ID: 1186761107

View in Genome Browser
Species Human (GRCh38)
Location X:12722877-12722899
Sequence TGATCTGAGATGAGACTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186761107_1186761110 21 Left 1186761107 X:12722877-12722899 CCTGTGAGTCTCATCTCAGATCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1186761110 X:12722921-12722943 ATGCATCACCGCCTCTACAGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1186761107_1186761108 -7 Left 1186761107 X:12722877-12722899 CCTGTGAGTCTCATCTCAGATCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1186761108 X:12722893-12722915 CAGATCACAGCTCTCAGCATAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1186761107_1186761111 27 Left 1186761107 X:12722877-12722899 CCTGTGAGTCTCATCTCAGATCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1186761111 X:12722927-12722949 CACCGCCTCTACAGAGGCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 100
1186761107_1186761109 -6 Left 1186761107 X:12722877-12722899 CCTGTGAGTCTCATCTCAGATCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1186761109 X:12722894-12722916 AGATCACAGCTCTCAGCATAGGG 0: 1
1: 0
2: 2
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186761107 Original CRISPR TGATCTGAGATGAGACTCAC AGG (reversed) Exonic
901115541 1:6840959-6840981 TCATCTGACATGGGTCTCACTGG + Intronic
901349088 1:8576595-8576617 TGATCTGAAATGAGTCTAAATGG + Intronic
901460534 1:9388642-9388664 TGATCTGAGAGGAGACAAAAGGG + Intergenic
904393407 1:30200290-30200312 GGATCTCAGAGGAAACTCACAGG - Intergenic
905094965 1:35462330-35462352 TGATTTTAGTTGAAACTCACTGG - Intronic
907024630 1:51103972-51103994 TGATCTGATATAAGCCTAACTGG - Intronic
907310218 1:53534809-53534831 TGCTCTGAGCTGAGACCCAAGGG + Intronic
907783807 1:57592269-57592291 GGATTTGAGATGTGACACACAGG + Intronic
908166890 1:61467785-61467807 GGATCTGAGACCAGACACACTGG + Intergenic
909652009 1:77986206-77986228 TGATCTGAGATGAAGTTCCCGGG - Intronic
909674553 1:78224858-78224880 TTATCTGAGAGGTGAATCACAGG + Intergenic
909756239 1:79229628-79229650 TGATCTGAGTTTAGACTTCCAGG - Intergenic
911987166 1:104641853-104641875 TTATCTCAGATGAGAATAACTGG + Intergenic
912247818 1:107979118-107979140 TGATCAAAGGTAAGACTCACTGG + Intergenic
912347357 1:108976869-108976891 TGATCTGAGGTGAGACTAGAAGG + Intronic
913581437 1:120231569-120231591 TGATCTTAGACAAGGCTCACAGG - Intergenic
913626739 1:120666819-120666841 TGATCTTAGACAAGGCTCACAGG + Intergenic
914563369 1:148843015-148843037 TGATCTTAGACAAGGCTCACAGG - Intronic
914609458 1:149287208-149287230 TGATCTTAGACAAGGCTCACAGG + Intergenic
921838739 1:219805869-219805891 TGATCTGAGATCAAAATCATAGG + Intronic
921872894 1:220160277-220160299 TGATAAGAGAGGAAACTCACAGG + Intronic
923798326 1:237182079-237182101 TTATGTGAGATGAAACTCCCTGG + Intronic
924336205 1:242989069-242989091 TCATCTGAACTCAGACTCACAGG + Intergenic
1063202849 10:3801618-3801640 TGGCCTGAGATGAGAGTTACAGG + Intergenic
