergenic
959470484 3:106744147-106744169 AAATCATAAGGGTATTGATTGGG - Intergenic
959936701 3:112036932-112036954 AAATTATGAGAGTATTGATTGGG - Intronic
959939031 3:112060812-112060834 AAATCACAAGGTTATTGATTGGG + Intronic
960112887 3:113862674-113862696 AAATCACAAGGGTATTGACTGGG + Intronic
960308509 3:116091441-116091463 AAATCACAAGGGTATTGATTGGG + Intronic
960374301 3:116879292-116879314 AAATCACAAGGGTATTGACTGGG + Intronic
960889806 3:122435749-122435771 AAATTATAAGAGTATTGATTGGG - Intronic
961698106 3:128720546-128720568 AAATCACAAGGGTATTGATTGGG - Intergenic
961909284 3:130298492-130298514 AAATCACAAGGGTATTGATTGGG - Intergenic
961922651 3:130444349-130444371 AAATCACAAGGGTATTGATTGGG + Intronic
961923718 3:130453196-130453218 AAATCACAAGAGTATTGATTGGG + Intronic
962290453 3:134131927-134131949 AAATCACAAGGGTATTGATTGGG + Intronic
962651501 3:137498511-137498533 AAATCACAAGGGTATTGATTGGG - Intergenic
962765380 3:138557417-138557439 AAATCACAAGGGTATTGATTGGG + Intronic
962841624 3:139238050-139238072 AAAACATAAAGGTCTGGATTGGG - Intronic
963176630 3:142304470-142304492 AAATCACAAGGGTATTGATTGGG + Intergenic
963349773 3:144138075-144138097 AAATCACAAGGGTATTGACTGGG + Intergenic
963415013 3:144983963-144983985 AAATCACAAGGGTATTGATTGGG + Intergenic
963499945 3:146113612-146113634 AAATCACAAGAGTATTGATTAGG - Intronic
963519507 3:146346635-146346657 AAATCACAAGGGTATTGATTGGG - Intergenic
963659854 3:148111954-148111976 AAATCACAAGGGTATTGATTGGG - Intergenic
963663968 3:148159063-148159085 AAATCACAAGGGTATTGATTGGG - Intergenic
964196182 3:154067534-154067556 AAATCCCAAGGGTATTGATTGGG - Intergenic
964754528 3:160081709-160081731 AAATCACAAGGGTATTGATTGGG + Intergenic
964840138 3:160984572-160984594 AAATCACAAGAGTATTGATTGGG + Intronic
964880460 3:161417697-161417719 AAATCACAAGGGTATTGACTGGG + Intergenic
964945829 3:162222533-162222555 AAATCACAAGGGTATTGATTGGG - Intergenic
965400783 3:168209973-168209995 AAATCACAAGGGTATTGATTGGG + Intergenic
965885317 3:173438213-173438235 AAATTAAAAGGGTTTTGATTTGG - Intronic
966124796 3:176563495-176563517 AAATCACAAGGGTATTGACTGGG - Intergenic
966142526 3:176772125-176772147 AAATCACAAGGGTATTGATTGGG - Intergenic
966817277 3:183899602-183899624 AAATCACAAGGGTATTGACTGGG - Intergenic
967412836 3:189183931-189183953 AAATCACAAGGGTATTGATTGGG + Intronic
967497806 3:190161755-190161777 AAATCACAAGGGTATTGATTGGG - Intergenic
967567103 3:190986246-190986268 AAATCACAAGGGTTTTGATTGGG - Intergenic
967590166 3:191263768-191263790 AAATCATTATGCTCTTCAATTGG - Intronic
968192951 3:196683917-196683939 AAATCACAAGGGTATTGATTGGG + Intronic
968212217 3:196858359-196858381 AAATCATAAGGGTATTGATTGGG + Intergenic
968367788 3:198200532-198200554 AAATCACAAGGGTATTGATTGGG + Intergenic
968420928 4:484209-484231 AAGTCACAAGGGTATTGATTGGG - Intronic
969008712 4:4042981-4043003 AAATCACAAGGGTATTGATTGGG + Intergenic
969009378 4:4048952-4048974 AAATCACAAGGGTATTGATTGGG + Intergenic
969033710 4:4233512-4233534 AAATCATTACAGTCCTGATTTGG - Intergenic
969273373 4:6118073-6118095 AAATCACAAGGGTATTGATTGGG + Intronic
969420002 4:7088186-7088208 AAACCATTAGGTTCTAGATAAGG - Intergenic
969586786 4:8098454-8098476 AAATGTTGAGGGTCTTGCTTTGG - Intronic
969744976 4:9063372-9063394 ATATCACAAGGGTATTGATTGGG - Intergenic
970342352 4:15120196-15120218 AAATCACAAGGGTGTTAATTGGG - Intergenic
970719635 4:18971284-18971306 AAATTATAAGAGTATTGATTGGG + Intergenic
971010777 4:22431842-22431864 AAATGTTTGGGGTCTTTATTTGG + Intronic
971285350 4:25283955-25283977 AAATCTTTTGGTTCTTAATTGGG - Intergenic
971365774 4:25975991-25976013 AAATCACAAGGGTATTGATTGGG - Intergenic
971536415 4:27756868-27756890 AAATTATTAGTGTCTTTCTTAGG + Intergenic
971586381 4:28409675-28409697 AAATCACAAGGGTATTGATTGGG + Intergenic
971603908 4:28632074-28632096 AAATTATAAGAGTATTGATTGGG + Intergenic
971987606 4:33846405-33846427 AAATCACAAGGGTATTGATTGGG + Intergenic
972839320 4:42912771-42912793 AAATCATTAGTGTTATGGTTTGG + Intronic
972847396 4:43006106-43006128 AAATCACAAGAGTATTGATTGGG - Intronic
973040160 4:45459933-45459955 AAATCACAAGAGTATTGATTGGG - Intergenic
973585841 4:52390230-52390252 ATATCACAAGGGTATTGATTGGG - Intergenic
973615442 4:52673122-52673144 AAATCACAAGGGTATTGATTGGG + Intergenic
973881869 4:55280945-55280967 AAATCACAAGGGTATTGATTGGG - Intergenic
973943658 4:55935714-55935736 AAATCACAAGAGTATTGATTGGG - Intergenic
973976178 4:56264701-56264723 AAATTATAAGAGTATTGATTGGG + Intronic
974199386 4:58619753-58619775 AAATCACAAGAGTATTGATTGGG - Intergenic
974214791 4:58830392-58830414 AAATCACCAGGGTATTGATTGGG + Intergenic
974252303 4:59402479-59402501 ATCTCATTGTGGTCTTGATTTGG - Intergenic
974399704 4:61387851-61387873 AAATCACAAGGGTATTGATTGGG + Intronic
974472715 4:62338811-62338833 AAATCACAAGGGTATTGACTGGG + Intergenic
974727064 4:65811317-65811339 AAATCACAAGAGTATTGATTGGG + Intergenic
