ID: 1186768363

View in Genome Browser
Species Human (GRCh38)
Location X:12792985-12793007
Sequence CATTGTGAATGAGTGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186768357_1186768363 27 Left 1186768357 X:12792935-12792957 CCAGGTGGCAAATTCCAGTTATG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 209
1186768359_1186768363 13 Left 1186768359 X:12792949-12792971 CCAGTTATGGCTCCGATGATAAT 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 209
1186768360_1186768363 1 Left 1186768360 X:12792961-12792983 CCGATGATAATATAAGCGAAGAA 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186768363 Original CRISPR CATTGTGAATGAGTGGCAGG TGG Intronic
901042634 1:6374579-6374601 CATGGTGGATGAGGGGCAGGTGG + Intronic
901227055 1:7619609-7619631 CATTGTGTGTGTTTGGCAGGGGG - Intronic
902117280 1:14131979-14132001 CTCTGTGGGTGAGTGGCAGGTGG - Intergenic
903859497 1:26356331-26356353 CATGGTGGATCAGTGGCAGAGGG + Intergenic
905506811 1:38486349-38486371 CATTGTGCAGGGGCGGCAGGCGG - Intergenic
906031772 1:42726604-42726626 CTTTGGGAATGTGAGGCAGGTGG + Intergenic
906779123 1:48556702-48556724 AACTGTGAAGGAGTGCCAGGAGG - Intronic
907886097 1:58593620-58593642 TATGGAGGATGAGTGGCAGGAGG + Intergenic
909491463 1:76231501-76231523 AATTGTGAGGGAATGGCAGGAGG - Intronic
910436786 1:87213377-87213399 CATTATTAATGACTTGCAGGAGG + Intergenic
911644870 1:100327395-100327417 CTTTGGGAAGCAGTGGCAGGTGG - Intergenic
915708430 1:157869730-157869752 CATTGTCAGTGAGGGGCAGATGG + Intronic
919422660 1:197390037-197390059 GATTGGGGAGGAGTGGCAGGTGG + Intronic
919963512 1:202497047-202497069 CAGTGTGAAAGACTGGCAGTAGG - Intronic
920527755 1:206680479-206680501 CATTATGAATGAGTGACAGAGGG - Intronic
921906663 1:220502442-220502464 CATCATGAATGAGTGGCATTTGG - Intergenic
924217805 1:241842517-241842539 CAAGGTGAATGAGTGGGAGAGGG - Intergenic
924497440 1:244603760-244603782 CTTTGGGAATCAGAGGCAGGAGG + Intronic
1067558285 10:47287248-47287270 CATGGGGTCTGAGTGGCAGGTGG - Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1073631936 10:105157951-105157973 CTTTCTGAATAAGTGGCAAGAGG - Intronic
1076209337 10:128627846-128627868 CAAGGGGAAGGAGTGGCAGGTGG + Intergenic
1077524167 11:3054201-3054223 CTTTGTGAACGAGTTGCAGCTGG - Intronic
1080462768 11:32470313-32470335 CTTTGGGAATCAGAGGCAGGAGG - Intergenic
1083831054 11:65233840-65233862 CAGTGGCAATTAGTGGCAGGTGG + Intergenic
1084464947 11:69317172-69317194 CATTTTGCAAGAGTGGGAGGAGG + Intronic
1085471466 11:76761109-76761131 CAGTGGGAATGAGGGGCAGCAGG - Intergenic
1086974951 11:93120948-93120970 CATTGAGAAGGAGGGGGAGGAGG + Intergenic
1087018229 11:93575373-93575395 CATTGGGAAAGGGTGCCAGGAGG + Intergenic
1089882965 11:121792493-121792515 TAATGTGATTGAGTGGAAGGTGG + Intergenic
1092075667 12:5671333-5671355 TATTGTGAATGGGTTGGAGGAGG - Intronic
1097323856 12:58253715-58253737 CCTTGTGAATGATTGGTAGGAGG + Intergenic
1098611253 12:72461024-72461046 TCTTTTGAATGTGTGGCAGGAGG + Intronic
1101337493 12:103809362-103809384 CATTGAGAGTGAGAGGCAAGCGG - Intronic
1104634446 12:130428749-130428771 CATTGTGTCAGAGAGGCAGGGGG + Intronic
