ID: 1186776875

View in Genome Browser
Species Human (GRCh38)
Location X:12873646-12873668
Sequence AGGGGCCTTCCCTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186776875_1186776885 12 Left 1186776875 X:12873646-12873668 CCCTCTTCCCAGGGAAGGCCCCT 0: 1
1: 1
2: 2
3: 39
4: 360
Right 1186776885 X:12873681-12873703 CCAGAAGAAATTGCTATTAAAGG 0: 1
1: 0
2: 0
3: 20
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186776875 Original CRISPR AGGGGCCTTCCCTGGGAAGA GGG (reversed) Intronic
900100493 1:960230-960252 GGGGGGCTTCCCGGGGAAGAAGG + Intergenic
900115982 1:1028107-1028129 ACGGGGCTTCCCAGGGAAGCCGG + Intronic
900143083 1:1146635-1146657 AGGGGCTCTGCCTGGGCAGAGGG + Intergenic
900173457 1:1281631-1281653 AGAGGCCTTGCCCGGGAGGAGGG + Intronic
900472161 1:2860369-2860391 AGGGGCCTTCCTGGGCCAGATGG - Intergenic
900521204 1:3106314-3106336 AGGGGAGCTCCCTGGGCAGAGGG + Intronic
900523724 1:3118501-3118523 AGGGGCCTTCCCCGGCATGATGG + Intronic
900710614 1:4111092-4111114 TGGGGCCTTCCATGGGCGGATGG + Intergenic
900773545 1:4564390-4564412 ATGGGGGTTCCCTGGGTAGAGGG - Intergenic
901013057 1:6211792-6211814 AGGGGGCTGCCCTGGGAGGCTGG + Intronic
901058816 1:6462204-6462226 AGGGGCCTTACTTGGCAAGCAGG - Intronic
901445428 1:9305284-9305306 AGGGGACATCCCTGGGAAGAGGG - Intronic
901686738 1:10947537-10947559 CCGGGGCTTCCCTGGAAAGACGG + Intronic
901925665 1:12564709-12564731 AGAGGCCTTCCAGGGGAAGCAGG - Intergenic
902331568 1:15733568-15733590 TGGGGCCTTCCCAGGAAAGAGGG + Intronic
902555985 1:17247070-17247092 AGGGGCTTTCCCTGGGGTGCTGG - Intergenic
902706685 1:18210232-18210254 TGGGTGCTCCCCTGGGAAGAGGG + Intronic
903259608 1:22124221-22124243 AGGGGCTTTCCAAGGGACGAAGG + Intronic
903501879 1:23804953-23804975 AGGTGACTGACCTGGGAAGATGG - Intronic
904295544 1:29517670-29517692 TGGGGCTTCCTCTGGGAAGAAGG + Intergenic
905318437 1:37098322-37098344 AGGGGCCTGCCCTGGGGCCAAGG + Intergenic
905521770 1:38605796-38605818 AGCGGCCTCCCTTGGGAAGCAGG - Intergenic
906792235 1:48669094-48669116 AGCTGACTTCCCTGGGTAGATGG + Intronic
907222030 1:52914167-52914189 AGGGGCCTCCAGTGGGCAGAGGG + Intronic
907491567 1:54811976-54811998 AGGGGCACTCCCAGGGCAGAGGG + Intronic
907844663 1:58193157-58193179 TAGTGCCCTCCCTGGGAAGAGGG + Intronic
908599275 1:65721735-65721757 AGGGGCCTCCCATGGGATGTAGG - Intergenic
910123494 1:83815776-83815798 AGGGGTCTCCCTTGGGCAGATGG + Intergenic
910778455 1:90900059-90900081 AGGGCCATTCACTAGGAAGATGG - Intergenic
912529570 1:110310509-110310531 AGTGACCTTCTCTGGGAAGTAGG + Intergenic
912864587 1:113245875-113245897 GGGGGCCATCCCTGGGATAAAGG + Intergenic
913608364 1:120487572-120487594 AGGGGCTTTACCTGGGAATGCGG - Intergenic
914340323 1:146754578-146754600 GTGGGCCTTCCCTGGAAGGAAGG - Intergenic
914490249 1:148146989-148147011 GGCGGGCTTCCCTGGGAGGAAGG + Intronic
914582838 1:149034265-149034287 AGGGGCTTTACCTGGGAATGCGG + Intronic
914911642 1:151791557-151791579 AGGGGCTCACCCTGGGAACAGGG + Intergenic
915810960 1:158910019-158910041 TGGGACCTGTCCTGGGAAGAGGG + Intergenic
916691325 1:167192752-167192774 AGTGCCTTTCTCTGGGAAGACGG + Intergenic
917471836 1:175332385-175332407 GGGGGACTTCACTGGGGAGAAGG - Intronic
920194387 1:204217173-204217195 AGGGGCCTGATGTGGGAAGAGGG - Intergenic
921149128 1:212385875-212385897 AGGTGCCTGGGCTGGGAAGAGGG - Intronic
921390287 1:214608224-214608246 GGCGGGCTTCCCTGGGAGGAAGG - Intronic
922781656 1:228257245-228257267 AGGTGCCTCCCCTGGGAAAGTGG + Intronic
922866870 1:228868000-228868022 AGGGGCCTTGACTGGGAATCTGG + Intergenic
1062952615 10:1516100-1516122 AGGGTCGTCCTCTGGGAAGAGGG - Intronic
