ID: 1186776872

View in Genome Browser
Species Human (GRCh38)
Location X:12873641-12873663
Sequence AGTCCCCCTCTTCCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186776872 Original CRISPR AGTCCCCCTCTTCCCAGGGA AGG Intronic
900143891 1:1149847-1149869 CCTCCCCCTCCTCCAAGGGAGGG - Intergenic
900458106 1:2787041-2787063 AGACCCCCTGCTCCCAGGAAAGG - Intronic
900599469 1:3496906-3496928 AGTTCCCCTGGTCCCCGGGAAGG - Intronic
900998271 1:6134457-6134479 AGGCCCCCCGTTCCCAGGCAGGG + Intronic
901651811 1:10747252-10747274 AGACCCCACCTTCCCAAGGACGG - Intronic
901746668 1:11378260-11378282 AGACCCCTACCTCCCAGGGATGG - Intergenic
901932076 1:12602298-12602320 AGCCCCTGTCTTCCCAGGCAGGG - Intronic
902510614 1:16965152-16965174 ATTTACCCTCTTCCCAGGCAAGG - Intronic
902639199 1:17755857-17755879 AGAGCCCCTCACCCCAGGGAAGG - Intronic
905885986 1:41492237-41492259 TGTCCCCCTCTTCCCAGCCTGGG - Intergenic
906080716 1:43086496-43086518 AGTCCCACTTTTCTAAGGGAGGG + Intergenic
908943167 1:69461422-69461444 AGTCTCACTCTCGCCAGGGATGG - Intergenic
912706293 1:111917336-111917358 AGTACCCCACTTCCTAGGGAAGG + Intronic
915810961 1:158910024-158910046 ACTCTCCCTCTTCCCAGGACAGG - Intergenic
915910200 1:159910257-159910279 GGTGCCCCTACTCCCAGGGAGGG + Intergenic
919362160 1:196609019-196609041 GGCCCCCCTCCTCCCAGAGAAGG - Exonic
919793203 1:201305637-201305659 GGCCCTCCTCTTCCCAGGGCTGG + Intronic
922024181 1:221735326-221735348 AGCCCTCCTACTCCCAGGGAGGG + Intronic
922881277 1:228983192-228983214 AGGCCCTCTCTGCCCTGGGATGG + Intergenic
924125504 1:240846504-240846526 GGTCACCCTCTTCACTGGGAAGG + Intronic
924559259 1:245143918-245143940 AGTCCCTCTCTTCCCTGAGCAGG + Intergenic
1063782715 10:9344662-9344684 ACTCCCCCTCTTCCCCTGTAGGG - Intergenic
1063839419 10:10052981-10053003 AGTCCTCCTTTTCCCAGGTTAGG - Intergenic
1064207499 10:13336345-13336367 TTTCCCTCTCTTCCCAGGGCAGG - Exonic
1065115632 10:22480089-22480111 AATCCCCCTCTGTCCAGGGAGGG + Intergenic
1065739544 10:28784639-28784661 AGGCCCCCTCTTTCCAGGCATGG + Intergenic
1067666141 10:48280713-48280735 AGTCCCTCTCATCACAGGGCTGG - Intergenic
1067749318 10:48959762-48959784 GGTCCCCATCAGCCCAGGGAGGG - Exonic
1069706660 10:70462903-70462925 AGTCTCCCAGTTCCCAGGGCTGG - Intergenic
1070789183 10:79179653-79179675 AGTCTGCTTCTTCCCTGGGAAGG + Intronic
1072715398 10:97749088-97749110 AGTCCCCATCTTACACGGGAAGG + Intronic
1073110494 10:101060872-101060894 AGAACCCCTCTGGCCAGGGATGG + Intergenic
1073486542 10:103822610-103822632 GGGCAGCCTCTTCCCAGGGAGGG + Intronic
1074140779 10:110670618-110670640 GGGCTCCCTCTTGCCAGGGAAGG - Intronic
1075092079 10:119449426-119449448 AGACCCCGTCTGGCCAGGGATGG + Intronic