1106798431 13:33231501-33231523 CATTATGAATGAGGGACTGGAGG + Intronic
1108014387 13:46058969-46058991 CCTTGTGAATTAGGGACAGGGGG - Intronic
1109884069 13:68519842-68519864 CATAGTTAATGAATGGAAGGTGG - Intergenic
1113789053 13:113017718-113017740 CAGTGTGCAGGAGTGGCGGGCGG - Intronic
1115629492 14:35229715-35229737 CTTTGAGAATGATTAGCAGGTGG + Intronic
1119040829 14:71272875-71272897 TATTGTGAATTAGTGGAAGGAGG + Intergenic
1119806634 14:77486461-77486483 CAGGGTGGATGAGTGGAAGGTGG + Intronic
1121350206 14:93167425-93167447 CATTTTGGATGAGTTTCAGGTGG - Intergenic
1122142810 14:99672941-99672963 CGTGGTGAATGAGTGGATGGGGG - Intronic
1122625253 14:103082227-103082249 GATTGTGAATGGATGGCTGGTGG + Intergenic
1123586509 15:21765200-21765222 TATTGTGAATGGGTTGGAGGAGG + Intergenic
1123623148 15:22207765-22207787 TATTGTGAATGGGTTGGAGGAGG + Intergenic
1124009948 15:25830239-25830261 CATTCTGAATGAGGGGAAGGTGG - Intronic
1124592771 15:31068023-31068045 CATGGTGAAAGATTGGCAGCTGG - Exonic
1128727457 15:69998707-69998729 CTTTGAGAGTGAGAGGCAGGAGG + Intergenic
1129162516 15:73754308-73754330 CATTGTGAGTGGGTGTGAGGAGG + Intergenic
1129565567 15:76619086-76619108 CTTTGGGAATGTGAGGCAGGTGG - Intronic
1130292776 15:82618925-82618947 CTTTGTGTATGTGGGGCAGGGGG + Intronic
1130659410 15:85818308-85818330 CATTATTAATGATTGGGAGGGGG + Intergenic
1131047674 15:89326476-89326498 CAGTGTGACTGAATGGCAGCAGG + Intronic
1131205085 15:90437780-90437802 CTTTGAGAAAGAGAGGCAGGAGG - Intronic
1131270202 15:90942598-90942620 CATTGTGGGTGAGTGGAAGCAGG + Exonic
1131680322 15:94715275-94715297 CATTGAGAATGAGTGACTTGGGG + Intergenic
1133921085 16:10153930-10153952 CCTTGTGAATACGTGGGAGGAGG - Intronic
1135921390 16:26651998-26652020 CACTCTAAAGGAGTGGCAGGAGG - Intergenic
1138577468 16:57917249-57917271 CATTGTGAGTCACAGGCAGGTGG - Exonic
1139099015 16:63743608-63743630 CATTGAGAATGGGTGGAGGGAGG + Intergenic
1139561421 16:67744760-67744782 CCTTGTGAAGGAGTGGGAGCTGG + Intronic
1139570410 16:67808182-67808204 CACTGGGAATGAGTAGAAGGGGG - Intronic
1139660454 16:68417121-68417143 CTTTCTGAATGATTGGCAGATGG + Intronic
1141474878 16:84266158-84266180 CTGTGTGAATTTGTGGCAGGAGG - Intergenic
1141497936 16:84422781-84422803 CCTTAGGAATGAGTGGCATGTGG + Intronic
1142235481 16:88920634-88920656 CATGGTGACGGAGTGGCAGGAGG + Intronic
1143027855 17:3951577-3951599 CATTGTGGGCGTGTGGCAGGTGG - Exonic
1143481118 17:7227881-7227903 CATGGGGAATGGGTGGGAGGAGG - Intronic
1146010624 17:29191621-29191643 CAGTGGGAATGAGTGGCTGATGG - Intergenic
1146781081 17:35673100-35673122 CATACTAAAAGAGTGGCAGGTGG - Intronic
1148212025 17:45814359-45814381 CATTGTGAGTCAGTCACAGGGGG - Intronic
1149009707 17:51843014-51843036 CATTGTGAATGTGTTGAAGTTGG + Intronic
1149480692 17:57000913-57000935 CATTGTGGACGAGTTGCTGGAGG + Exonic
1150372929 17:64656982-64657004 CATTGGGTATGAGTGGCAAGAGG - Intronic
1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG + Intergenic
1156646713 18:39171659-39171681 CATGGTGAAGGAGTAGAAGGTGG + Intergenic
1157969642 18:52251393-52251415 AATTGAGAATGATTGGCAGCTGG + Intergenic