1063667340 10:8071268-8071290 AGGAGGCTTTCCTGGGAAGTTGG + Intronic
1063865525 10:10361388-10361410 AGCTGCCTCCCCTGTGAAGAAGG - Intergenic
1064156493 10:12907318-12907340 ATGGGGCTTCACAGGGAAGATGG - Intronic
1064342450 10:14499491-14499513 AGGTGCCTTCCCGGCGAGGAAGG - Intergenic
1066207849 10:33207457-33207479 AGGGGCCTCCCAAGGGAAAAGGG + Intronic
1066456688 10:35578436-35578458 AGGGCCCTTCCCTGGGGGGTGGG - Intergenic
1066481522 10:35799813-35799835 AAGGGCCTACTTTGGGAAGATGG + Intergenic
1067086062 10:43238775-43238797 TGGGCCCTTCCCATGGAAGAGGG - Intronic
1067833065 10:49621357-49621379 TGGGGTCTCCCCAGGGAAGAAGG + Intronic
1069515933 10:69077258-69077280 AGGGCGCTTCCCTAGGGAGAAGG - Intergenic
1069593715 10:69657090-69657112 GAGGGCCATCCCTGGAAAGATGG - Intergenic
1069595536 10:69667585-69667607 TGGAGCATTCTCTGGGAAGATGG + Intergenic
1069832105 10:71287754-71287776 AGGCTCCTTACCTGGGCAGATGG - Exonic
1070507841 10:77131024-77131046 AGTGGCTGACCCTGGGAAGAAGG + Intronic
1070523592 10:77275907-77275929 ATGGGTCTTCACTAGGAAGATGG + Intronic
1070786313 10:79164165-79164187 GTGGGCCAGCCCTGGGAAGAAGG - Intronic
1071516042 10:86298609-86298631 AGGGGCCTTTCCAGGGAGGTGGG - Intronic
1072686851 10:97542615-97542637 AGGGGCCTTCCCTGTTGGGAAGG + Intronic
1073110496 10:101060877-101060899 AGGCGCCATCCCTGGCCAGAGGG - Intergenic
1073825941 10:107321566-107321588 AGAGGCCATGCCTGGGAGGAAGG + Intergenic
1074859641 10:117500596-117500618 AGGGTCCCTGCCTGGGAAGTTGG + Intergenic
1074930155 10:118116889-118116911 AATGGCTTTCCCTGGGCAGAGGG + Intergenic
1075330200 10:121568503-121568525 AGGTGCCTTCCCTGTGAGGGAGG - Intronic
1075554402 10:123419863-123419885 AGGGCTCTCCCCTGGGAAGTGGG + Intergenic
1075584158 10:123645072-123645094 AGGAGCCTTCTCTGTGTAGAAGG + Intergenic
1075634877 10:124023764-124023786 AATTGCCTTCCCTGGAAAGAGGG - Intronic
1076161250 10:128245767-128245789 AGGGAGCTTCCCAGGGCAGATGG - Intergenic
1076195164 10:128512610-128512632 AGGGGCCTTCCTCAGGATGATGG - Intergenic
1076338933 10:129729273-129729295 AGGTGCCTTCCCTGTGCAGTGGG - Intronic
1076536033 10:131178269-131178291 AGGGGACTTCCCTGGAAACAAGG + Intronic
1077078093 11:710226-710248 AGGGGGCTTCCCTGGAGGGAGGG + Intronic
1077091932 11:782545-782567 AGGAGCCCTCCCTGGGACGAGGG + Intronic
1077486159 11:2839239-2839261 AGGCCCCTTCCAAGGGAAGAGGG + Intronic
1078891954 11:15565647-15565669 GGGGGCCTTCTCTGGGAAATTGG - Intergenic
1079227037 11:18615501-18615523 AGGGGCATTCCTTTGGAAGAAGG + Exonic
1080224317 11:29943501-29943523 TGTGGCCTTCCTTGGGCAGATGG + Intergenic
1081095063 11:38921762-38921784 AGGGGGATTCCCAGGCAAGATGG - Intergenic
1082745371 11:56955143-56955165 AGGGTCCTTCCCTTGGCACAAGG + Intergenic
1082829050 11:57601969-57601991 GGGGGCCTTCCTTGGGAATGAGG - Intronic
1083061365 11:59876189-59876211 AGGGGCCTTCCATGGAAATCAGG + Intergenic
1083246030 11:61429329-61429351 AGGGTCCTGGGCTGGGAAGAGGG + Intronic
1083292025 11:61695805-61695827 AGTGGCCTTGCCTGGAAGGAGGG + Intronic
1083619103 11:64040272-64040294 GGGGGACTTCCCAGGGAAGGGGG + Intronic
1084315069 11:68341160-68341182 AGGGGTGATCCCTGGGGAGAGGG + Intronic
1084390369 11:68871819-68871841 AAGGTCCTTACCTGGGAAAAAGG - Intergenic
1084519625 11:69655473-69655495 AGGCGCCTGCCCTGGGAGGAAGG + Intronic
1084560305 11:69901525-69901547 AGGGGATTTCCCTGGGAAGGGGG - Intergenic
1084760524 11:71267899-71267921 AGGGGCCTGCCCTGGGTGGTGGG - Intergenic
1085048788 11:73368748-73368770 AAGGGGCTTCCCTTGGCAGAAGG - Exonic
1085128336 11:74017227-74017249 AAGGGCCTTCCCAGGGAACAGGG + Intronic
1085201738 11:74706138-74706160 GAGGCCATTCCCTGGGAAGAAGG + Intronic