1069296143 10:66846754-66846776 TGACCTGATTTGAGACTGACAGG - Intronic
1069460268 10:68588444-68588466 TGATCTGGGATTAGAATCCCTGG + Intronic
1074828322 10:117230645-117230667 TGACCTGAGATGTGATTGACAGG - Intergenic
1076431976 10:130410455-130410477 AGATCTGAAATGGGTCTCACCGG + Intergenic
1079401576 11:20110474-20110496 TCATCTGTTAAGAGACTCACTGG - Intronic
1081321153 11:41693304-41693326 TGTTCTTAGAAGAGACACACTGG - Intergenic
1084703163 11:70800777-70800799 TGCTCTGAGATGACCCTCTCAGG - Intronic
1085610439 11:77943431-77943453 TGATATGAGTTGTGACTCAATGG + Intronic
1086077336 11:82868732-82868754 GGAGATGAGATTAGACTCACTGG + Intronic
1086333635 11:85778202-85778224 GGTTCTGAGATGAAATTCACAGG + Intronic
1086517850 11:87634444-87634466 CAATATGAAATGAGACTCACAGG - Intergenic
1087061688 11:93985017-93985039 TGTTCAGAGATGGAACTCACTGG + Intergenic
1094696886 12:32828577-32828599 TGATTTTAAATGAGAATCACAGG - Intronic
1095168637 12:39006232-39006254 GAATCTGACATGAGGCTCACTGG - Intergenic
1095256484 12:40042642-40042664 TGAACTGAGCTGAAATTCACTGG - Intronic
1096240823 12:49959345-49959367 TGACCTGAGATGGGAACCACAGG - Intergenic
1097866177 12:64560871-64560893 GGATCTGATAGGAGACTCTCAGG + Intergenic
1101910020 12:108854438-108854460 GGAACTGAGATAAGATTCACAGG + Intronic
1102891517 12:116562021-116562043 TGAACTGAGCTGAGTCTGACTGG - Intergenic
1103044150 12:117721536-117721558 TGATCTCAGCTCTGACTCACAGG - Intronic
1104646981 12:130504622-130504644 AAGTCTGAGATGAGCCTCACAGG - Intronic
1106075734 13:26459411-26459433 TGATATGAAATATGACTCACAGG + Intergenic
1106279630 13:28253800-28253822 TCATCTGAGCTGAGGCTGACTGG - Intronic
1106603377 13:31206318-31206340 AGATCTGAAATGAGACTTCCAGG + Intronic
1109951576 13:69507407-69507429 TCTTCTGAGATGAGCCTTACTGG - Intergenic
1110976062 13:81835937-81835959 TGAAGAAAGATGAGACTCACTGG - Intergenic
1111108022 13:83671349-83671371 AGATGAGAGATGAAACTCACAGG - Intergenic
1111531540 13:89542978-89543000 TTAACTGAGATGAGGCTGACAGG - Intergenic
1111990768 13:95114619-95114641 TGAAGTAAGCTGAGACTCACAGG - Intronic
1112289830 13:98135925-98135947 TTCTCTGAGATGAGAATCAAAGG + Intergenic
1113551476 13:111196251-111196273 TGATCTGAGTTGAGTCCCAGTGG + Intronic
1116134361 14:40901514-40901536 TGAAAGGAGATGAGACACACAGG - Intergenic
1116980403 14:51164024-51164046 GAATCTGAGAGGAGATTCACGGG + Intergenic
1124036857 15:26061488-26061510 TGAGCTCAGATAAGACTCAGTGG - Intergenic
1124877910 15:33612938-33612960 TGATTTGCGATGAGTCTCAGGGG - Intronic
1126247646 15:46527847-46527869 TGATCTGAGATGACACTGTGAGG + Intergenic
1131223451 15:90604622-90604644 AGGTCTGGGATGAGACTCCCAGG + Intronic
1131323492 15:91420659-91420681 TGCCCTGAAAGGAGACTCACAGG - Intergenic
1134159840 16:11878724-11878746 TGACCTGAGAGGAGATACACGGG + Intronic
1134211384 16:12280216-12280238 GGAACTGAAAGGAGACTCACGGG + Intronic
1139054074 16:63160013-63160035 TCAACTGAGTTGAGACTAACAGG - Intergenic