1160859417 19:1231352-1231374 CATTGTGTGTGTGTGGCGGGGGG - Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1165154241 19:33777654-33777676 CAGGGTGAAGGAGAGGCAGGAGG - Intergenic
1165323871 19:35102797-35102819 CAGAGTGAGTGAGGGGCAGGTGG - Intergenic
1167664092 19:50813218-50813240 GATTGTGAATAATTGGCAAGGGG + Intergenic
925030203 2:644535-644557 CAGTGTGAATGAATGGATGGAGG + Intergenic
925497638 2:4469878-4469900 CCATGTGACTGAGTGGCAGATGG + Intergenic
928413201 2:31070200-31070222 CTTTGTGAATGAGTAGATGGTGG - Intronic
928420958 2:31137744-31137766 CGGTGTGCATGAGTGGCAGTGGG - Intronic
933841780 2:86292758-86292780 CTTTGAGATTGACTGGCAGGTGG + Intronic
934530703 2:95086161-95086183 CTTTGTGAAGGTGAGGCAGGAGG - Intergenic
934942475 2:98512537-98512559 CATGGTGGAAGAGTGGAAGGTGG + Intronic
935051803 2:99530723-99530745 CATTGAGAATGGGTCCCAGGGGG + Intergenic
935118472 2:100158987-100159009 CAGTGGGAGTCAGTGGCAGGAGG - Intergenic
935979168 2:108609586-108609608 CATTGTGAAAGAATGGCACCAGG - Intronic
938890436 2:135698930-135698952 CATTGTGAATGAGATTTAGGTGG + Intronic
941344664 2:164353009-164353031 CACTGTGAATGAGTGAAAGAAGG + Intergenic
941392755 2:164935220-164935242 GATTGTGAATAATTGGCAGCAGG + Intronic
946410091 2:219511436-219511458 CAGTGAGAATGAGTGGTAGATGG - Intergenic
946980715 2:225212450-225212472 CATTGTGCATGAGAGGTAAGAGG - Intergenic
947150247 2:227108113-227108135 CAGTGGGTGTGAGTGGCAGGGGG + Intronic
948811143 2:240479031-240479053 CACTGGGAATGAGAGGAAGGAGG - Intergenic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1171455797 20:25271468-25271490 GATTGTCAATGGCTGGCAGGTGG + Exonic
1171469241 20:25356687-25356709 CACTGTGGCAGAGTGGCAGGTGG + Intronic
1172133908 20:32674449-32674471 TATTGTTACTGGGTGGCAGGGGG + Intergenic
1175364947 20:58446717-58446739 CCTTTTGACTGAGTGGCAGAAGG + Exonic
1177126517 21:17200583-17200605 CCTTGTGAAAGAGAGGCAGAGGG - Intergenic
1177584273 21:23069674-23069696 CATTGGGAATCCGAGGCAGGTGG - Intergenic
1178095217 21:29207627-29207649 CATGGTGAAAGGGTGGAAGGTGG + Intronic
1179912829 21:44459488-44459510 CATGGAGAAGGGGTGGCAGGAGG - Exonic
1181489717 22:23253990-23254012 CATGGTGTACGTGTGGCAGGAGG + Intronic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1182516490 22:30861948-30861970 GATGGTGACTTAGTGGCAGGTGG - Intronic
1182786917 22:32915673-32915695 CATTGTGGGTAAGGGGCAGGAGG + Intronic
1184477249 22:44728499-44728521 CATTGTGAAGGAGTGTCCTGGGG + Intronic
949164133 3:917192-917214 CATTGTGAAACAGTGGTGGGGGG - Intergenic
949473609 3:4421407-4421429 CCTTGTGACTGAGTGTCATGGGG - Intronic
952276676 3:31883822-31883844 CTTTGTGTAAGAGTGGCATGTGG - Intronic
953504483 3:43470868-43470890 CTTTGGGAATCAGAGGCAGGTGG - Intronic
954276038 3:49542271-49542293 TTTTTTGAATGAGTGACAGGTGG - Intergenic
954330410 3:49886969-49886991 CAGTGTGAAAGAATGACAGGAGG - Intergenic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
954569098 3:51625613-51625635 CATTGGGAATGTGAGGCAGAAGG + Intronic
954850344 3:53594678-53594700 CATTGTGGAGTAATGGCAGGTGG + Intronic
956125333 3:66005638-66005660 CAGTGTGTGTGAGTGGAAGGGGG + Intronic
959319468 3:104852673-104852695 CTTTGGGAGTGAGAGGCAGGTGG + Intergenic