1085388719 11:76171488-76171510 AGGGGCCCTCCCTGGGCACTGGG - Intergenic
1087991543 11:104749525-104749547 AGGAGACTTGCCTGGGCAGAGGG + Intergenic
1089491734 11:118888157-118888179 AGATTCCTGCCCTGGGAAGAAGG - Intronic
1089662513 11:119994563-119994585 AGGGGCCTCCACTGGGGAGAAGG - Intergenic
1089790256 11:120937738-120937760 AGGGTTCTTCCCTGGGCACAGGG - Intronic
1089830381 11:121322088-121322110 AGTGGCTTTGGCTGGGAAGAGGG + Intergenic
1092270271 12:7018263-7018285 AGGGTCCTTACCCAGGAAGATGG + Exonic
1094812208 12:34149558-34149580 AGGGGCCTTCCCTAGGCTTATGG + Intergenic
1096531013 12:52242929-52242951 AGGGGCCTTGGGTGGGGAGAGGG + Intronic
1101079756 12:101170905-101170927 AAGAGGCTTCCCTGGGAAGCTGG - Intronic
1101442835 12:104716247-104716269 GGGGGCCATCCCAGAGAAGAAGG - Intronic
1101556294 12:105813110-105813132 AGGGGCCGTCCTGGGGAAGATGG - Intergenic
1101561810 12:105864109-105864131 AGGGACCATCCCTGGGTACAGGG + Intergenic
1102224927 12:111221591-111221613 AAAGGCCTGCACTGGGAAGAAGG - Intronic
1102471097 12:113160339-113160361 TGGAGTCTTCCCTGGGGAGAGGG - Intronic
1103342983 12:120230888-120230910 AGGGGCCTTCCCTGCCAATTTGG + Intronic
1106125518 13:26897496-26897518 TGAGGCCAGCCCTGGGAAGAAGG + Intergenic
1106555122 13:30802948-30802970 TGGGGCTTTCCCTGCGAGGAGGG + Intergenic
1107097526 13:36552635-36552657 AGGATCCTTGCCTGAGAAGAAGG + Intergenic
1111845987 13:93508997-93509019 AGGTGACTCCACTGGGAAGATGG + Intronic
1112302189 13:98240365-98240387 AGTGGCCTTCCCAGGCAGGAAGG + Intronic
1112382479 13:98905434-98905456 ATGGGCCTTCCCTTGGGAGGTGG - Intronic
1113388137 13:109870096-109870118 AGGGAGCTTCCCCGGAAAGATGG + Intergenic
1113818678 13:113194667-113194689 AGGGGGCTTCCCTGGGGTGAAGG - Intronic
1114494940 14:23126095-23126117 AAATGCCTTCCCTGGGAGGAAGG - Exonic
1114566982 14:23639899-23639921 AGAGGCCTCCCCTGGGGAGGCGG + Intronic
1115242500 14:31263534-31263556 AGGAGCCTTCATTGGGATGATGG + Intergenic
1118893990 14:69930736-69930758 AGTGTCCTTGCCTGGGAAGCCGG - Intronic
1121358035 14:93231384-93231406 AGGGGACTTCTGTAGGAAGAAGG + Intergenic
1121737393 14:96228079-96228101 TGGGGCCTGCCCTGGGAGAAGGG + Intronic
1121786913 14:96668862-96668884 AGGGGCCTCTCCTGGGCAGGAGG + Intergenic
1122082342 14:99274458-99274480 AGGGGCCGTGCCTGGGGAGGGGG + Intergenic
1122154881 14:99744264-99744286 AGGGACCTGCCCTGGGAGCAGGG - Intronic
1122745514 14:103895048-103895070 AGGGTCCATACCAGGGAAGAGGG + Intergenic
1123035440 14:105469994-105470016 TGGGGCCTTCCCAGGGCAGGCGG + Intronic
1124231681 15:27951624-27951646 GGCAGCCTGCCCTGGGAAGAAGG - Intronic
1124234368 15:27974850-27974872 AGTGACATTCTCTGGGAAGATGG - Intronic
1124291723 15:28457517-28457539 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1125531822 15:40418564-40418586 AGGTGCCTACCCTGGGAGGTGGG - Exonic
1125531836 15:40418602-40418624 AGGTGCCTACCCTGGGAGGTGGG - Exonic
1126061037 15:44782832-44782854 AGAAGGCTTCCCTGGGGAGAAGG - Intergenic
1126096899 15:45096292-45096314 CTGGGCCTTCCATGGGAAGAGGG - Intronic
1126355512 15:47791151-47791173 AAGTGACTTCCCTGGGAAGAAGG - Intergenic
1126891219 15:53206412-53206434 AGGAGACTGCCGTGGGAAGATGG - Intergenic
1128616689 15:69115831-69115853 GGGGGCCTTCCCAGAGGAGATGG - Intergenic
1128671850 15:69579527-69579549 AGCAGCCATCCCAGGGAAGAAGG + Intergenic
1128783533 15:70378592-70378614 AGGGGCCTGCCCAGAGGAGATGG - Intergenic
1129236357 15:74225946-74225968 AGGCCCCGTCCCAGGGAAGATGG + Intergenic
1129323149 15:74785880-74785902 TGGGGCTGGCCCTGGGAAGATGG + Intronic
1129845755 15:78767072-78767094 AGGGGCTTACCCTGGGAGGCAGG + Intronic