974983275 4:68988823-68988845 AAATCACAAGGGTATTGATTGGG - Intergenic
974986506 4:69034017-69034039 AAATTATAAGAGTATTGATTGGG - Intronic
975024851 4:69535280-69535302 AAATCACAAGGGTATTGATTGGG - Intergenic
975248927 4:72154175-72154197 AAATCACAAGGGTATTGATTGGG + Intergenic
975587462 4:75964838-75964860 AAATCACAAGAGTATTGATTGGG - Intronic
975605905 4:76154304-76154326 AAATCACAAGGGTATTGACTGGG - Intergenic
975807753 4:78130645-78130667 AAATCCTTAGTGCCTGGATTGGG - Intronic
975826946 4:78330242-78330264 AAATCACAAGGGTATTGATTGGG - Intronic
975889491 4:79010005-79010027 GAATTGTTAGGGTGTTGATTTGG + Intergenic
975954860 4:79825263-79825285 AAATCACAAGGGTATTGATTGGG + Intergenic
976375456 4:84340416-84340438 AAATCACAAGGGTATTGATTGGG + Intergenic
976437385 4:85033642-85033664 AAATCACAAGAGTTTTGATTAGG - Intergenic
976816260 4:89150951-89150973 AAATCACAAGGGTATTGACTGGG - Intergenic
977140519 4:93365962-93365984 AAATCACAAGGGTATTGATTGGG - Intronic
977233540 4:94480280-94480302 TTACCATTAAGGTCTTGATTTGG + Intronic
977388840 4:96382090-96382112 AAATCACAAGGGTATTGATTGGG + Intergenic
977473454 4:97473010-97473032 AAATCACAAAGGTATTGATTGGG - Intronic
977820743 4:101469940-101469962 AAAGTATTATGGTCTAGATTAGG + Intronic
978023950 4:103848922-103848944 AAATCACAAAGGTATTGATTGGG + Intergenic
978211919 4:106147605-106147627 AAATCACAAGGGTACTGATTGGG - Intronic
978625652 4:110682262-110682284 AAATCATTAGGGTTTCTATGAGG - Intergenic
979137075 4:117123623-117123645 AAATCACAAGGGTATTGATTGGG - Intergenic
979147659 4:117265301-117265323 AAATCACAAGGGTATTGATTGGG + Intergenic
979151389 4:117320511-117320533 AAATCATGAGTGTTCTGATTTGG + Intergenic
979195844 4:117919352-117919374 AAATCACAAGGGTATTGACTGGG - Intergenic
979256209 4:118610248-118610270 AAATCACAAGGGTATTGATTAGG + Intergenic
979332139 4:119430288-119430310 AAATCACAAGGGTATTGATTAGG - Intergenic
979678218 4:123432775-123432797 AAATCACAAGGGTATTGATTGGG - Intergenic
979964253 4:127058926-127058948 ACATCATTAGGTTGTTTATTTGG - Intergenic
979970151 4:127124438-127124460 AAATCATAAGGGTATTGATTGGG + Intergenic
979993780 4:127407231-127407253 AAATTATAAGAGTATTGATTGGG - Intergenic
980073328 4:128266133-128266155 AAATTATAAGAGTATTGATTGGG + Intergenic
980231927 4:130056746-130056768 AAATCACAAGGGTATTGATTGGG - Intergenic
980278349 4:130684686-130684708 AAATCACAAGGGTATTGATTGGG + Intergenic
980313238 4:131162685-131162707 AAATCACGAGGGTATTGATTGGG + Intergenic
980337680 4:131496852-131496874 AAATTATAAGAGTATTGATTGGG + Intergenic
980577157 4:134698480-134698502 AAATTATAAGAGTATTGATTGGG - Intergenic
980646861 4:135653377-135653399 AAATCACAAGGATATTGATTAGG + Intergenic
981190340 4:141855210-141855232 AAATTATAAGAGTATTGATTGGG - Intergenic
981263630 4:142753966-142753988 AAATTATTAGGAGCTGGATTGGG - Intronic
981338136 4:143589779-143589801 AAGTCATTGGTGTCTTGATGGGG + Intronic
981421197 4:144551966-144551988 AAATCACAAGGGTATTGACTGGG + Intergenic
981448311 4:144866500-144866522 AAATCACAAGGGTATTGATTGGG - Intergenic
981739802 4:147989848-147989870 AAATCACAAGGATATTGATTGGG + Intronic
982175429 4:152701560-152701582 AAATCACAAGGGTATTGATTGGG + Intronic
982479479 4:155891687-155891709 AAATTATAAGAGTATTGATTGGG + Intronic
982807815 4:159788677-159788699 AAATCACAAGGGTATTGATTGGG - Intergenic
983419057 4:167495154-167495176 AAATCACAAGGGTATTGACTGGG - Intergenic
983863573 4:172736624-172736646 AAATTATAAGAGTATTGATTAGG + Intronic
983894222 4:173064292-173064314 AAATCACAAGCGTATTGATTGGG + Intergenic
983935065 4:173496785-173496807 TAATCATCAGGGTCCTGTTTTGG - Intergenic
983973801 4:173907548-173907570 AAATGATTAGGGCCATGTTTTGG - Intergenic
984064311 4:175028974-175028996 AAATCACAAGGGTATTGACTGGG + Intergenic
985037641 4:185857311-185857333 AAATTATAAGAGTATTGATTGGG - Intronic
986122059 5:4848704-4848726 CAATCATGAGATTCTTGATTGGG - Intergenic
986416160 5:7530314-7530336 AGGTCATTTGGGTTTTGATTAGG - Intronic
987571980 5:19675768-19675790 AAATCACAAGAGTATTGATTGGG + Intronic
987583331 5:19823303-19823325 GAATCACAAGGGTATTGATTGGG + Intronic
987689695 5:21251221-21251243 AAATCACAAGAGTATTGATTGGG - Intergenic
987768781 5:22272308-22272330 AGAGCATTAGGGTCTTGCTCTGG + Intronic
988046927 5:25968803-25968825 AAATCACAAGAGTATTGATTGGG - Intergenic
988222674 5:28369192-28369214 AAAGCACAAGGGTATTGATTGGG + Intergenic
988343377 5:30005386-30005408 AAATCACAAGGGTATTGGTTGGG - Intergenic
988717683 5:33844073-33844095 AAATCACAAGGGTATTGATTGGG - Intronic
988830504 5:34982413-34982435 AAATCACAAGGGTGTTGATCGGG + Intergenic
988946766 5:36211163-36211185 AAATTATAAGAGTATTGATTGGG + Intronic
989231203 5:39088283-39088305 ACATCATTAGGTTGTTAATTTGG - Intergenic
989317830 5:40103095-40103117 AAATCACAAGGGTATTGATTGGG - Intergenic
989318856 5:40111895-40111917 AAATCACAAGGGTATTGATTGGG - Intergenic