1075222963 10:120600573-120600595 CCTCCCCCTCTTCCCAGAGCCGG - Intergenic
1075481934 10:122789625-122789647 AGCCTCCTGCTTCCCAGGGATGG + Intergenic
1075634875 10:124023759-124023781 GCTTCCCCTCTTTCCAGGGAAGG + Intronic
1077001864 11:327329-327351 AGGCCCCCTCTCCCCAGGTGGGG + Intronic
1077091933 11:782550-782572 TGTCTCCCTCGTCCCAGGGAGGG - Intronic
1077333963 11:1995103-1995125 AGCCCCCCTCTGCCCAAGGCTGG + Intergenic
1077368395 11:2170514-2170536 AGTCCCCCTCTGTCCAGGCCTGG - Intronic
1077423092 11:2462104-2462126 ACGCCCCCTCAGCCCAGGGAAGG - Intronic
1077583792 11:3435194-3435216 AGCCCCTCACTGCCCAGGGACGG + Intergenic
1077774881 11:5259313-5259335 AGTCCCCCTTTTCCTAGGCGTGG - Intronic
1078057287 11:8018810-8018832 AGTTCCCCCCTTCTCAGGAATGG - Intergenic
1078426982 11:11259974-11259996 AGTCCTTCTCTTCCGAGTGAGGG - Intergenic
1078795816 11:14591172-14591194 AGTCCCTCACTGCCCAGGGCCGG - Intronic
1078840284 11:15071685-15071707 AGTCGCCCCCTCCCCTGGGAAGG - Intronic
1079190036 11:18269630-18269652 ATTCTCCCTGTTCCAAGGGAGGG - Intronic
1079553229 11:21727185-21727207 AGTCCCCCTCCTCCCAGGGAGGG - Intergenic
1081656920 11:44863446-44863468 TGTCCTCTTCTTCCCTGGGAAGG + Intronic
1081862621 11:46342175-46342197 GGTCCCCAGCTTCCCAGGGCTGG + Intronic
1083320470 11:61842836-61842858 AGTCCCCTTTTTCCCAGTGATGG - Intronic
1083584306 11:63845599-63845621 AGTCACCCTCTTCCCACTGCTGG + Intronic
1083631718 11:64098768-64098790 AGGGCAGCTCTTCCCAGGGAGGG + Intronic
1083852856 11:65378066-65378088 AGGCCCCATCTCCCAAGGGATGG - Intronic
1083944341 11:65915748-65915770 AGTCCCCCTCTGCCCAGCCTTGG - Intergenic
1084248004 11:67873368-67873390 AGTGCTCTTCTTCCCTGGGAGGG + Intergenic
1086436967 11:86791210-86791232 ACTCCCCCAGTTCCCAGGAAAGG + Intronic
1086754439 11:90542111-90542133 AATACCCCTCTTCCCAGCTAAGG + Intergenic
1086894511 11:92296339-92296361 ATTCCACCACTTCCCAGAGATGG - Intergenic
1089322216 11:117634114-117634136 GGTCCCCCTCTGCCCTGGGTCGG - Intronic
1089491732 11:118888152-118888174 AGCCTCCTTCTTCCCAGGGCAGG + Intronic
1089987188 11:122825410-122825432 AGTCCCGCTTTTCCAGGGGAGGG + Intergenic
1090077465 11:123588240-123588262 TGGTACCCTCTTCCCAGGGATGG - Intronic
1202816946 11_KI270721v1_random:50285-50307 AGCCCCCCTCTGCCCAAGGCTGG + Intergenic
1091728145 12:2859465-2859487 AGGGCCACTCTTCCAAGGGAGGG + Exonic
1091969353 12:4772785-4772807 CGTCCCCAGCTTCCCTGGGAAGG + Intronic
1092262446 12:6959866-6959888 GGTACCCCCCTTCCCGGGGAGGG + Intronic
1092302623 12:7266665-7266687 AGTTCCTCACTTGCCAGGGATGG + Intergenic
1092418294 12:8308756-8308778 AGTGCTCTTCTTCCCTGGGAGGG + Intergenic
1092730941 12:11533824-11533846 ACTCCCCTCCTTCACAGGGAGGG + Intergenic