1130298645 15:82664308-82664330 AGGGGGCTTTCCTGGAAAGAGGG - Intronic
1130407218 15:83612692-83612714 AGGGGCCTGCAGTGAGAAGAGGG - Intronic
1131260008 15:90883257-90883279 AGGGGGCACCCCTGGGCAGATGG - Exonic
1131778462 15:95827931-95827953 AGGGGCCTTTCCTTGGATGAGGG - Intergenic
1131935566 15:97500462-97500484 TGGGGCATTCATTGGGAAGAGGG - Intergenic
1134126259 16:11618311-11618333 AGGTGCCTCCCCTGGCAAGGCGG + Intronic
1136023619 16:27455801-27455823 AGGGGACTTCCGGTGGAAGATGG + Intergenic
1136419259 16:30122296-30122318 AGGAGCCTTTCCTGGGAATGGGG - Intronic
1136707060 16:32200153-32200175 GGCGGGCTTCCCTGGGAGGAAGG + Intergenic
1136760850 16:32729264-32729286 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1136807253 16:33141122-33141144 GGCGGGCTTCCCTGGGAGGAAGG + Intergenic
1138387266 16:56644184-56644206 TGGGGCCTTCCCTGGGAATCTGG + Intronic
1138387942 16:56648899-56648921 TGGGGCCTTCCCTGGGAATCAGG + Intronic
1139993965 16:70962830-70962852 GTGGGCCTTCCCTGGAAGGAAGG + Intronic
1141341484 16:83208045-83208067 TAGCGCCTTCCCTGGGATGATGG + Intronic
1141436742 16:84003969-84003991 AGGGACCTGCCCTGGGAGCAGGG - Intergenic
1141535784 16:84678812-84678834 GGGAGCTTTCCCTGGGAGGAGGG - Intergenic
1141886479 16:86895776-86895798 GCAGACCTTCCCTGGGAAGAGGG + Intergenic
1141967201 16:87453455-87453477 AGTGCCCAGCCCTGGGAAGAGGG + Intronic
1142061884 16:88035702-88035724 GGGGGCCTCCCCTGGCAGGAAGG - Intronic
1142147797 16:88499797-88499819 TGGGCCCTTCCCTGGGAGGCAGG - Intronic
1203063002 16_KI270728v1_random:989578-989600 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1142626713 17:1196999-1197021 AGGGTCCTTCCTTAGGAAGGCGG - Intronic
1142758431 17:2029232-2029254 AGGGTGCTTTCCTGGGAAGGTGG - Intergenic
1142803091 17:2357162-2357184 CTGGCCTTTCCCTGGGAAGATGG + Intronic
1142917531 17:3154137-3154159 TTGCGCCTTCCCTGGGCAGAGGG + Intergenic
1143492126 17:7290605-7290627 AGGGGTCTTCCCCTGAAAGAAGG - Intronic
1143891555 17:10106234-10106256 TGTGGCCTTCCCTGAGAAGCAGG - Intronic
1144253668 17:13444258-13444280 ATGGGCCTTCCCTGTCAAAATGG + Intergenic
1144578862 17:16446829-16446851 AGGGGCTCTACCTGGGTAGAGGG - Intronic
1145190841 17:20841592-20841614 GGCGGGCTTCCCTGGGAGGAAGG + Intronic
1145768579 17:27476468-27476490 AGGGGCGCTCCCTGAGAAGATGG - Intronic
1146688673 17:34858093-34858115 AGGGGCAATGGCTGGGAAGAAGG + Intergenic
1148678492 17:49459070-49459092 AGGGGCCTTCCTAGAGGAGAAGG + Intronic
1149181070 17:53937448-53937470 AGAGGTTATCCCTGGGAAGAAGG + Intergenic
1150698095 17:67423355-67423377 AGGGCCCTTACCTTGGGAGAGGG + Intronic
1151285416 17:73107594-73107616 GTGGGCCTTCCCAGGGAGGAGGG + Intergenic
1151512437 17:74569496-74569518 ACGTGCCTTTCTTGGGAAGAAGG + Intergenic
1151682460 17:75629229-75629251 GGGGCCCTCCCCTGAGAAGAAGG - Exonic
1151881449 17:76897640-76897662 AGTGGCCTTACTTGGGAATAGGG - Intronic
1152007980 17:77694520-77694542 AGAGGGCTCCTCTGGGAAGAAGG - Intergenic
1152551543 17:81032866-81032888 GGAGGCCTTCCCTGAGAAGACGG - Intergenic
1153350175 18:4071496-4071518 AGGGCACTGCCCTGGGAAGTCGG - Intronic
1157102663 18:44744389-44744411 AGGGGCCCTGCCTGGGAACAGGG + Intronic
1158393729 18:57063739-57063761 GGGTGCCTTCCTTGGGAGGAAGG - Intergenic
1158514303 18:58118779-58118801 AGGGGCCTTCACTGGAGAGTGGG - Intronic
1158847471 18:61459756-61459778 AGGAGCCTTCCCTGGGAAGATGG + Intronic
1159943354 18:74425826-74425848 AGGGGTATTCCCGGGGAGGAGGG - Intergenic
1160145664 18:76362056-76362078 AGGGGCCTCCCATGTTAAGAGGG - Exonic
1160769730 19:825171-825193 TGGGGCCTCCGCAGGGAAGATGG + Intronic