989455002 5:41634179-41634201 AAATCACAAGGGTATTGATTGGG - Intergenic
989484394 5:41972319-41972341 ATAGCATTATGTTCTTGATTTGG - Intergenic
989513967 5:42320191-42320213 AAATTATAAGAGTGTTGATTGGG + Intergenic
989580147 5:43025008-43025030 AAATCACAAGGGTATTGATTGGG - Intergenic
989624304 5:43414796-43414818 AAATCACAAGGATATTGATTGGG - Intergenic
989698977 5:44239299-44239321 AAATCACAAGGATATTGATTAGG - Intergenic
989829122 5:45892196-45892218 AAATTATAAGAGTATTGATTGGG + Intergenic
990300430 5:54444445-54444467 AAATCACAAGAGTATTGATTGGG - Intergenic
990302420 5:54462031-54462053 AAATCACAAGGGTATTGATTGGG + Intergenic
990346369 5:54875766-54875788 AAATCACAAGGATATTGATTGGG - Intergenic
990395648 5:55375701-55375723 AAATCACAAGGGTATTGATTGGG + Intronic
990474391 5:56147618-56147640 AAGTAATTTGGGTCTTGATTTGG - Intronic
991137192 5:63195672-63195694 AAATCACAAGGGTATTGATTGGG - Intergenic
991250726 5:64558438-64558460 AAATTATAAGGGTATTGATTGGG - Intronic
991376507 5:65973674-65973696 AAGTAATTAGTGTCTTGAATTGG + Intronic
991625970 5:68601452-68601474 AAATCACAACGGTATTGATTGGG - Intergenic
991712510 5:69422037-69422059 AAATCACAAGGGTATTGATTGGG - Intronic
991991669 5:72345499-72345521 AAATCACAAGGGTATTGATTGGG + Intronic
992160340 5:73994628-73994650 AAATCACAAGGGTATTGACTGGG + Intergenic
992860376 5:80903207-80903229 AAATTATAAGAGTATTGATTGGG + Intergenic
992955123 5:81900708-81900730 AAATCACAAGGGTATTGATTGGG - Intergenic
993411241 5:87576040-87576062 AAATTATAAGAGTATTGATTGGG - Intergenic
993891095 5:93474719-93474741 AAGTCATGAGAGTCATGATTAGG - Intergenic
994570897 5:101512793-101512815 AAATCACAAGAGTATTGATTAGG - Intergenic
994734288 5:103533333-103533355 AAATCACAAGGGTATTGATTGGG - Intergenic
994812969 5:104546660-104546682 AAATTATAAGAGTATTGATTGGG - Intergenic
995050399 5:107696840-107696862 AAATCATCAGGGTCTGGAAGTGG + Intergenic
995098948 5:108274626-108274648 AAATCACAAGGGTATTGACTGGG + Intronic
995119954 5:108525699-108525721 AAATCACAAGGGTATTGATTGGG - Intergenic
995149490 5:108825656-108825678 AAATCACAAGGGTATTGATTGGG + Intronic
995371222 5:111420997-111421019 AAATCACAAGGGTATTGATTGGG + Intronic
995594016 5:113729605-113729627 AAATCACAAGGGTATTGATTGGG + Intergenic
995674147 5:114643478-114643500 AAATCACAAGGGCATTGATTGGG - Intergenic
995765329 5:115609799-115609821 AAATTGTTAGGATTTTGATTGGG - Intronic
996100029 5:119436396-119436418 AAATCACAAGGGTATTGATTGGG - Intergenic
996104325 5:119481147-119481169 AAATCATAAGGGTATTGACTGGG + Intronic
997089694 5:130842730-130842752 AAATCACAAGGGTATTGATTGGG - Intergenic
997244879 5:132338946-132338968 AAATCACAAGGGTGTTGATTGGG + Intronic
997491955 5:134285022-134285044 AAATTATAAGAGTATTGATTGGG + Intergenic
997719807 5:136069053-136069075 ATATCATTAGGATTTTGATATGG + Intergenic
997765524 5:136499649-136499671 AAATCACAAGGGTATTGAATGGG + Intergenic
997901292 5:137767730-137767752 AAATCATGAGAGTATTGATTGGG - Intergenic
997920722 5:137976730-137976752 AAATCACAAGGGTATTGATTGGG - Intronic
998259806 5:140621430-140621452 AAATCACAAGGGTATTGACTGGG - Intergenic
998585234 5:143420293-143420315 AAATCACAAGGGTATTGATTGGG + Intronic
998641905 5:144021007-144021029 AAATCACAAGGGTATTGACTGGG - Intergenic
998647630 5:144081148-144081170 AAATTATAAGAGTATTGATTGGG - Intergenic
998939964 5:147271286-147271308 AAATCACAAGGGTATTGACTGGG - Intronic
999093284 5:148956185-148956207 AAATCACAAGGGTATTGATTGGG + Intronic
999308644 5:150537081-150537103 AAATCACAAGAGTATTGATTGGG - Intronic
999457558 5:151730250-151730272 AAATCACAAGGGTATTGATTGGG + Intergenic
1000004389 5:157169719-157169741 AAATCACAAGGGTATTGATTGGG - Intronic
1000471825 5:161652481-161652503 AAAGCACAAGGGTATTGATTGGG + Intronic
1000487620 5:161867741-161867763 AAAGCGTTTGGGTCTTGATTTGG - Intronic
1000562598 5:162809580-162809602 AAATCACAAGCGTATTGATTGGG - Intergenic
1000615207 5:163418695-163418717 AAATCACAAGGGTATTGATTGGG - Intergenic
1000735456 5:164893644-164893666 AAATTATAAGAGTATTGATTGGG + Intergenic
1001189723 5:169618439-169618461 AAATCACAAGGGTATTGACTGGG - Intergenic
1002651558 5:180700240-180700262 AAATCACAAGGTTATTGATTGGG - Intergenic
1002727009 5:181305761-181305783 AAATCACAAGGGTATTGATTGGG + Intergenic
1003068771 6:2927677-2927699 AAATCACAAGGGTATTGATTGGG - Intergenic
1003079490 6:3009528-3009550 AAATCACATGGGTATTGATTGGG + Intronic
1004164590 6:13244879-13244901 AAATCACAAGGGTATTGATTGGG + Intronic
1004267270 6:14159688-14159710 AAATTATAAGAGTATTGATTGGG + Intergenic
1004440636 6:15648831-15648853 ATGTCATTGGGGTTTTGATTGGG - Intronic
1004474348 6:15957193-15957215 AAATCATTTGGTTCTTGAATAGG + Intergenic
1004778199 6:18872853-18872875 AAATCACAAGGGTATTGATTGGG - Intergenic
1005132322 6:22523686-22523708 AAATCACAAGGGTATTGATTGGG - Intergenic
1005133630 6:22541586-22541608 AGATCATTAGGGTCTGGATGGGG - Intergenic