1102208259 12:111105384-111105406 TGTCCGCCTCCTCCCAGGAAGGG + Intronic
1102329149 12:112014049-112014071 CGCGCCCCTCTTCCCAGGGTTGG + Intronic
1104686597 12:130788854-130788876 AGTCCCACTCAGCCCCGGGAAGG - Intergenic
1104776279 12:131391949-131391971 AGTCTCCCTCTCCCCAGGGGTGG + Intergenic
1107748367 13:43537330-43537352 ATTCCCCTTCTACCCTGGGAAGG - Intronic
1109211178 13:59537812-59537834 AGTTCCCCTTGGCCCAGGGAAGG + Intergenic
1110869394 13:80432599-80432621 AGTCAACCTCTTCCCAGTGTGGG - Intergenic
1111631918 13:90853362-90853384 AGTCCCGCTTTTCTGAGGGAGGG - Intergenic
1111976125 13:94968408-94968430 AGTCGCCCTTTCCCCGGGGACGG - Intergenic
1114494938 14:23126090-23126112 AGCACCCTTCCTCCCAGGGAAGG + Exonic
1114600720 14:23953746-23953768 GGTTCCACTCTTCCCAGGGGCGG - Exonic
1114968952 14:28001773-28001795 GGTTCCCCTCTGCCCAGGGCAGG - Intergenic
1115646686 14:35373008-35373030 GGCCCCTCTTTTCCCAGGGAAGG + Intergenic
1116573249 14:46544929-46544951 AGTCCCACTTTTCTGAGGGAGGG + Intergenic
1116781242 14:49240328-49240350 AGTCACACTCTCCCTAGGGAGGG - Intergenic
1117300250 14:54418682-54418704 AGAGCCCATCTTCCCAGGGTTGG + Intronic
1117314923 14:54565375-54565397 AGTCCCACTCTTCCCCGGGGAGG - Intergenic
1120142160 14:80941488-80941510 ACTTCCCCTCGTCCCAGGGGTGG - Intronic
1120877089 14:89384996-89385018 AGTCGGCATCTTACCAGGGAAGG + Intronic
1121887180 14:97554193-97554215 AGACCCACTCTATCCAGGGAGGG + Intergenic
1122124607 14:99572256-99572278 AGTCCCTCCCTCCCCAGGGATGG + Intronic
1122506155 14:102233179-102233201 CGGCCCCCACATCCCAGGGAGGG - Intronic
1125130415 15:36278477-36278499 AGTGACCCTCTTCCCACAGAGGG - Intergenic
1126303843 15:47231507-47231529 ACTCCCACTCTTTCCAGGCAGGG + Intronic
1129236360 15:74225951-74225973 ATTCTCCATCTTCCCTGGGACGG - Intergenic
1131403522 15:92145307-92145329 ACTCCTCCTCTTCCCAGGAGAGG - Intronic
1132305330 15:100807812-100807834 ACTCACCTTCTGCCCAGGGAGGG + Intergenic
1132661675 16:1064302-1064324 AGCCCCCAGCTTCCCAGGGCGGG - Intergenic
1133223444 16:4328836-4328858 AGTCCCCATCTGTCCTGGGAAGG + Intronic
1133257994 16:4529943-4529965 AGTCCCCCTATTCCGTGGGTCGG + Intronic
1133339058 16:5025161-5025183 AGTCTCCCTCCTCCTGGGGAAGG - Exonic
1134756877 16:16674950-16674972 TTTTCCCCTCTTCCCAGGGTGGG + Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1134989191 16:18684213-18684235 TTTTCCCCTCTTCCCAGGGTGGG - Intergenic
1136111920 16:28068859-28068881 AGGGCCACTGTTCCCAGGGAAGG + Intergenic
1136235040 16:28908545-28908567 GGGCCCCTTCTTCCCAGGCAGGG - Intronic
1136297713 16:29313117-29313139 AGTCCCGCTCTTCAGAGGGGAGG - Intergenic
1136926673 16:34381226-34381248 CTTCCACCTCTTCCCAGGAAAGG + Intergenic