1139400225 16:66675417-66675439 TGATCTGATCTGAGACACAATGG + Intronic
1140267852 16:73435757-73435779 TGTTCTGAGTTGGGGCTCACAGG + Intergenic
1143210742 17:5185592-5185614 TGAAATGAGATGAGACTTAGGGG - Intronic
1146308595 17:31749951-31749973 TGATCAGAAATTAGACTCTCAGG + Intergenic
1150345108 17:64398529-64398551 TGATTGGAAATGAGATTCACCGG + Intronic
1151534476 17:74730934-74730956 TAGCCTGAGATGAGACACACTGG + Intronic
1151690774 17:75683847-75683869 TTAACTCAGATGTGACTCACTGG + Intronic
1155058335 18:22205116-22205138 TGCTCTGACATGAGTCTCAGAGG - Intergenic
1155234945 18:23809922-23809944 TGATGGGGGATGTGACTCACTGG - Intronic
1155694926 18:28674083-28674105 TTATTTGAAATGAGACTCAAAGG - Intergenic
1156514680 18:37669850-37669872 TGAGCAGACGTGAGACTCACAGG + Intergenic
1156544271 18:37947890-37947912 TTATCTGAGAGGAGAATCAGTGG + Intergenic
1158718850 18:59905317-59905339 TGATTTGATTTGAGAATCACTGG + Intergenic
1160067391 18:75588660-75588682 TCACCTGAGATGTGACTCTCTGG - Intergenic
1160286022 18:77544237-77544259 AAATCTGACATGGGACTCACTGG + Intergenic
1160403277 18:78627568-78627590 TGAACAGAGATGAGAATCTCTGG + Intergenic
1160869734 19:1271709-1271731 GGAGCTGAGATGAGACTGGCTGG + Intronic
1165093359 19:33397731-33397753 TGGTCTGAGATGAGCCTAGCTGG + Intronic
1166621354 19:44304344-44304366 TTATCTGAGATAAAACACACAGG + Intronic
1166772817 19:45294517-45294539 TGATCTGAGATGATAGGCATTGG + Intronic
1167318938 19:48783626-48783648 AGATCTGGGGTGAGACTCCCTGG - Intergenic
928117037 2:28552909-28552931 TTACCTGAAATGAGACACACAGG - Exonic
929684645 2:44023227-44023249 AGATTTGGGATGAGTCTCACTGG + Intergenic
929734659 2:44534524-44534546 TGATCTGAGAAGATACTGATAGG - Intronic
929880316 2:45831026-45831048 TGATCTGAGCTGACGCTCTCTGG - Intronic
930392012 2:50773277-50773299 TGATCTGAAAAGAGACCCTCTGG - Intronic
931238596 2:60432859-60432881 TGAGCTGAGATGAGACGAGCTGG - Intergenic
931388351 2:61817209-61817231 TGATCTGTGAAGCGACTCACAGG - Intergenic
932390397 2:71384647-71384669 TCATCAGAGATGAGCCTTACAGG - Intronic
932946501 2:76238718-76238740 TGAGCTGAAATCAGAGTCACTGG + Intergenic
934562344 2:95319910-95319932 TGTTCTGAGATGGGGCTCAACGG - Intronic
935732445 2:106075259-106075281 TGCTCTTACATGTGACTCACAGG - Intronic
937494045 2:122399332-122399354 TGATCTGAGAAGAAACGCATTGG + Intergenic
938083284 2:128381519-128381541 TGATGTGGAATGAGACTCACGGG + Intergenic
940791391 2:158033394-158033416 AAAACTGAGATGAGACTCAGGGG + Intronic
943104898 2:183532669-183532691 TGCTCTTTGATGTGACTCACTGG - Intergenic
947540519 2:230974356-230974378 TGATCTGGGCTCTGACTCACTGG + Intergenic
948911242 2:241003744-241003766 TGCTTAGAGAAGAGACTCACAGG + Intronic
1173327195 20:42044818-42044840 AGATCTGACATGAAACTAACTGG + Intergenic
1173555451 20:43962297-43962319 TGTACTGGGATGGGACTCACTGG + Intronic
1176417334 21:6484295-6484317 TGATCTGTGGTGAGACACAGTGG - Intergenic