959611036 3:108295156-108295178 GAGTGTGCATGTGTGGCAGGAGG - Intergenic
959611119 3:108295652-108295674 GAGTGTGCATGTGTGGCAGGAGG + Intergenic
962250348 3:133832418-133832440 CTTGGTGAATGTGTGGCATGAGG - Intronic
962357591 3:134708197-134708219 AACTGTGATTGATTGGCAGGGGG - Intronic
965431288 3:168592313-168592335 AACTGTGACTGAGTTGCAGGGGG + Intergenic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
966148357 3:176838227-176838249 CTTTGCCAATCAGTGGCAGGTGG - Intergenic
967310540 3:188102044-188102066 CTTTGGGAAGGAGAGGCAGGAGG - Intergenic
969294831 4:6263721-6263743 CAGTGTGTGTGTGTGGCAGGTGG + Intergenic
969977700 4:11121350-11121372 CTTTGTGAATGAGTGACCTGTGG - Intergenic
978941014 4:114435578-114435600 CATTGAGAATGGGTGGAGGGAGG - Intergenic
979661376 4:123259480-123259502 CAGGGACAATGAGTGGCAGGTGG - Intronic
980755264 4:137150243-137150265 AATTGTGACTGACTGGCATGTGG + Intergenic
982062778 4:151621533-151621555 GATTGTGTGTGTGTGGCAGGGGG + Intronic
982120545 4:152138947-152138969 TATTGTCAATGAGTGGCAATTGG - Intergenic
983515904 4:168656413-168656435 ATTTGTGAATGAGTGACAGATGG + Intronic
984148791 4:176099733-176099755 AAGTGTGAAGGAGTGGGAGGGGG - Intronic
988062531 5:26191394-26191416 CATTGGGAATGAGTGAAATGTGG - Intergenic
988465197 5:31483764-31483786 CACTGAGGAGGAGTGGCAGGAGG - Intronic
988704460 5:33710916-33710938 CATAGTGAATGTGGGGCAAGTGG + Intronic
990611721 5:57464233-57464255 GAGTGTTAAGGAGTGGCAGGAGG - Intergenic
990880665 5:60533941-60533963 CATAGTGAAAGGGTGGAAGGTGG - Intergenic
994670867 5:102759866-102759888 TATAGAGAATGAGTGGGAGGAGG + Intronic
995841596 5:116447518-116447540 CGTTGTGCATGAGTGGCGTGAGG + Exonic
997399494 5:133591494-133591516 TCTTGTGAAGGAGTGGCAGGAGG - Intronic
998417405 5:141955832-141955854 CATTGGGAGTGAGTGGGAGCTGG - Exonic
999664328 5:153896984-153897006 CATGGTGACTGAGTTGCAAGAGG + Intergenic
1001023187 5:168201079-168201101 CATTGTGCATATGGGGCAGGAGG + Intronic
1001040807 5:168333814-168333836 CATCTTGAAGGAGTGGGAGGGGG - Intronic
1002020440 5:176361177-176361199 TATTGTGAAGGAGAGGCAGAGGG - Intronic
1002077003 5:176714266-176714288 CATGTTGAATGAGAGGAAGGAGG - Intergenic
1006699936 6:35963964-35963986 CTTTGTGAAGGTGAGGCAGGAGG + Intronic
1012526380 6:100182813-100182835 CATTGTGTGTGTGTGGCAGGGGG - Intergenic
1012945830 6:105464501-105464523 CATGGTGGAGGAGTGGCAAGTGG + Intergenic
1013700314 6:112760278-112760300 CATAGAGAATGATTGGTAGGTGG - Intergenic
1013701305 6:112773456-112773478 CATTGGTAATTAGTGGGAGGAGG + Intergenic
1014053966 6:116991253-116991275 CATTGATAATGTTTGGCAGGTGG - Intergenic
1016324865 6:142889225-142889247 CATTTTGAGAGACTGGCAGGAGG + Intronic
1016703166 6:147076746-147076768 CATTTTTAATGAATGGCAGCTGG + Intergenic
1020000674 7:4753949-4753971 CAGGGTGAAGGCGTGGCAGGTGG - Intronic
1023088378 7:36594992-36595014 AATTGTGCAGGAGTTGCAGGGGG - Intronic
1023362485 7:39430903-39430925 CATTGTGCATGTGTGGAAAGGGG + Intronic
1023656922 7:42432644-42432666 CCTTGTGTATGTATGGCAGGGGG - Intergenic
1024011388 7:45269982-45270004 CAAAGTGGTTGAGTGGCAGGTGG + Intergenic
1025104376 7:56158805-56158827 TAATGTGATGGAGTGGCAGGTGG - Intergenic