1160995363 19:1879831-1879853 GGCGGGCTTCCCTGGGAGGAAGG - Intronic
1161730730 19:5959072-5959094 AGGGGAGGTCCCTGAGAAGAGGG + Intronic
1161842154 19:6688918-6688940 AGAGTCCTTTCCTGGGAATATGG + Intronic
1162021431 19:7870142-7870164 AGGGGCCTGCCCAGGGAATGAGG + Exonic
1162109710 19:8393458-8393480 AGGCCCCTTCCCTGGGGACAGGG - Intronic
1162143107 19:8596402-8596424 CGGGGCCAGGCCTGGGAAGACGG + Exonic
1162865514 19:13543202-13543224 AGGAACATTCCCTGGGAAGATGG - Intronic
1163020557 19:14478941-14478963 AGGGACCTTCCTTGGGCACATGG - Intronic
1164437623 19:28245150-28245172 AAGAGCTGTCCCTGGGAAGAAGG + Intergenic
1164827952 19:31298119-31298141 AGTGGCCTTCCCTGGGTGCAAGG - Intronic
1165124336 19:33583276-33583298 AAGGGAATTCCCAGGGAAGAAGG - Intergenic
1166051578 19:40263910-40263932 AGGGGGCTTCGCTGAGAAGGGGG - Intronic
1166333334 19:42091192-42091214 TGGTCCCTTGCCTGGGAAGAGGG - Exonic
1166545537 19:43632671-43632693 AGGAGTCAGCCCTGGGAAGATGG - Intronic
1166853526 19:45771339-45771361 AGGGGTCTTACATGGGAAGGTGG + Exonic
1167444174 19:49527829-49527851 CGCGGCCTGCCCGGGGAAGAAGG - Exonic
1167828904 19:52001676-52001698 AGAGCTCTTCCTTGGGAAGAAGG + Intronic
1167851799 19:52207887-52207909 AGGCGCCTTCCCTGGGTTTAAGG - Intronic
1168071417 19:53954362-53954384 AGGGGCCTTCCATGAGCTGAAGG + Intergenic
925288457 2:2730812-2730834 TGGGGCCTCCCTAGGGAAGAGGG - Intergenic
925905301 2:8536457-8536479 AGGGGTCTGCCCAGGGAGGAAGG - Intergenic
925953408 2:8937250-8937272 AGGGGCCATGGCTGGGAAGCAGG + Intronic
926220858 2:10934703-10934725 GGGGGCTTTCCCAGGGATGAGGG - Intergenic
926755070 2:16227910-16227932 AGGGACCTCCCATGGGAAGCTGG - Intergenic
927002673 2:18814925-18814947 GGGTGTCTTCCCTGGGACGATGG - Intergenic
927219482 2:20694142-20694164 AGGGGCCCTAGCTGGGAAGTAGG - Intronic
927704160 2:25286758-25286780 AGGAGCCATCCCTGGTGAGAAGG + Intronic
929536255 2:42786228-42786250 AGAGGTCTTCCCTGTGATGAGGG + Intronic
929587674 2:43126632-43126654 AGGGACCTGCTCTGGGAGGAAGG - Intergenic
930617843 2:53612430-53612452 AGTGTCCTCCCCTAGGAAGAGGG + Intronic
932484929 2:72079017-72079039 AGGGGCCTTGCCAGGGAGCAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934518688 2:95005838-95005860 CGTGGCCTTCCCTGGGCAGCAGG + Intergenic
935590805 2:104844378-104844400 AGGGTCCTTCTCTTGGGAGAGGG - Intergenic
936093620 2:109516092-109516114 AGGGGTCTTCCCTGGGCTAAGGG + Intergenic
937288590 2:120768362-120768384 AGGGACTTTCCATGGGAAGGTGG + Intronic
937745208 2:125404038-125404060 AGGGGCCTCCACTGAGACGAGGG + Intergenic
937976936 2:127588227-127588249 GGGGGCCATGCCTGGGTAGAGGG + Intronic
938453921 2:131445796-131445818 AGGGGGCTTCCCGGGGGAGGAGG + Intergenic
940365466 2:152843820-152843842 TGAGGCCTGCCCTGGGAATATGG - Intergenic
940965178 2:159829180-159829202 AGGGGTCTTGCCTTGGGAGATGG - Intronic
941082479 2:161078002-161078024 AGGGTGCTGCCCTGGGAGGAGGG + Intergenic
941527923 2:166628951-166628973 ATGGGCATTCCCAGGGTAGAGGG + Intergenic
941930044 2:170929659-170929681 AGGGGGCGGCCCTGGGAAGGGGG + Intronic
943112452 2:183622400-183622422 AGGGGGATTCCCAGGCAAGATGG - Intergenic
944656583 2:201881786-201881808 AGGGGCTTGGACTGGGAAGAGGG - Intronic
944936987 2:204579745-204579767 AGGGGTCCACCCTGGGTAGAGGG - Intronic
947475762 2:230446485-230446507 TGGGGAATTCCCTGGGGAGAAGG - Intronic
948463531 2:238141546-238141568 AGGCCCCATCCCTGGGAAGCAGG + Intronic
948796047 2:240402531-240402553 AGGGGCCTTGGCTGTGAGGAGGG - Intergenic
1169267066 20:4173193-4173215 AGGGGCCTTTCTGGGGTAGACGG - Intronic
1169892512 20:10468865-10468887 AGCCACATTCCCTGGGAAGAAGG + Intronic
1170569685 20:17625705-17625727 AGGGACCGTCCCTGGCCAGATGG - Intronic