1005501575 6:26433488-26433510 AAATCACAAGAGTATTGATTGGG - Intergenic
1005693367 6:28328717-28328739 AAATCACAAGGGTATTGATTGGG + Intronic
1005971506 6:30765410-30765432 AAATCACAAGGGTATTGACTGGG + Intergenic
1006218418 6:32466335-32466357 AAATCACAAGGGTATTGATTGGG + Intergenic
1006238435 6:32656607-32656629 AAATCACAAGGGTATTGATTGGG + Intergenic
1006418120 6:33917153-33917175 AAATCACAAGGGTATTGATTGGG + Intergenic
1006661719 6:35652126-35652148 AAATCACAAGGGTATTGATTGGG - Intronic
1006720816 6:36149197-36149219 AAATCACAAGGGTATTGACTGGG + Intergenic
1007477808 6:42130568-42130590 AAATGATTAGGGCCTTGCCTAGG - Intronic
1008100431 6:47384893-47384915 AAATCACAAGGGTATTGATTGGG - Intergenic
1008170670 6:48201934-48201956 AAATCACGAGGGTATTGATTGGG - Intergenic
1008251288 6:49243001-49243023 AAATCACAAGGGTATTGATTGGG + Intergenic
1008585418 6:52944093-52944115 AAATCACAAGGGTATTGACTGGG - Intergenic
1008909969 6:56721390-56721412 AAATCACAAGGGTATTGACTGGG + Intronic
1008983963 6:57519744-57519766 AAATCACAAGGGTATTGATTGGG + Intronic
1009039026 6:58155565-58155587 AAATTATAAGAGTATTGATTGGG - Intergenic
1009172025 6:60412652-60412674 AAATCACAAGGTTATTGATTGGG + Intergenic
1009296480 6:61957129-61957151 AAACCACAAGGGTATTGATTGGG - Intronic
1009536165 6:64889683-64889705 AAATCACAAGGGTATTGACTGGG - Intronic
1009544104 6:65002889-65002911 AAATCACTAGGATATTGATTGGG - Intronic
1009719885 6:67454983-67455005 TGATCATTAAGGTGTTGATTTGG + Intergenic
1009766698 6:68086191-68086213 AAATTATAAGAGTATTGATTGGG + Intergenic
1010103039 6:72132195-72132217 AAATCACAAGGGTATTGATTGGG + Intronic
1010305118 6:74310692-74310714 AAATCACAAGGGTATTGATTGGG + Intergenic
1010485453 6:76406848-76406870 AAATCACAAGGGTATTGACTGGG + Intergenic
1010489846 6:76461973-76461995 AAATCACAAGGGTATTGATTGGG + Intergenic
1011066040 6:83327091-83327113 AAATCACAAGGGTATTGATTGGG - Intronic
1011124760 6:83995368-83995390 AAATCACAAGGGTATTGATTGGG - Intergenic
1011157752 6:84352289-84352311 AAGTCATTGGAGACTTGATTGGG + Intergenic
1011507529 6:88063058-88063080 AAATCATTAGGATAATGAATAGG + Intronic
1011874409 6:91939380-91939402 AAGTCATTGGTGGCTTGATTGGG - Intergenic
1011878504 6:91992721-91992743 AAATCACAAGGGTATTGACTGGG + Intergenic
1011959755 6:93073117-93073139 AAATCACAAGGGTATTGATTGGG - Intergenic
1012076922 6:94699920-94699942 AAATTATTATTGTGTTGATTGGG + Intergenic
1012122710 6:95387293-95387315 AAATCACAAGGGTATTGATTGGG + Intergenic
1012143367 6:95651023-95651045 AAATCACAAGGGTATTGATTGGG - Intergenic
1012460645 6:99456615-99456637 AAATCACAAGGGTATTGATTGGG - Intronic
1012960400 6:105615941-105615963 AAATCACAAGGGTATTGATTGGG + Intergenic
1012990518 6:105921233-105921255 AAAGAATTTGGGTCTTGATGTGG + Intergenic
1013346766 6:109268312-109268334 AAATCACAAGGGTATTGATTGGG - Intergenic
1013560574 6:111300722-111300744 AAATTATAAGAGTATTGATTGGG - Intronic
1013833141 6:114298812-114298834 AAATCACAAGGGTATTGATTGGG - Intronic
1013865280 6:114689182-114689204 AAATCACAAGGGTATTGATTGGG + Intergenic
1013923654 6:115441222-115441244 AAATCACAAGGGTATTAATTGGG + Intergenic
1014119949 6:117713092-117713114 AAATCACAAGGGTATTGATTGGG + Intergenic
1014251355 6:119118637-119118659 AAATCACAAGGGTATTGATTGGG - Intronic
1014269330 6:119318894-119318916 AAATTATTAGGGTGTTCTTTTGG - Intronic
1014290613 6:119553712-119553734 AAATCACAAGGGTATTGATTGGG - Intergenic
1015180886 6:130361160-130361182 AAATCACAAGGATATTGATTGGG + Intronic
1016193040 6:141294308-141294330 AAATCACAAGGGTATTGACTGGG + Intergenic
1016586865 6:145697965-145697987 AAATCACAAGGGTATTAATTGGG + Intronic
1016632050 6:146244231-146244253 AAATCACAAGAGTATTGATTAGG + Intronic
1016789717 6:148055270-148055292 AAATCACAAGAGTATTGATTGGG + Intergenic
1016865869 6:148765644-148765666 AAATCATGAGAGTATTGATTGGG + Intronic
1018712143 6:166504908-166504930 AAATCATTTGGCTCTGGAGTAGG + Intronic
1019002896 6:168770418-168770440 AAATTATAAGAGTATTGATTGGG + Intergenic
1019156551 6:170042945-170042967 ATAACAGTCGGGTCTTGATTTGG - Intergenic
1019512434 7:1424378-1424400 AAACCAATAGGGTGTTGACTTGG + Intergenic
1020020502 7:4864182-4864204 AAATCATTGGGGTCATGGGTTGG - Intronic
1020048526 7:5063076-5063098 AAATCACAAGGGTATTGATTGGG + Intronic
1020387810 7:7626863-7626885 AAATCACAAGGGTATTGGTTGGG + Intergenic
1020738533 7:11983966-11983988 AAATCACAAGAGTATTGATTAGG + Intergenic
1020803563 7:12760923-12760945 AAATCACAAGGGTATTGATTGGG + Intergenic
1020909390 7:14109400-14109422 AAATCACAAGGGTATCGATTGGG + Intergenic
1021020122 7:15587379-15587401 AAATCACAAGAGTATTGATTGGG + Intergenic
1021139326 7:17004250-17004272 AAATCACAAGAGTATTGATTGGG + Intergenic
1021747194 7:23753817-23753839 AAATGTTTTGGGTCTTTATTTGG + Intronic
1023016890 7:35977313-35977335 AAATCACAAGGGTATTAATTGGG + Intergenic
1023565981 7:41524059-41524081 AAATCACAAGGGTATTGATTGGG + Intergenic