1177003553 21:15643018-15643040 ACATCTGACATGAGTCTCACTGG + Intergenic
1178090190 21:29154453-29154475 TAATCTGAGATGACAGTGACAGG + Intronic
1179077340 21:38135283-38135305 TGATCTCAACTGAGACTCAGAGG - Intronic
1179692830 21:43092628-43092650 TGATCTGTGGTGAGACACAGTGG - Intergenic
1180228734 21:46413665-46413687 TGAGCTGAGGTGAGGCCCACGGG - Intronic
1181573642 22:23780966-23780988 TCATCTGGGCTGAGACTCAGTGG - Exonic
1182472368 22:30556318-30556340 TGTTGTGAGATGAGGCACACAGG + Intronic
1182567114 22:31208386-31208408 TGATCTGAGTTGATAGTTACTGG - Intergenic
1183749618 22:39712430-39712452 GGGTCTGAGATGGGATTCACGGG + Intergenic
1185261414 22:49866829-49866851 AAATCTGAGATGGGTCTCACTGG + Intronic
951035631 3:17928892-17928914 TGATTTGAGGTGAGAGGCACCGG - Intronic
953542452 3:43834089-43834111 TGATCTTGGATGATACTCAAGGG - Intergenic
955897605 3:63717356-63717378 GCATCTGAAATGGGACTCACTGG + Intergenic
957168639 3:76708919-76708941 TGATGGGACATGAGAATCACTGG + Intronic
958271469 3:91505028-91505050 GGCTCTGAGATGGGACCCACAGG + Intergenic
958529067 3:95301167-95301189 TTAACTGAGATGCAACTCACTGG - Intergenic
958773337 3:98452461-98452483 TTACATGAGATGAGAATCACAGG + Intergenic
964453577 3:156836635-156836657 TAATCTTAGATAAGACTTACTGG - Intronic
964863928 3:161232740-161232762 TGATCTGAACTGAGAGGCACTGG - Intronic
966024393 3:175258368-175258390 GGATCTGAAATGAGACTGCCTGG - Intronic
966258609 3:177948941-177948963 TGTTCTCTGATGAGACTGACTGG - Intergenic
967446574 3:189574012-189574034 GGATCTGTGAGGAGACTGACAGG + Intergenic
969435597 4:7187429-7187451 GGATCCGTGATGAGGCTCACTGG - Intergenic
970633428 4:17980089-17980111 AGATCTGAAATGGGTCTCACTGG - Intronic
970892845 4:21067271-21067293 TGATCTTGGGTGAGACTCAGAGG + Intronic
971695827 4:29901670-29901692 TAATCTGAAATGAGACCGACTGG - Intergenic
973944110 4:55940137-55940159 TGATCTGAGATAAGACTGTTAGG + Intergenic
974642498 4:64649304-64649326 TGATCTGAGTTTGGACGCACAGG + Intergenic
976912585 4:90325677-90325699 TGTTCTGAGGTGACAGTCACTGG + Intronic
978667867 4:111208042-111208064 TGATTTGAGATGGGACTCATAGG + Intergenic
978895734 4:113885262-113885284 TGTTGTGAGATGATACTCACTGG - Intergenic
979240923 4:118446242-118446264 TCATCTGAACTCAGACTCACAGG - Intergenic
986054633 5:4124055-4124077 TGTTCTGCCATGAGACCCACAGG - Intergenic
990565237 5:57021172-57021194 AGATTTGGGATGAGTCTCACTGG + Intergenic
994922696 5:106069979-106070001 TAATCAGAGATAAGACTCAAGGG + Intergenic
996179532 5:120401537-120401559 TGATCTGATAAGAGACATACAGG + Intergenic
999126343 5:149248945-149248967 TGATCCGAGATGAGATTTCCTGG - Intronic
1000720646 5:164702326-164702348 TGTTCTGAGTTGAGAATTACAGG - Intergenic
1004157678 6:13184460-13184482 TGCTCTAAGATGGGACTCATGGG - Intronic
1004742152 6:18472476-18472498 AGATGGGAGATGAGACTCAGGGG + Intergenic
1004830195 6:19468479-19468501 TGATCTGAGAGGTGAGTCAGGGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005830999 6:29671030-29671052 TGATCTGAGAGGTGAGGCACTGG - Intronic