1136977901 16:35030581-35030603 CTTCCACCTCTTCCCAGGAAAGG - Intergenic
1137600299 16:49751940-49751962 AGGCCCCCACAGCCCAGGGAGGG + Intronic
1138387270 16:56644189-56644211 AGCCCCCAGATTCCCAGGGAAGG - Intronic
1139055092 16:63173768-63173790 ATTCACCCTTGTCCCAGGGAGGG - Intergenic
1139469238 16:67169614-67169636 AGTCCCACTTCTCCTAGGGAAGG + Exonic
1140196740 16:72861415-72861437 AGTAACCCGCCTCCCAGGGAGGG - Intronic
1140218802 16:73028721-73028743 ACTGCCCCCTTTCCCAGGGATGG - Intronic
1141341486 16:83208050-83208072 AGCTCCCATCATCCCAGGGAAGG - Intronic
1141486735 16:84345105-84345127 AGTCCCCACCTGGCCAGGGAAGG - Intergenic
1141886480 16:86895781-86895803 TCTCTCCCTCTTCCCAGGGAAGG - Intergenic
1142266881 16:89068040-89068062 AGACACCCTCTCCCCAGGGCTGG + Intergenic
1142917534 17:3154142-3154164 GGGCCCCCTCTGCCCAGGGAAGG - Intergenic
1144178754 17:12732681-12732703 AATCCCCCTTTCCCCAGGGCTGG - Intronic
1144782237 17:17814022-17814044 CACCCCCCTCCTCCCAGGGATGG + Intronic
1145305150 17:21670012-21670034 ACACCCCCTCTCCCCTGGGAGGG + Intergenic
1145750873 17:27354130-27354152 AGTCCCCCACTTCTCAGGGTGGG - Intergenic
1145762034 17:27430522-27430544 TGCCCCTCTCTTCCCAGGGCTGG - Intergenic
1146890631 17:36504231-36504253 AGTCCCCCTCATCCGACGCATGG + Intronic
1146927909 17:36757667-36757689 ATTCCACCACTTCCCAGGCATGG - Intergenic
1148468183 17:47877401-47877423 AGACCCTCTGATCCCAGGGAAGG - Intergenic
1150630587 17:66877588-66877610 TGGCCATCTCTTCCCAGGGAGGG - Intronic
1151839953 17:76610605-76610627 AGTCCCGCTTTTCTGAGGGAGGG - Intergenic
1152103405 17:78315639-78315661 AGTCACTCTCTACCCAGGGGGGG - Intergenic
1154339823 18:13493764-13493786 TGTGCCCCTCTTCCCAGCCACGG - Intronic
1157085520 18:44576735-44576757 ACTCACCCTTTTTCCAGGGATGG + Intergenic
1157712323 18:49858515-49858537 AGCCCCCCACCCCCCAGGGAGGG + Intronic
1158190786 18:54826432-54826454 GGAACCCCTCTTCCCAGGGAAGG + Intronic
1158419164 18:57277773-57277795 TGGCCCCCTCTTGCCAGGGAAGG + Intergenic
1159955170 18:74513792-74513814 AGACCCCCTGGACCCAGGGAAGG - Intronic
1160878369 19:1308398-1308420 TTTCCCCCTCTGCACAGGGAAGG - Intergenic
1160905675 19:1450639-1450661 AAACCCCCTCTTTCCAGAGAGGG - Intronic
1161350132 19:3786535-3786557 AGAACCCCGCTTCCCAGGGTGGG - Intronic
1161681303 19:5681097-5681119 AGCCCACCTCCTCCCGGGGAGGG - Exonic
1162461248 19:10815661-10815683 AGTCCCCATGGTCCCTGGGATGG + Intronic
1163102868 19:15108308-15108330 ATTCCCAATGTTCCCAGGGAAGG + Intronic
1163388639 19:17015889-17015911 AGGCATCCTCTTCCCTGGGAAGG - Intronic
1164675116 19:30095539-30095561 AGTCCCCTTCACCCCAGGGCTGG - Intergenic
1164824461 19:31274350-31274372 TCTCCCCCTCCTCCCATGGATGG + Intergenic