1171099925 20:22373514-22373536 AGGTGCCTTTCCTGGGAAGTGGG - Intergenic
1173352837 20:42260878-42260900 AGGGGACCTCACTGGGGAGATGG + Intronic
1173925173 20:46775986-46776008 AGAGTCCTTCCCTGGGAATGTGG - Intergenic
1174565723 20:51463206-51463228 CTGGGTCTTCCCTGGGAAGTGGG + Intronic
1175198418 20:57262332-57262354 AGGGGCCCAGGCTGGGAAGATGG + Intronic
1175285304 20:57833617-57833639 AGGGGCCCTCGCTGGGAAAAGGG + Intergenic
1176095769 20:63343702-63343724 TGGGGCCTCCCCTGGGAAGGAGG + Intronic
1176380097 21:6108039-6108061 ACGGCCCTGGCCTGGGAAGAGGG - Intergenic
1176389653 21:6156987-6157009 AGGAGCCGTGCCTGGGCAGAGGG - Intergenic
1178196002 21:30345868-30345890 AGGGGTCTTCATTGGGAAGGAGG + Intergenic
1178616988 21:34143357-34143379 AGAGGCCTGCCCTGGGATGAGGG - Intergenic
1179435444 21:41359335-41359357 AGGGGCCATCACTGGGTAGGAGG - Intergenic
1179681227 21:43022493-43022515 AGGGCCCTCTCCTGGGCAGAAGG + Intronic
1179733815 21:43381251-43381273 AGGAGCCGTGCCTGGGCAGAGGG + Intergenic
1179743377 21:43430199-43430221 ACGGCCCTGGCCTGGGAAGAGGG + Intergenic
1179925561 21:44532188-44532210 AGTGGACTTCCTGGGGAAGATGG - Intronic
1180726955 22:17953420-17953442 AGAACCCTTCCCTGGGAAGATGG + Intronic
1181269977 22:21653093-21653115 AGGGGCCCTGCCTGGGGAGTGGG - Intronic
1182067755 22:27442577-27442599 AGCGGCCCTGCCGGGGAAGAGGG - Intergenic
1182796340 22:32994202-32994224 AGGGGCCGGGCCTGGGAAAACGG + Intronic
1183252623 22:36741038-36741060 AAGGGCATTCTCAGGGAAGATGG - Intergenic
1184298410 22:43540715-43540737 ACTGGGCTTCCCTGGGATGAAGG - Intronic
1184428164 22:44425239-44425261 TGGGGCCCTCCCAGGGATGATGG - Intergenic
1184646708 22:45899127-45899149 AGGGGCCTTCCCGGGCAACAAGG + Intergenic
1184699324 22:46159736-46159758 AGAGGGCTATCCTGGGAAGAAGG + Intronic
1184771407 22:46598883-46598905 AGGGGACATGCATGGGAAGAGGG + Intronic
1184817053 22:46880529-46880551 AGGGGCCTTTGCTTGGGAGACGG + Intronic
1184824019 22:46934847-46934869 AGGGGCCCTCCCTGGGCTCAGGG + Intronic
1184974570 22:48051942-48051964 AGGGACGTCCCCTGGGAGGAGGG + Intergenic
1185059783 22:48600259-48600281 AGGGGCGTCCCCGGGGAGGATGG + Intronic
950267564 3:11585989-11586011 TGGGGGCTTTCATGGGAAGAGGG - Intronic
950472147 3:13192995-13193017 AGGGGCCATCTCTGGGCAGTGGG + Intergenic
950604859 3:14069570-14069592 AGGGGCTTTCCCATGCAAGAGGG - Intronic
952299936 3:32096086-32096108 AGGAGCCTGCCATGGGAAGGTGG - Intergenic
953927436 3:46989582-46989604 CGGGGCCTGACCTTGGAAGAAGG - Exonic
954643828 3:52118547-52118569 AGGGGGTTTTCCTGGGCAGAAGG + Intronic
958806708 3:98819745-98819767 TGAGGTCTTCCCTGGGAGGAAGG + Intronic
960329335 3:116339076-116339098 AGGTGCCTTTCCTAGGCAGAGGG + Intronic
960795453 3:121481938-121481960 AGTGGTCTTCCCAGGAAAGAAGG + Intronic
961518348 3:127452513-127452535 GGGGGCCTTGCCTGGGACAAGGG + Intergenic
961523645 3:127483139-127483161 AGGGGGCTTCCCGGGGGAGTAGG - Intergenic
961627788 3:128275642-128275664 AGTCGCCTTGCCTGGGAAGCAGG - Intronic
961734487 3:128993043-128993065 ACTGGCCTTCCCTGTGAATATGG - Exonic
962979734 3:140477051-140477073 AGTAGTCTTCCCTGGGAAGTTGG - Intronic
963451366 3:145485376-145485398 GGGAGCCTTACGTGGGAAGATGG + Intergenic
964328511 3:155574404-155574426 AGGGGCTTCCCCTGGGCAAATGG + Intronic
965583546 3:170294795-170294817 AGAGGCTTTCTCTGAGAAGATGG + Intronic
966847342 3:184140820-184140842 AGGGACAGTCCCTGGGAATAAGG + Intronic
967030557 3:185602397-185602419 AGGGGCTTTCACTGGCCAGATGG + Intronic
967982922 3:195076412-195076434 AGGGGCCTTCGGTGGGAGGAGGG + Intronic
968233437 3:197017280-197017302 AAGCGTCTTCCCTGGGAAGCAGG + Exonic