1006467887 6:34206886-34206908 TCAGCTGAGATGAGGGTCACCGG - Intergenic
1006850181 6:37092701-37092723 TGCTCTGTGATGAGGCTCACGGG + Intergenic
1008830123 6:55748824-55748846 TAGTGTGAGATGAGATTCACTGG + Intergenic
1008983646 6:57516052-57516074 GGCTCTGAGATGGGACCCACAGG - Intronic
1009171702 6:60408955-60408977 GGCTCTGAGATGGGACCCACAGG - Intergenic
1014115460 6:117663882-117663904 AGATTTGGGATGAGTCTCACTGG + Intergenic
1019273663 7:164673-164695 GGATCTGAGAGGAGACTCGCTGG - Intergenic
1021376639 7:19916167-19916189 TGATTCTAGATGTGACTCACAGG - Intergenic
1022816024 7:33915006-33915028 TGATCATAGATGAGATTCAGTGG + Intronic
1025015509 7:55435950-55435972 TGAGCTGAGCTCAGACTCAGAGG + Intergenic
1025842663 7:65165604-65165626 TGATATGAGTTGTGACTCAATGG - Intergenic
1025880382 7:65530364-65530386 TGATATGAGTTGTGACTCAATGG + Intergenic
1025893055 7:65672240-65672262 TGATATGAGTTGTGACTCAATGG - Intergenic
1027827018 7:83128459-83128481 TGATCTGAAATAATAGTCACTGG - Intronic
1030163730 7:106532599-106532621 AGATTTGGGATGAGTCTCACTGG + Intergenic
1033266619 7:139892666-139892688 AGGTCTGACATGAGACTCAAAGG + Intronic
1034241665 7:149615992-149616014 TGGGCTGAGATGAGACTCTGGGG + Intergenic
1037646935 8:20800686-20800708 TAATCTGAAATGAGAATCTCGGG + Intergenic
1038619465 8:29126448-29126470 TTATTTGAGATGAGATTAACAGG + Intronic
1045679146 8:104640369-104640391 GGATTTGAGATTAGATTCACCGG + Intronic
1046721129 8:117620280-117620302 ACATTTGAGCTGAGACTCACAGG - Intergenic
1046858221 8:119060025-119060047 TGTGCTGAGATGAGGCTCAACGG - Intronic
1047461686 8:125071813-125071835 AAATCTGAGATGGGGCTCACTGG + Intronic
1047777383 8:128084172-128084194 TAATCTGAGATGAGATCCATGGG - Intergenic
1048004121 8:130404911-130404933 TGATCTGAGTTCAGACTAAAAGG - Intronic
1048768475 8:137869284-137869306 TGATCTGAGAGAGGACTCCCTGG + Intergenic
1054808328 9:69413427-69413449 TGATCAGGGGTGAGACCCACAGG - Intergenic
1056219038 9:84433316-84433338 TCATCTGATATGAGACACACTGG + Intergenic
1057551739 9:96056133-96056155 GGACCTGAGATGAGCCTCTCTGG + Intergenic
1058567875 9:106306343-106306365 CCATCTGAGATGTGAATCACTGG - Intergenic
1062007129 9:134245174-134245196 TGATCTGAGATGAGTCTCCTTGG - Intergenic
1062590381 9:137271941-137271963 TGTTCTGAGATGAGAAGCACAGG - Intronic
1186761107 X:12722877-12722899 TGATCTGAGATGAGACTCACAGG - Exonic
1189382602 X:40512579-40512601 TGATCTGAGACGACCCGCACAGG - Intergenic
1190185020 X:48226055-48226077 TGTTTTGAAATGAGACTCATTGG + Intronic
1190190549 X:48273462-48273484 TGTTTTGAAATGAGGCTCACTGG + Intronic
1195413148 X:104590721-104590743 TGATCTGTGATAAGTCACACAGG - Intronic
1196585002 X:117419178-117419200 AGATTTGGGATGAGTCTCACTGG - Intergenic
1199854453 X:151749132-151749154 TCTTCTGAGATGAAATTCACAGG + Intergenic
1202388641 Y:24348063-24348085 TCATCTGAACTCAGACTCACAGG - Intergenic
1202482146 Y:25322065-25322087 TCATCTGAACTCAGACTCACAGG + Intergenic