1024010532 7:45262504-45262526 AAATCAAAACGGTATTGATTGGG - Intergenic
1024213026 7:47223249-47223271 AAATCACAAGGGTATTGATTGGG - Intergenic
1024408872 7:49015456-49015478 AAATCACAAGAGTATTGATTGGG + Intergenic
1024497479 7:50064889-50064911 AAATCACAAGGGTATTGATTGGG + Intronic
1024572536 7:50735394-50735416 ATATCATTAGGATATTGATAGGG - Intronic
1024586365 7:50845310-50845332 AAATCAAAAGGGTATTGATTGGG - Intergenic
1024756731 7:52541971-52541993 AAATTATAAGAGTATTGATTGGG + Intergenic
1025009703 7:55386233-55386255 AAATCACAAGGATATTGATTGGG + Intronic
1025116698 7:56264332-56264354 AAATCACAAGGGTATTGATTGGG - Intergenic
1025155295 7:56599782-56599804 AAATCACAAGGGTATTGATTGGG + Intergenic
1025229351 7:57190568-57190590 AAATCAATTGGTTATTGATTAGG - Intergenic
1025723022 7:64033562-64033584 AAATTATAAGTGTATTGATTGGG + Intronic
1025734704 7:64136748-64136770 AAATCACAAGGGTATTGATTGGG - Intronic
1025749545 7:64281443-64281465 AAATCACAAGAGTATTGATTGGG + Intergenic
1025760009 7:64381033-64381055 AAATCACAAGGGTATTGATTGGG - Intergenic
1025870073 7:65423074-65423096 AAATTATAAGGGTATTGATTGGG - Intergenic
1026137051 7:67672768-67672790 AAATCATGAGGCTCTGGACTTGG + Intergenic
1026286715 7:68969631-68969653 TAATTATTAGGATCTTGGTTTGG - Intergenic
1026300415 7:69092795-69092817 AAATCAGGAGGGTCATGATGAGG + Intergenic
1026412632 7:70140663-70140685 CAAAGATTAGGGTCTTTATTTGG - Intronic
1027342093 7:77220513-77220535 AAATTATAAGAGTATTGATTGGG + Intronic
1027628739 7:80576239-80576261 AAATCACAAGGGTATTGATTGGG - Intronic
1027793295 7:82659335-82659357 AAATCACAAGGGTATTGAATGGG + Intergenic
1027976087 7:85157980-85158002 AAATCACAAGGGTATTGATTGGG - Intronic
1028330485 7:89584611-89584633 AAATTATAAGAGTGTTGATTGGG + Intergenic
1028400807 7:90423600-90423622 AAATCACAAGGGTATTGATTGGG - Intronic
1028435175 7:90794801-90794823 AAATCACAAGAGTATTGATTGGG + Intronic
1028539434 7:91925857-91925879 AAATCACAAGGGTATTGACTGGG + Intergenic
1028787101 7:94807754-94807776 AAATCACAAGGGTATTGATTGGG + Intergenic
1029068337 7:97874472-97874494 AAATCACAAGGGTATTGATTAGG + Intergenic
1029370168 7:100145046-100145068 AAATCACAAGGGTATTGATTGGG + Intergenic
1030071027 7:105697662-105697684 AAATCACAAGGGTATTGATTGGG + Intronic
1030139455 7:106290202-106290224 AAATGACTGGGGTCTGGATTGGG + Intergenic
1030265813 7:107620864-107620886 TAAACTTTAGGCTCTTGATTGGG - Exonic
1030267989 7:107640298-107640320 AAACCAATAGGGTCTTGGTGGGG - Intergenic
1030411282 7:109183075-109183097 AAATTATAAGAGTATTGATTGGG + Intergenic
1030599151 7:111572807-111572829 AAATCACAAGGGTATTGATTGGG + Intergenic
1030663609 7:112249790-112249812 AAATCACAAGGGTATTGACTGGG - Intronic
1030886836 7:114949224-114949246 AAATTATTTGGGTCATTATTGGG + Intronic
1031229375 7:119085492-119085514 AAATCACAAGGGTATTGATTGGG + Intergenic
1031426941 7:121616687-121616709 AAATCACAAGGGTATTGATTGGG - Intergenic
1031513836 7:122678914-122678936 AAATTATAAGAGTATTGATTGGG - Intronic
1031560032 7:123227501-123227523 AAATCACAAGGGTATTGATTGGG - Intergenic
1031636102 7:124103073-124103095 AAATCACAAGAGTATTGATTGGG - Intergenic
1031763080 7:125738369-125738391 AAATTATAAGAGTATTGATTGGG + Intergenic
1031838187 7:126704285-126704307 AAATCACAAGGATATTGATTGGG - Intronic
1031930530 7:127680815-127680837 AAATCACAAGGGTATTGATTGGG + Intronic
1032048532 7:128630979-128631001 AAATCACAGGGGTATTGATTGGG + Intergenic
1032937147 7:136746021-136746043 AAATCACAAGAGTATTGATTGGG + Intergenic
1033677142 7:143553797-143553819 AAATCACAAGAGTTTTGATTGGG + Intergenic
1033694693 7:143775640-143775662 AAATCACAAGAGTTTTGATTGGG - Intergenic
1033721171 7:144060860-144060882 AAATCACAAGGGTATTGATTGGG - Intergenic
1033859389 7:145606493-145606515 AAATCACAAGGGTATTGATTGGG - Intergenic
1034363517 7:150523585-150523607 AAATCACAAGGGTATTGATTGGG + Intergenic
1034583903 7:152071633-152071655 AAATCACAAGGGTATTGATTGGG + Intronic
1034609358 7:152351770-152351792 AAATCACAAGGGTATTGATTGGG - Intronic
1034897603 7:154887489-154887511 AAATCATTTGGGTCTTTACAAGG - Intronic
1034929583 7:155151115-155151137 AAATCACAAGGGTATTGATTGGG - Intergenic
1035123623 7:156591052-156591074 AAATCACAAGGGTATTGACTGGG - Intergenic
1035572905 8:685508-685530 AAATTATAAGAGTATTGATTGGG + Intronic
1035592685 8:828672-828694 AAATCACAAGGGTACTGATTGGG + Intergenic
1035719566 8:1781687-1781709 ACAGAATTAGGGTCTAGATTGGG - Exonic
1036158301 8:6362943-6362965 AAATCACAAGGGTATTGACTGGG - Intergenic
1036249988 8:7153639-7153661 AAATCACAAGGGTATTGATTGGG + Intergenic
1036250662 8:7159627-7159649 AAATCACAAGGGTATTGATTGGG + Intergenic
1036366826 8:8127827-8127849 AAATCACAAGGGTATTGATTGGG - Intergenic
1036367505 8:8133798-8133820 AAATCACAAGGGTATTGATTGGG - Intergenic
1036496005 8:9270507-9270529 AAATCACAAGAGTATTGATTGGG + Intergenic
1036877248 8:12483711-12483733 AAATCACAAGGATATTGATTGGG + Intergenic