1165225706 19:34353063-34353085 AGTGCGCCCCATCCCAGGGAGGG + Exonic
1165242197 19:34477828-34477850 AGTCCCACTGTTCCAAAGGAGGG - Intergenic
1165497206 19:36160104-36160126 AGTCCCGCTTTTCTCGGGGAGGG - Intergenic
1165754499 19:38284556-38284578 ACTCCTCCTCTTCCCAGAAAGGG + Intronic
1166333332 19:42091187-42091209 CCTCGCCCTCTTCCCAGGCAAGG + Exonic
1166750617 19:45162524-45162546 AGGGCCACTCTGCCCAGGGACGG + Intronic
1167725905 19:51212370-51212392 AGGTCTCCTCTTCCCAAGGAGGG - Intergenic
1167830906 19:52021699-52021721 ACTCGCCCTCTTCCCCAGGATGG - Intronic
926140010 2:10362867-10362889 GGTCCCCCTCTGCTCAGGAATGG - Intronic
926695119 2:15765715-15765737 TGGCACCCACTTCCCAGGGATGG - Intergenic
927208153 2:20622999-20623021 AGGCCGCCTCTTTCCAGGAACGG - Intronic
927848451 2:26484320-26484342 AGCCCCACTCTTCCGAGGCAGGG - Intronic
929658627 2:43759539-43759561 AGACCCACCCTGCCCAGGGATGG + Intronic
931310695 2:61077040-61077062 TGTCCACCTCTTCCCAGCGCTGG - Exonic
931831208 2:66053293-66053315 ACTCTCCCTCTTTCTAGGGAGGG + Intergenic
933187344 2:79292597-79292619 AGTACCCCATTTCCCAGGGAAGG + Intronic
934506910 2:94902117-94902139 ATTCCCCCTTATCGCAGGGAAGG - Intergenic
934523065 2:95032061-95032083 ACTCCCCCACCTCACAGGGATGG + Intronic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
938039096 2:128061000-128061022 GGTCCCACATTTCCCAGGGAAGG + Intergenic
938240328 2:129738181-129738203 ACTTCCCCTGTTCCCTGGGATGG - Intergenic
942381972 2:175401079-175401101 AGGCACCTTCTTCCCAGGGCGGG + Intergenic
942620015 2:177835784-177835806 AGTCCCTCACTGCCCAGGGCCGG - Intronic
946153453 2:217791454-217791476 AGTCCCCCTCTTTCATGGGAAGG - Intergenic
947792927 2:232878033-232878055 AGGCCCCCTGGTCCCAGTGAGGG - Intronic
948212966 2:236208565-236208587 AGGGCACCTCTTCCCAGGGTGGG - Intronic
948342936 2:237269807-237269829 TGTCCCCATCTTTCCAGAGAAGG - Intergenic
948770790 2:240250455-240250477 AGGCCACCTCTTCCCAGCCATGG + Intergenic
948980997 2:241494710-241494732 AGTCCCCCTGTGCCCTGGGAGGG + Exonic
1169770610 20:9195904-9195926 AGTCCACCCCTCCCCAGGCATGG - Intronic
1170305398 20:14932330-14932352 ACTCCGCCTGTTCCCAGGGCAGG - Intronic
1170439254 20:16361559-16361581 AGTCCCATCCTTCACAGGGATGG - Intronic
1172482594 20:35279739-35279761 AGTCCCCGCCTGCCAAGGGATGG + Exonic
1173614519 20:44394150-44394172 TCTCCCCCTCCTCCCAGGGCTGG - Intronic
1174416801 20:50372865-50372887 ATTCCTCCCCTTCCCTGGGAGGG - Intergenic
1174451328 20:50622524-50622546 ACTCCTCCTCTTCCCAGGGGCGG + Intronic
1175208193 20:57328098-57328120 ACTCCCTCTGTTCACAGGGATGG - Intergenic
1175285306 20:57833622-57833644 AGGACCCCTTTTCCCAGCGAGGG - Intergenic