968310608 3:197680636-197680658 AGGGGCCTTCCCTGACTAGAGGG - Intronic
968480363 4:830466-830488 AGGGGCCTTCCCGGAGGACAGGG + Intergenic
968596730 4:1489744-1489766 AGGTCCCTCCCCTGGGAAGGGGG + Intergenic
969191702 4:5526550-5526572 TGGGGCCTTCCCTGGAGAGCTGG + Intronic
969717999 4:8877683-8877705 GTGGGCCTTCCCTGGGAGAATGG - Intergenic
970073514 4:12190763-12190785 AGGGAGGTTCCCTGGGAAGCAGG - Intergenic
971137175 4:23881957-23881979 TTGGGTCTTCCCTGTGAAGAAGG - Intronic
972415228 4:38832819-38832841 AGTGGCTTTCCCTGGGACAAAGG + Intronic
972646368 4:40971484-40971506 AGGAGCTTTCTCTGGGAAAATGG + Intronic
973090108 4:46125060-46125082 AGGAGGCTTCCGTGGGAAGCAGG - Intergenic
973757197 4:54087023-54087045 AGGGGCCTCCTCAGGAAAGAAGG + Intronic
976262088 4:83155359-83155381 TGGGGCCTTCCATGGCAACATGG - Intergenic
976809011 4:89080355-89080377 ATGTGTCTTCACTGGGAAGATGG + Intronic
981749661 4:148081859-148081881 AGGGGCCTTCCCAGGGTGTAAGG + Intronic
983165943 4:164477468-164477490 CTGGACCTTCCCTGGGGAGAGGG - Intergenic
983843636 4:172488362-172488384 CAGGGCCTCACCTGGGAAGATGG + Intronic
985551965 5:538361-538383 TGGGGGCTTCCCTGTGAAGGGGG - Intergenic
985913267 5:2898934-2898956 AGGAGCCTTCCCTGGGAGCCGGG + Intergenic
986602807 5:9490698-9490720 AGGGGGCATCCCCGGGAAGAGGG - Intronic
989775311 5:45199925-45199947 ATAGGCCTTCTCTGGAAAGATGG - Intergenic
990525666 5:56624455-56624477 GGAGGCCTCCCCTGGGAAGGTGG + Intergenic
995216018 5:109595159-109595181 ATGGGCTTTCCTGGGGAAGAGGG + Intergenic
995858069 5:116614647-116614669 AAGGGCCTACAATGGGAAGAGGG - Intergenic
997589029 5:135061742-135061764 AGGGGCCTTCCTGGAGAAGAAGG - Intronic
998045533 5:138983810-138983832 AGGGTCCATCTCTGGGAGGAGGG - Intronic
999288156 5:150406673-150406695 TGGTGCCATCCCTGGGAGGAAGG - Intronic
999956328 5:156706615-156706637 GCTGGCCTTTCCTGGGAAGAGGG + Intronic
1002206991 5:177569596-177569618 AGGGGCATTGCTTGGGGAGATGG + Intergenic
1002691843 5:181055362-181055384 AGTGGCCTGTCTTGGGAAGATGG + Intronic
1004281178 6:14281009-14281031 AGGGGACTTCACTGGGCAGAGGG + Intergenic
1005150925 6:22749586-22749608 AGGGGCATTCCATGTGAAGAAGG - Intergenic
1005399147 6:25413716-25413738 ATGGGCCTTCCCAGGGGAGGTGG + Intronic
1006372708 6:33655321-33655343 AGGGGCTGCCCCTGGGAAGAGGG + Intronic
1006418523 6:33919328-33919350 AGGGGCCTTTCCAGGGAGGGAGG - Intergenic
1008573587 6:52837876-52837898 AGGGGACATCACTGGAAAGAAGG + Intronic
1008932634 6:56955513-56955535 AAGGGCCTTCCCTGGGAATTGGG + Intronic
1009906275 6:69873310-69873332 GTGGTCTTTCCCTGGGAAGATGG - Intronic
1013755221 6:113453770-113453792 AGTGGCATTCCCAGAGAAGAGGG + Intergenic
1015503114 6:133953413-133953435 AGGGGGTTACCGTGGGAAGAGGG - Exonic
1016056790 6:139586482-139586504 AGAGTGCTTCCCTGGCAAGAGGG - Intergenic
1016839953 6:148516280-148516302 TGGGGCCTCTCCTGAGAAGATGG - Intronic
1019075362 6:169382926-169382948 AGGGGCCTTCTGGAGGAAGAGGG + Intergenic
1019403865 7:872302-872324 CGAGGCCTTCCCTGGAAGGAAGG - Intronic
1019501724 7:1368244-1368266 TGCGGCCGACCCTGGGAAGATGG + Intergenic
1019639083 7:2093462-2093484 AGCAGCTTTCCCTGGGAAGAGGG + Intronic
1019898305 7:4000109-4000131 ATGGGGTTTCCCTGGGAAGGAGG + Intronic
1022551546 7:31244735-31244757 GGGGGGCTTGCATGGGAAGATGG - Intergenic
1023840778 7:44096408-44096430 AGTGGCCTGCGCTGAGAAGAGGG - Intergenic
1023844754 7:44114344-44114366 AGGGGCCTTCCATGTGCTGATGG - Exonic
1024221227 7:47288730-47288752 AATGGCCTTTCCTGGGAAGCCGG - Intronic
1029032018 7:97478591-97478613 AGAGGGCTTCTCTCGGAAGATGG + Intergenic
1029514225 7:101015960-101015982 AGGGCCATTCCCAGGGCAGAGGG + Intronic