1026150405 7:67783552-67783574 CTCTCTGAATGGGTGGCAGGGGG + Intergenic
1028156520 7:87435843-87435865 CTTTGGGATTGAGTGGTAGGTGG + Intronic
1030066936 7:105666979-105667001 TATGGTGATTGAGTGGAAGGAGG - Intronic
1031561221 7:123240928-123240950 CATTGTGAATGAATGAAGGGAGG + Intergenic
1032991158 7:137396229-137396251 GATTCTGTGTGAGTGGCAGGTGG + Intronic
1035692187 8:1567555-1567577 GATGGTGAATGAGTGGAAGAAGG - Intronic
1036289295 8:7473227-7473249 CAGTGGGAGTGTGTGGCAGGTGG + Intronic
1036332186 8:7838305-7838327 CAGTGGGAGTGTGTGGCAGGTGG - Intronic
1036810181 8:11862599-11862621 GGTTGGGAATGGGTGGCAGGTGG + Intronic
1039122443 8:34162499-34162521 CATGCTGCATGAGTGGCAGATGG + Intergenic
1039144475 8:34431109-34431131 CATTAGGAATGAGTGCAAGGTGG - Intergenic
1041821095 8:62033634-62033656 CAGTGTGAGTGAGTGGGATGTGG + Intergenic
1046334339 8:112765006-112765028 CATAGTGAATGAGAGGTAAGAGG + Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1050379857 9:5016724-5016746 CATGGAGAATAACTGGCAGGAGG - Intronic
1052406316 9:28065394-28065416 CATTGTGAATAAGAGGGTGGGGG + Intronic
1052777536 9:32747822-32747844 CTTTGGGGATGAGTGGGAGGGGG - Intergenic
1055072370 9:72179960-72179982 CATTCTGAATTACTGGCGGGGGG + Intronic
1055337987 9:75252116-75252138 CATTGGGAGTGAATGGAAGGAGG - Intergenic
1056236282 9:84597954-84597976 GATGGAGAATGAGTTGCAGGGGG - Intergenic
1057472889 9:95373547-95373569 TATTGTGAATGAATGTCAGTCGG - Intergenic
1057955769 9:99406607-99406629 GATTCTTAATGAATGGCAGGTGG + Intergenic
1058142885 9:101376659-101376681 CTTTGTGCGTGAGTGGGAGGTGG - Intronic
1058142892 9:101376706-101376728 CTTTGTGCACGAGTGGGAGGTGG - Intronic
1059374854 9:113874081-113874103 CCTGGTGGATGAGGGGCAGGTGG + Intergenic
1059870527 9:118568842-118568864 CACTGTGACTGAGTGGGAGGAGG - Intergenic
1062528765 9:136990379-136990401 CATTGTGAATGAATGAATGGGGG - Intergenic
1186470608 X:9819262-9819284 CATTGTGAATGGATCTCAGGAGG - Intronic
1186569156 X:10695959-10695981 CATTGTGTGTGTGTGGCGGGGGG - Intronic
1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG + Intronic
1189437568 X:41006482-41006504 CATTGTGAGGCAGAGGCAGGAGG - Intergenic
1189709104 X:43790991-43791013 CATTTTAAATGACTGGCTGGTGG - Intronic
1190630428 X:52380745-52380767 CAGTGTGAGTGAGTGTGAGGAGG + Intergenic
1190634505 X:52420596-52420618 AAGTGTGAATGAGTGTGAGGAGG + Intergenic
1190730621 X:53223325-53223347 CATGGTGAGGGAGTGGCAGTGGG - Intronic
1194582482 X:95693435-95693457 CTTTGTGACTGATTTGCAGGTGG + Intergenic
1195300608 X:103526399-103526421 GATTGTGAAGGCTTGGCAGGGGG - Intergenic
1196653360 X:118191141-118191163 AAATGTGAATCAGTGGCAGCTGG + Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200985838 Y:9303256-9303278 CATTCGGAATGACTGGCAGCAGG + Intergenic
1202124738 Y:21557639-21557661 CATTCGGAATGACTGGCAGCAGG - Intergenic
1202154270 Y:21871741-21871763 CATTCGGAATGACTGGCAGCAGG + Intergenic
1202195246 Y:22294435-22294457 CATTCAGAATGACTGGCAGCAGG + Intergenic
1202299157 Y:23392921-23392943 CAGTGTGAAAGACTGGCAGCAGG - Intergenic
1202571652 Y:26277677-26277699 CAGTGTGAAAGACTGGCAGCAGG + Intergenic