1175749179 20:61483491-61483513 ACTCCTCCTCTTCTCAGGGATGG + Intronic
1175902258 20:62364654-62364676 AGTCCCCACCTTCCCAGGCTGGG + Intronic
1180001683 21:44998077-44998099 AGTCCCCATCTTCTGAGGGTGGG + Intergenic
1181427727 22:22855269-22855291 AGTCCCCCTCAGCCCAGAGCCGG - Intronic
1182006622 22:26965565-26965587 AGTGCCCCTCTGCAGAGGGAAGG + Intergenic
1182446112 22:30390542-30390564 AGGCACCCTGCTCCCAGGGATGG + Intronic
1183417168 22:37689089-37689111 ACGCCCCTTCTTCCCAGGGCTGG - Intronic
1184089011 22:42282778-42282800 CGGCCCCCTCCTCCCAGGCATGG - Intronic
1184518748 22:44979625-44979647 AGTCTCCCTCTGAGCAGGGAAGG - Intronic
1184551880 22:45209051-45209073 AGTCCAGCCTTTCCCAGGGAGGG - Intronic
1184643803 22:45885564-45885586 AGGGCCCCACTCCCCAGGGACGG + Intergenic
1185087062 22:48746682-48746704 AGAACCCCTCTTCCCAGGGCGGG - Intronic
950408745 3:12820675-12820697 AGTTCCTCTCCTCCCAGTGAAGG - Intronic
950812181 3:15659325-15659347 AGTGCCCCCCTTCCCAGGCATGG - Intergenic
951024865 3:17817935-17817957 AGTCCCTCACTGCCCAGGGCCGG + Intronic
954432062 3:50476066-50476088 AGGGACCCTCTTCCAAGGGAAGG - Intronic
954437956 3:50505848-50505870 AGTCCCCCTATTCCTTGGGAAGG - Intergenic
954577663 3:51685701-51685723 AGTCCCACCCTGCCCAGAGATGG - Intronic
954646780 3:52136425-52136447 AGTCCCCCTCTTCCCAGGCCAGG + Intronic
960785100 3:121363443-121363465 AGTTCCCCTCTGGCTAGGGATGG + Intronic
961204649 3:125072255-125072277 AGTCCCCTTATTCCCAGGCTTGG + Intergenic
961349454 3:126290370-126290392 AGACCCCCTCTTCCAGGGGCTGG - Intergenic
961628479 3:128279716-128279738 TGTCCCCCTGCTCCCAGGCATGG + Intronic
961795157 3:129403822-129403844 AGCCCACCTCTTGCCAGAGAAGG + Intronic
961880785 3:130060004-130060026 AGTCCCGCTTTTCTGAGGGAGGG + Intergenic
962900135 3:139754611-139754633 AGTACCCCTCTCCCCAAGAAGGG - Intergenic
966076058 3:175937484-175937506 AGTCCCTCACTTCCCGGGGCTGG - Intergenic
966906536 3:184530341-184530363 ATGCCCCCCCTTCCCTGGGAGGG + Intronic
966978067 3:185103902-185103924 AGTCCCCCTCCTCCCTGTGCAGG - Intronic
967041928 3:185701956-185701978 TGTCCCCTCCTTCCCCGGGAGGG + Intronic
967768972 3:193313216-193313238 AACCCACCTCTTCCCAGGGTAGG + Intronic
967952784 3:194853551-194853573 ATTCCCCCTCTGCCCTGGGGAGG - Intergenic
968033359 3:195523174-195523196 AGCCCTCCCCTTCACAGGGATGG - Intronic
970256626 4:14175248-14175270 AGTCCCGCTTTTCTGAGGGAGGG - Intergenic
972976270 4:44640532-44640554 GGTCCCACCCTTCCCATGGAAGG - Intronic
973159906 4:47003263-47003285 AATCCACCTCCTCCCAGGTAAGG + Intronic
973728750 4:53802900-53802922 AGTTCCCCTCTTCCAATTGATGG - Intronic
973882704 4:55289953-55289975 AATCCACCTTCTCCCAGGGAGGG - Intergenic
977811277 4:101358466-101358488 AGTACCCCTCTGCCCAGGCTGGG + Intergenic