1036883375 8:12531863-12531885 AAATCACAAGGGTATTGATTGGG + Intergenic
1036884054 8:12537834-12537856 AAATCACAAGGGTATTGATTGGG + Intergenic
1036913516 8:12781424-12781446 ATGTCATTAGTGTTTTGATTGGG + Intergenic
1037038364 8:14198865-14198887 AAATCACAAGAGTATTGATTGGG - Intronic
1037894941 8:22645722-22645744 GAATCATTATGGTCTATATTAGG + Intronic
1038287993 8:26223142-26223164 TCAGCATTAGGGTCTTGCTTTGG + Intergenic
1038786622 8:30623038-30623060 AAATCACAAGGGTATTGACTGGG + Intronic
1038991845 8:32876955-32876977 AAATCACAAGAGTATTGATTGGG - Intergenic
1040025617 8:42779186-42779208 AAATCACAAGGGTATTGACTGGG + Intronic
1040124808 8:43725440-43725462 AAATCACAACGGTATTGATTGGG - Intergenic
1040393151 8:46967092-46967114 AAATCACAAGGGTATTGATTGGG + Intergenic
1040489799 8:47909364-47909386 AAATTATAAGAGTATTGATTGGG - Intronic
1040538900 8:48333813-48333835 AAATCACAAGGGTATTGATTGGG + Intergenic
1040634261 8:49254171-49254193 AAATCATAAGGGTATTGATTAGG - Intergenic
1040679113 8:49787619-49787641 AAATCACAAGAGTATTGATTGGG + Intergenic
1040840043 8:51775647-51775669 AAATCACAAGAGTATTGATTGGG - Intronic
1040921145 8:52619112-52619134 AAATCATTGGTGTTTTGATAGGG - Intergenic
1041033808 8:53766310-53766332 AAATCACAAGGGTATTGATTGGG - Intronic
1041164057 8:55073642-55073664 AAATCACAAGGGTATTGATTGGG - Intergenic
1041210396 8:55544831-55544853 AAATTATGAGGGTATTGATTGGG - Intergenic
1041287439 8:56274901-56274923 AAATTATAAGAGTATTGATTGGG - Intergenic
1041414913 8:57597388-57597410 AAATTATAAGAGTATTGATTGGG - Intergenic
1041559750 8:59202362-59202384 AAATCACAAGGGTATTGATTGGG + Intergenic
1041584214 8:59496738-59496760 AAATCACAAGGGTATTGATTGGG + Intergenic
1041649804 8:60290575-60290597 AAATCACAAGGGTATTGATTGGG + Intergenic
1041746534 8:61213613-61213635 AAATCACAAGGGTATTGATTGGG - Intronic
1041824229 8:62073536-62073558 AAATCACAAGGGTATTGATTGGG + Intergenic
1041886078 8:62809338-62809360 AAATCACAAGAGTATTGATTGGG + Intronic
1042084425 8:65092267-65092289 AAATTATAAGAGTATTGATTGGG - Intergenic
1042298320 8:67246665-67246687 ACATCATTAGGTTGTTTATTTGG - Intronic
1042529172 8:69797240-69797262 AAATCACAAGGGTATTGATTGGG - Intronic
1042709306 8:71697456-71697478 AAATCACAAGGGTATTGATTGGG + Intergenic
1043023425 8:75035734-75035756 ATATCATTAGGGGCTGGATGTGG + Intergenic
1043145011 8:76642121-76642143 AAATTATAAGAGTATTGATTGGG + Intergenic
1043324372 8:79032771-79032793 AAATTATAAGAGTATTGATTAGG - Intergenic
1043327403 8:79069861-79069883 AAATCACAAGGGTATTGATCGGG - Intergenic
1043584194 8:81748380-81748402 AAATCACAAGGGTATTGATTGGG + Intronic
1043684828 8:83072108-83072130 AAATCACAAGAGTATTGATTGGG + Intergenic
1043977449 8:86599240-86599262 AAATCACAAGGGTATTGATTGGG - Intronic
1044003507 8:86914239-86914261 AAATCACAAGAGTATTGATTGGG + Intronic
1044064073 8:87677162-87677184 AAATCACAAGAGTATTGATTGGG + Intergenic
1044066830 8:87708510-87708532 AAATCACAAGGGTATTGATTGGG + Intergenic
1044070321 8:87752094-87752116 AAATTATAAGAGTATTGATTGGG + Intergenic
1044086324 8:87946194-87946216 AAATTATAAGAGTATTGATTGGG + Intergenic
1044652385 8:94510182-94510204 ATATCTTGAAGGTCTTGATTTGG - Intronic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1045593577 8:103627477-103627499 AAATTATAAGAGTATTGATTGGG + Intronic
1045813927 8:106257697-106257719 AAATTATAAGAGTATTGATTGGG - Intergenic
1045883723 8:107071252-107071274 ACATCCACAGGGTCTTGATTGGG - Intergenic
1045955045 8:107896070-107896092 AAATCACAAGAGTATTGATTGGG + Intergenic
1045955704 8:107903707-107903729 AAATCTTTAGGGTTGTAATTAGG - Intronic
1046043979 8:108942128-108942150 AAATTATAAGAGTATTGATTGGG - Intergenic
1046076717 8:109320655-109320677 AAATCACAAGGGTACTGATTGGG + Intronic
1046153420 8:110257299-110257321 AAATCACAAGGGTATTGATTGGG + Intergenic
1046868924 8:119182364-119182386 AAATCACAAGAGTATTGATTGGG + Intronic
1047447553 8:124933131-124933153 AAATCACAAGGGTATTGATTGGG - Intergenic
1048002861 8:130393938-130393960 AAATCACAAGGGTATTGATTGGG - Intronic
1048479232 8:134772465-134772487 AAATAATTAGGGCCTTGCTCTGG - Intergenic
1048670289 8:136711815-136711837 AAATTATAAGAGTATTGATTGGG - Intergenic
1048809736 8:138275032-138275054 AAATCACAAGGGTATTGATTGGG + Intronic
1048820201 8:138373369-138373391 AAATCACAGGGGTATTGATTGGG - Intronic
1048825774 8:138424206-138424228 AAATCACAAGGGTATTGATTGGG + Intronic
1049500900 8:142964954-142964976 AAATCACTAGGGTATTGATTGGG + Intergenic
1049513453 8:143041614-143041636 AAATCACAAGGGTATTGATTGGG + Intronic
1049965929 9:779924-779946 AAATCACAAGGGTATTGATTGGG - Intergenic
1050143368 9:2539673-2539695 AACTCCTTGGGGTCTTGTTTGGG - Intergenic
1050769386 9:9177389-9177411 AAACAATTAGGGTCGTGATATGG - Intronic
1050784387 9:9381916-9381938 AAATCATTGGGGTTTTAATGTGG + Intronic
1050974333 9:11917296-11917318 AAATCATGAGGATTTTGATAGGG + Intergenic