1029920230 7:104254708-104254730 AGGAGCTTTCCATGGGAGGATGG - Intergenic
1030605199 7:111632985-111633007 AGGGGCCAAGCCTGGTAAGATGG + Intergenic
1030820069 7:114084477-114084499 TGGGGCTGGCCCTGGGAAGATGG - Intergenic
1032020944 7:128406816-128406838 AGGGTCCTGCGGTGGGAAGATGG + Intronic
1034416802 7:150969580-150969602 AGGAGCCTTCCCTGGGAGTCAGG - Intronic
1034458678 7:151186320-151186342 AGAGGCCTTCTCAGGGAGGATGG - Intronic
1035294761 7:157860805-157860827 AGTGGCCTTCCCTGGTTGGACGG - Intronic
1035397898 7:158547025-158547047 GGGGGCCTTGCCTGGCAGGAGGG - Intronic
1035912776 8:3586125-3586147 AGGTGCCTTACCTCGGCAGATGG + Exonic
1036019872 8:4832488-4832510 AGGGGACTTCTCTAGGCAGAAGG + Intronic
1036062982 8:5345682-5345704 AGGAGGCTTCGGTGGGAAGATGG + Intergenic
1037208487 8:16355275-16355297 AGGGGACCTCCTTGGAAAGATGG - Intronic
1037930675 8:22878287-22878309 AGGGGACTGGCCTGGTAAGATGG + Intronic
1039840438 8:41289153-41289175 AGGGGCCTTGCCTGGGGAGCAGG + Intronic
1040017008 8:42708034-42708056 AGGGCCCATCTCTGTGAAGAGGG + Intronic
1041329944 8:56713930-56713952 CAGGTCCTTCCCTGGGAAGGAGG - Intergenic
1041720802 8:60973702-60973724 GGGGGCATTCCATGGGAAAAGGG - Intergenic
1042879712 8:73473585-73473607 TGAGGGCTTCCCGGGGAAGAAGG - Intronic
1043479313 8:80637124-80637146 AGGGGAGTGCCCTGGGAAAACGG - Exonic
1045757448 8:105561439-105561461 GGGGCCGTTTCCTGGGAAGATGG + Exonic
1048281103 8:133106220-133106242 AGGGCCATTCCCTGAGGAGAGGG + Intronic
1048573964 8:135676622-135676644 AGGGGCTCTCCCTGGGGAGGCGG - Intergenic
1049473162 8:142785198-142785220 AGGGGCCTTCCCTGGGGGGAAGG + Exonic
1049593608 8:143473520-143473542 GGTGCCCTTCCCTGGGCAGAGGG + Intronic
1056043900 9:82696195-82696217 AGGAGCCCTCACTGGGAATATGG + Intergenic
1056706104 9:88953857-88953879 AGGGGCCTTGCCAGGGCAGCTGG + Intergenic
1057507457 9:95647601-95647623 ACGGGTTTTCCCTGGGAAGCTGG + Intergenic
1059998958 9:119941318-119941340 TGGGGCCTTCCCAGGCAAGTTGG - Intergenic
1060103628 9:120860272-120860294 ACGGGCCTCCACTGGGATGAAGG - Intronic
1060795115 9:126507922-126507944 AATGGCTTGCCCTGGGAAGATGG + Intergenic
1060894491 9:127209003-127209025 AGGGCCCTGCTCTGGGAAGGGGG + Intronic
1061083032 9:128383531-128383553 AAGGGCCATCCTGGGGAAGAGGG + Intronic
1061137103 9:128741304-128741326 AGGGGCTTTCCCTGGGAGTGGGG + Intronic
1061574926 9:131500410-131500432 AGATGCCATCCGTGGGAAGAGGG - Intergenic
1062176912 9:135168470-135168492 AGGGCCCTTCCCTGGGCTGAGGG - Intergenic
1062391929 9:136337323-136337345 AGGGCCATGCCCTGGAAAGAGGG - Intronic
1062598372 9:137309210-137309232 TGGGGCCTTCCCTGGGGGGGTGG + Intronic
1186436751 X:9549696-9549718 AGGGGCCTGCCCAGGAAGGAAGG - Intronic
1186501573 X:10055119-10055141 AGGATCCTGCCCAGGGAAGATGG + Intronic
1186776875 X:12873646-12873668 AGGGGCCTTCCCTGGGAAGAGGG - Intronic
1186834874 X:13427773-13427795 AAGGGCATTCCCAGGGGAGAGGG - Intergenic
1190144117 X:47875000-47875022 AGGGGGTTTCCCTGCAAAGAGGG - Intronic
1193811843 X:86060880-86060902 AAGGGCCTTTCCCAGGAAGAAGG + Intergenic
1195998635 X:110757962-110757984 ATTGTTCTTCCCTGGGAAGAAGG - Intronic
1196916105 X:120536541-120536563 AGGGGTATAACCTGGGAAGATGG + Intronic
1197588064 X:128374050-128374072 AGAAGCCTTCCCTTGCAAGAAGG + Intergenic
1198129291 X:133677742-133677764 AGGCGCCATCCCCTGGAAGAAGG - Intronic
1199492995 X:148421947-148421969 AGGGTCATTCCCCAGGAAGAAGG - Intergenic
1200096006 X:153662682-153662704 AGGGCCCTGCCCTTAGAAGAAGG - Intergenic
1200133345 X:153863147-153863169 TGGGGCCTCCCTTGGGGAGAGGG + Intronic
1202095235 Y:21242861-21242883 AAGGTCCTTTCCTGGGAGGAGGG + Intergenic