980388712 4:132119157-132119179 AGTCCCCCTTTTTCTAGGGGAGG + Intergenic
980611971 4:135172023-135172045 AGTCCCGCTCTTCTGGGGGAGGG - Intergenic
981625218 4:146747510-146747532 AGTCTCCATGTTCCCAGGGGTGG - Intronic
982240670 4:153296421-153296443 AACGCCCCTCTTCCCTGGGAGGG + Intronic
982436272 4:155385132-155385154 TGCCCCTCTCTTCCCAGGGCCGG - Intergenic
983165942 4:164477463-164477485 GGGCTCCCTCTCCCCAGGGAAGG + Intergenic
984944227 4:184958657-184958679 TGTCAGCCTCTCCCCAGGGATGG + Intergenic
985649209 5:1099447-1099469 AGTCCACCTCCTCCGGGGGACGG + Intronic
985649224 5:1099483-1099505 AGTCCACCTCCTCCGGGGGACGG + Intronic
985824414 5:2181880-2181902 AGGCCTCATCTTCCCAGGGTCGG - Intergenic
985975377 5:3415980-3416002 AGACCCCGTTTCCCCAGGGAAGG + Intergenic
986746256 5:10747740-10747762 AGCCACCCTCTTCCCAAGGCTGG - Intronic
988815492 5:34830321-34830343 AGCCCCCGTCTTCCCAGTGGAGG - Intronic
990594914 5:57303069-57303091 AGTCCCCCACACCTCAGGGAAGG - Intergenic
990972962 5:61529662-61529684 ACTCCCCCACTTCCCTAGGAGGG - Intronic
991761533 5:69921054-69921076 AGGCCCCCGCTTCCCACGTACGG + Intergenic
991785796 5:70197046-70197068 AGGCCCCCGCTTCCCACGTACGG - Intergenic
991840761 5:70796103-70796125 AGGCCCCCGCTTCCCACGTACGG + Intergenic
991878241 5:71197437-71197459 AGGCCCCCGCTTCCCACGTACGG - Intergenic
993192509 5:84699447-84699469 AGTCCCGCTTTTCTGAGGGAGGG + Intergenic
994898887 5:105744676-105744698 ACTCTCCCTCTTGCAAGGGATGG + Intergenic
995990152 5:118228733-118228755 AGTTCCCCTATGCCCATGGAGGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997388380 5:133493507-133493529 AGTCCCCATTTTCACAGAGAGGG + Intronic
1000342326 5:160287437-160287459 AATCTCCCTTTTCCCAGTGAGGG - Intronic
1000586961 5:163112254-163112276 AGTCTCCTGTTTCCCAGGGATGG - Intergenic
1001559244 5:172658721-172658743 AGCCGCCCTCCTCCCTGGGAGGG + Intronic
1004106002 6:12668159-12668181 AGTCCCACTCTTCTAGGGGAGGG + Intergenic
1004106035 6:12668280-12668302 AGTCCCACTCTTCTAGGGGAGGG + Intergenic
1006101539 6:31688970-31688992 AGCCCACCCCTTCCCAGGAAGGG + Intronic
1007254729 6:40520754-40520776 TGTCCCCCTCTGCCCAGGCCTGG + Intronic
1007952932 6:45888140-45888162 AATCCCCCCCACCCCAGGGAAGG - Intergenic
1008932635 6:56955518-56955540 AGTATCCCAATTCCCAGGGAAGG - Intronic
1013612675 6:111809651-111809673 AATCCCCCTCTTCACTGGGGAGG + Intronic
1013764413 6:113558200-113558222 AGTCCTCCTCACCCAAGGGAAGG + Intergenic
1014796273 6:125728547-125728569 TGTCCTCCTCTTCCCAGGTGTGG + Intergenic
1015851472 6:137577857-137577879 AGACCACCTCTACCCAGGAAGGG + Intergenic
1016648318 6:146435027-146435049 ATTCCCTTTCTTCCCAGAGAAGG - Exonic