1051090282 9:13399103-13399125 GAATCATAAGGGCCTTGACTGGG - Intergenic
1051404369 9:16719281-16719303 AAATCATTAGGGTGGCTATTTGG - Intronic
1051549970 9:18316774-18316796 AAATCACAAGGGTATTGATTGGG + Intergenic
1051742524 9:20265506-20265528 AAATCACAAGGGTATTGATTGGG - Intergenic
1052009546 9:23389576-23389598 AAATCACAAGGGTATTGATTGGG + Intergenic
1052125964 9:24774790-24774812 AAATTATAAGAGTATTGATTCGG + Intergenic
1052354827 9:27493675-27493697 AAATCACAAGGGTATTGATTGGG - Intronic
1052426515 9:28311853-28311875 AAATCACAAGGGTATTGATAGGG + Intronic
1052499042 9:29265401-29265423 AGAGCATTAGGGTCTTGCTCTGG - Intergenic
1052602125 9:30647209-30647231 AAATCACAAGAGTATTGATTGGG + Intergenic
1052740984 9:32392917-32392939 AAATCACAAGGGTATTCATTGGG - Intronic
1053651656 9:40175846-40175868 AAATTACAAGGGTATTGATTGGG + Intergenic
1053703521 9:40726582-40726604 AAATCACAAGGGTATTGATTTGG - Intergenic
1053902048 9:42805168-42805190 AAATTACAAGGGTATTGATTGGG + Intergenic
1054413578 9:64850045-64850067 AAATCACAAGGGTATTGATTTGG - Intergenic
1054532927 9:66200356-66200378 AAATTAAAAGGGTATTGATTGGG - Intergenic
1055002669 9:71470534-71470556 AAAATATTAGGTTATTGATTTGG + Intergenic
1055340235 9:75273598-75273620 AAATCACAAGGGTATTGATTGGG + Intergenic
1055784789 9:79861409-79861431 AAATCACAAGGGTATTGATTGGG - Intergenic
1055830505 9:80372567-80372589 AAATCACAAGGGTATTGATTGGG + Intergenic
1055908101 9:81316840-81316862 AAATCACAAGGGTATTGATTGGG + Intergenic
1056082795 9:83114269-83114291 AAATCACAAGGGTATTGATTGGG - Intergenic
1056470390 9:86900002-86900024 AAATCACAAGGGTATTGATTGGG + Intergenic
1057013265 9:91627580-91627602 AAATCACAAGGGTATTGACTGGG - Intronic
1057099105 9:92340699-92340721 AAATCACAAGGGTATTGATTGGG - Intronic
1057145263 9:92754765-92754787 AAATCACAAGGGTATTGATTGGG - Intronic
1057370968 9:94472635-94472657 AAATTATAAGAGTATTGATTGGG + Intergenic
1057538863 9:95945519-95945541 AAATCACAAGGGTATTGACTGGG + Intronic
1057715751 9:97494094-97494116 AAATCACAAGGGTATTGATTGGG + Intronic
1057732328 9:97621231-97621253 AAATTATGAGAGTATTGATTGGG - Intronic
1058265140 9:102889867-102889889 AAATCACAAGGGTATTGACTGGG - Intergenic
1058268374 9:102936815-102936837 AAATCACAAGGGTATTGATTGGG - Intergenic
1058549000 9:106093299-106093321 AAATCACAAGAGTATTGATTGGG - Intergenic
1058922569 9:109631408-109631430 AAATCACAAGGGTATTGACTGGG - Intergenic
1059022238 9:110589455-110589477 AAATCACAAGGGTATTGATTGGG - Intergenic
1059281794 9:113140719-113140741 AAATCACAAGGGTATTGATTGGG - Intergenic
1061104511 9:128519074-128519096 AAATCACAAGGGTATTGATTAGG - Intronic
1062174841 9:135155662-135155684 AGATCATTAGGGTCTGCATTTGG + Intergenic
1062728371 9:138092672-138092694 AAATTATAAGAGTATTGATTGGG + Intronic
1062752129 9:138263237-138263259 AAATCACAAGGGTATTGATTGGG + Intergenic
1186132025 X:6478299-6478321 AAATCACAAGGGTATTGATTGGG - Intergenic
1186150034 X:6664992-6665014 AAATCACAAGGGTATTGATTGGG + Intergenic
1186242581 X:7585840-7585862 ATCTCATTGTGGTCTTGATTTGG + Intergenic
1186329094 X:8513411-8513433 AAATCACAAGGGTATTGACTGGG - Intergenic
1186760869 X:12720653-12720675 AAATCATTAGGGTCTTGATTTGG - Exonic
1187122406 X:16422276-16422298 AAATTACAAGGGTATTGATTGGG - Intergenic
1187433662 X:19247676-19247698 AAATCACAAGGGTATTGATTGGG - Intergenic
1187650939 X:21405191-21405213 ATCTCATTAGGATCTTGACTAGG + Intronic
1187928002 X:24267904-24267926 ACAACATTAGGGTCTTAATTTGG - Intergenic
1188255715 X:27960205-27960227 AAATTATAAGAGTATTGATTGGG - Intergenic
1188446278 X:30256284-30256306 AAATTATAAGAGTATTGATTGGG + Intergenic
1188776580 X:34226990-34227012 AAATTATAAGAGTATTGATTGGG + Intergenic
1188822782 X:34796210-34796232 AAATCACAAGAGTATTGATTGGG - Intergenic
1188823517 X:34802575-34802597 AAATCACAAGAGTATTGATTGGG - Intergenic
1188849472 X:35114279-35114301 AAATCACAAGGGTATTGATTGGG - Intergenic
1188979469 X:36714154-36714176 AAATCACAAGGGTATTGATTGGG + Intergenic
1189509478 X:41647812-41647834 AAATCACAAGGGTATTGATTGGG - Intronic
1189557652 X:42162192-42162214 AAATCACAAGAGTATTGATTGGG + Intergenic
1190001947 X:46697561-46697583 AAATCACAAGGGTATTGATTGGG - Intronic
1190616240 X:52236109-52236131 AAATCACAAGGGTATTGATTGGG - Intergenic
1190651320 X:52571515-52571537 AAATCACAAGGGTATTGATTGGG - Intergenic
1191063645 X:56324652-56324674 AAATCAAAAGGGTATTGACTGGG - Intergenic
1191125997 X:56954431-56954453 AAATCACAAGAGTATTGATTGGG - Intergenic
1191148344 X:57192838-57192860 AAATCACAAGGGTATGGATTGGG - Intergenic
1191161007 X:57329923-57329945 AAATCATAAGGGTATTGATTGGG - Intronic
1191217372 X:57947367-57947389 AAATCATTAGTAGCTTGATGGGG + Intergenic
1191244925 X:58219761-58219783 AAATCACAAGGGTATTGACTGGG + Intergenic
1191722046 X:64239320-64239342 AAATTATAAGAGTATTGATTGGG + Intergenic
1192059779 X:67812253-67812275 AAATCACAAGGGTATTGATTGGG + Intergenic
1192077586 X:68016238-68016260 AAATAACAAGGGTATTGATTGGG - Intergenic
1192440989 X:71173533-71173555 AAAGCATTAGTGCCTAGATTCGG + Intergenic
1192731655 X:73807316-73807338 AAATCACAAGGGTATTGATTGGG - Intergenic
1192752277 X:74005611-74005633 AAATCACAAGGGTATTGATTGGG + Intergenic
1193025682 X:76843576-76843598 AAATCACAAGGGTATTGATTTGG - Intergenic
1193262374 X:79424084-79424106 AAATTATAAGAGTATTGATTGGG - Intergenic
1193301670 X:79896483-79896505 AAATCACAAGGGTATTGATTAGG - Intergenic
1193594695 X:83432175-83432197 AAATCACAAGGGCATTGATTGGG - Intergenic
1193680679 X:84515527-84515549 AAAGCACAAGGGTATTGATTGGG + Intergenic
1194101918 X:89716812-89716834 AAATCACAAGGTTATTGATTGGG - Intergenic
1194194890 X:90881100-90881122 AAATCACAAGGGTATTGATTGGG - Intergenic
1194378811 X:93168458-93168480 AAATTATAAGAGTATTGATTGGG - Intergenic
1194527538 X:94995624-94995646 AAATTATAAGAGTATTGATTGGG + Intergenic
1194535871 X:95105424-95105446 AAATCACAAGGGTATTGATTGGG - Intergenic
1194800725 X:98269267-98269289 AAATCACAAGGGTATTGATTGGG - Intergenic
1194923218 X:99793520-99793542 AAATCACAAGGGTATTGATTGGG - Intergenic
1195734251 X:107996672-107996694 AAATCACAAGGATATTGATTGGG - Intergenic
1195838263 X:109143843-109143865 AAATTATAAGAGTATTGATTGGG - Intergenic
1196238157 X:113306899-113306921 AAATCACAAGGATATTGATTGGG + Intergenic
1196311195 X:114167847-114167869 AAATTATAAGAGTATTGATTGGG + Intergenic
1196358936 X:114830012-114830034 AACACATTAGGGTTTTGATAGGG + Intronic
1196676324 X:118424390-118424412 ATATCATTGTGGTTTTGATTTGG + Intronic
1197071620 X:122305804-122305826 AAATCACAAGAGTATTGATTGGG - Intergenic
1197086451 X:122482376-122482398 AAATCACAAGGGTATTGATTGGG - Intergenic
1197113159 X:122800262-122800284 AAATCACAAGGGTATTGATTGGG - Intergenic
1197474035 X:126897606-126897628 AAATCACAAGGGTAGTGATTGGG + Intergenic
1197557079 X:127968823-127968845 AAATTATAAGAGTATTGATTGGG + Intergenic
1197630605 X:128853487-128853509 AAATCACAAGGATATTGATTGGG - Intergenic
1197685721 X:129437498-129437520 AAATCAGTAGGCCATTGATTAGG + Intergenic
1198023272 X:132680107-132680129 AAATCACAAGTGTATTGATTGGG + Intronic
1198072727 X:133165421-133165443 AAATCACAAGGGTATTGATTGGG + Intergenic
1198119424 X:133577658-133577680 AAATCATTTAGGTCATCATTTGG + Intronic
1198912396 X:141629190-141629212 AAACCACAAGGGTATTGATTGGG - Intronic
1198994659 X:142560738-142560760 AAATTATAAGAGTATTGATTGGG - Intergenic
1199321220 X:146441753-146441775 AAATCACAAGGGTTTTGACTGGG - Intergenic
1199337678 X:146639728-146639750 AAATCACAAGAGTATTGATTGGG - Intergenic
1199339635 X:146661654-146661676 AAATTATAAGAGTATTGATTGGG - Intergenic
1199386708 X:147231506-147231528 ATATCATTGGGGCCTTGGTTTGG + Intergenic
1199477056 X:148257416-148257438 AAATCACAAGGGTATTGATTGGG + Intergenic
1199529568 X:148831313-148831335 AAATCACAAGAGTATTGATTGGG + Intronic
1199536513 X:148908280-148908302 AAATCATAAGGGTATTGATTGGG + Intronic
1199561613 X:149169490-149169512 AAATCACAAGGGTATTGACTGGG + Intergenic
1199604269 X:149564154-149564176 AAATCACAAGGGTATTGATTGGG - Intergenic
1199890745 X:152077315-152077337 AAATCATTAAGGACTTTATAAGG - Intergenic
1199974088 X:152882204-152882226 AAACCATTTCGGTCTTGTTTGGG - Intergenic
1200016225 X:153165659-153165681 AAATCACAGGGGTATTGATTGGG - Intergenic
1200356472 X:155557193-155557215 AAATCACAAGGGTATTGATTGGG + Intronic
1200541510 Y:4463507-4463529 AAATCACAAGGGTATTGATTGGG - Intergenic
1200713077 Y:6506761-6506783 AAATCACAAGGGTATTGATTGGG + Intergenic
1200770129 Y:7116765-7116787 AAATTATAAGAGTATTGATTGGG + Intergenic
1200855872 Y:7937634-7937656 TAATCATTAGGCTTTTGATCTGG + Intergenic
1200861010 Y:7992748-7992770 AAATCACAAGGGTATTGATTGGG + Intergenic
1200861655 Y:7998614-7998636 AAATCACAAGGGAATTGATTGGG + Intergenic
1200950416 Y:8893411-8893433 AAATCACAAGGGTATTGACTGGG - Intergenic
1201020845 Y:9655279-9655301 AAATCACAAGGGTATTGATTGGG - Intergenic
1201427813 Y:13873770-13873792 AAATCACAAGGGTATTGATCAGG - Intergenic
1201478535 Y:14411166-14411188 AAATCACAAAGGTATTGATTGGG + Intergenic
1201517439 Y:14833375-14833397 AAATCACAAGCGTATTGATTGGG + Intronic
1201768670 Y:17596597-17596619 AAATCACAAGGGTATTGATTGGG - Intergenic
1201777976 Y:17687283-17687305 AAATCACAAGAGTATTGATTGGG - Intergenic
1201823582 Y:18218709-18218731 AAATCACAAGAGTATTGATTGGG + Intergenic
1201832884 Y:18309388-18309410 AAATCACAAGGGTATTGATTGGG + Intergenic
1201913102 Y:19153557-19153579 AAATCACAAGAGTATTGATTGGG + Intergenic
1201974089 Y:19829643-19829665 AAATCACATGGGTATTGATTGGG + Intergenic
1202247499 Y:22834733-22834755 AAATTATAAGAGTATTGATTGGG + Intergenic
1202346346 Y:23932043-23932065 AAATCACAAGGGTATTGATTGGG + Intergenic
1202400487 Y:24468481-24468503 AAATTATAAGAGTATTGATTGGG + Intergenic
1202470293 Y:25201605-25201627 AAATTATAAGAGTATTGATTGGG - Intergenic
1202524425 Y:25738047-25738069 AAATCACAAGGGTATTGATTGGG - Intergenic