1020326665 7:6979581-6979603 AGTGCTCTTCTTCCCTGGGACGG + Intergenic
1021564368 7:22002285-22002307 ACTCCCCCTCTTCCATGTGAGGG - Intergenic
1023601994 7:41889476-41889498 AGTCCCCCTCTGCCCTGGCATGG + Intergenic
1024137542 7:46426087-46426109 AGTCTGCCTCTTCACTGGGATGG + Intergenic
1024389005 7:48786009-48786031 GGTTGCCCCCTTCCCAGGGAAGG - Intergenic
1025283144 7:57642686-57642708 ACACCCCCTCTCCCCTGGGAGGG + Intergenic
1026460766 7:70613498-70613520 AGTCTCCCTCCTCCCAGGCTGGG + Intronic
1031542251 7:123008429-123008451 AGTCCCCCATCTCCCAGGAATGG - Intergenic
1035232298 7:157472559-157472581 AGGCTCCCTCTCCCCAGGCACGG - Intergenic
1038696597 8:29812232-29812254 AATCTCCCTGTTCCCTGGGAAGG + Intergenic
1041128244 8:54667146-54667168 TGTGCTCCTCTTCCCAGGCATGG - Intergenic
1041420906 8:57666436-57666458 ACTCTCCCTGCTCCCAGGGAGGG + Intergenic
1041429724 8:57765797-57765819 AATCCGCCTCTTCCCTGGCACGG - Intergenic
1042347251 8:67740215-67740237 AGTCCCCCTTTTCCCAGGACTGG - Intronic
1042399732 8:68331414-68331436 AATCCCACCCCTCCCAGGGAAGG + Exonic
1045498669 8:102728869-102728891 AGTGCCCCTGGTCCCAGGGCAGG - Intergenic
1046715255 8:117559974-117559996 AATCCCTCTCTTCTGAGGGATGG - Intergenic
1047141357 8:122143330-122143352 AGTCCATCTCTTCCCAAGGTAGG - Intergenic
1049500304 8:142959588-142959610 AGTCCCTCACTGCCCAGGGCCGG - Intergenic
1049815268 8:144596245-144596267 CGTCCCCCTCTGCCCACTGAGGG - Intronic
1052969739 9:34370206-34370228 AGTCCTCCTGTTCCCTGGGAGGG + Exonic
1053169830 9:35870479-35870501 AGTCCACCTCGTCCCAGAAAGGG - Exonic
1055395172 9:75866633-75866655 AGTCTCCAATTTCCCAGGGAAGG + Intergenic
1057570972 9:96204065-96204087 AGGCCCCCTCCTCGCAGGGCTGG - Intergenic
1058820785 9:108727788-108727810 AGTTCCCCTCTTGCTAGGGCTGG - Intergenic
1058862120 9:109126714-109126736 GTTCCCCCTCTTCACAGGAATGG + Intergenic
1059609511 9:115877849-115877871 ACTCCCCCTTTTCCTATGGATGG + Intergenic
1061211059 9:129193731-129193753 ACTCCCCCATTTTCCAGGGAAGG + Intergenic
1061883054 9:133577608-133577630 AGCCCCTCTCTGCCCAGGGAAGG - Intergenic
1062176961 9:135168732-135168754 AGCCCCCCTTCTCACAGGGAAGG + Intergenic
1062183395 9:135203148-135203170 ACTCCCTCTCTCCCCAGGGCAGG + Intergenic
1062325422 9:136010391-136010413 AGTCCCCCGCTCCCCAGGTCCGG + Exonic
1186776872 X:12873641-12873663 AGTCCCCCTCTTCCCAGGGAAGG + Intronic
1190325690 X:49205637-49205659 ACTGCCCCTCTTCCCATGGCTGG + Exonic
1193414178 X:81201877-81201899 CCTCGCCCTCTTCTCAGGGAAGG + Exonic
1195675087 X:107501981-107502003 AGCCCCCCTCTCCACAGGGGAGG + Intergenic
1197831586 X:130648714-130648736 TGCACCCCCCTTCCCAGGGAGGG - Intronic
1200049905 X:153423201-153423223 AAACCCCCTCTCCCCTGGGAGGG - Intergenic