ID: 1186777872

View in Genome Browser
Species Human (GRCh38)
Location X:12883631-12883653
Sequence AGCAAGAAACTGACTGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186777871_1186777872 4 Left 1186777871 X:12883604-12883626 CCTGGGAAACAATTTCAAGGAGT 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG 0: 1
1: 0
2: 0
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186777872 Original CRISPR AGCAAGAAACTGACTGATTA AGG Intronic
901171118 1:7258309-7258331 AGCTAGAAACTCCCTGATGAAGG + Intronic
901896117 1:12313734-12313756 AGCTAGAAGCTGACAGATGAAGG + Intronic
902686195 1:18079279-18079301 AGCAAGGAACTCCCTGATGAAGG + Intergenic
903074632 1:20753657-20753679 TCCAAGAAATTCACTGATTAGGG + Intronic
903815345 1:26060602-26060624 AGCAAGGAACTGACAGAGGAGGG + Intronic
908052857 1:60251432-60251454 AGCAAGAAACTCACACTTTAGGG + Intergenic
908713540 1:67044963-67044985 ACCAAGTAACTGATTGCTTATGG + Intronic
910660393 1:89665528-89665550 AGCAAAAAACTTATTGAATAAGG + Intronic
910958802 1:92738479-92738501 AGCAATTAACTTACTGAGTAGGG - Intronic
911908743 1:103603588-103603610 AGTATGAAACTCATTGATTAAGG + Intergenic
911911054 1:103635925-103635947 AGTATGAAACTCATTGATTAAGG + Intergenic
911914174 1:103675873-103675895 AGTATGAAACTCATTGATTAAGG - Intronic
911918469 1:103730067-103730089 AGTATGAAACTCATTGATTAAGG + Intronic
911921584 1:103769201-103769223 AGTATGAAACTCATTGATTAAGG + Intergenic
913297574 1:117336785-117336807 TGCAAGAATCTGATGGATTAGGG + Intergenic
913481610 1:119294337-119294359 AGCAAGCAACTGCATGAATAGGG + Intergenic
916519135 1:165547537-165547559 AGGAAGAACCAGACTGATTAAGG - Intronic
916541466 1:165759685-165759707 AGTTACACACTGACTGATTATGG + Intronic
918353125 1:183678332-183678354 AATAAAAAACTCACTGATTATGG - Intronic
918368979 1:183839723-183839745 AGCAGGAGACTACCTGATTATGG - Intronic
920505440 1:206512399-206512421 AGCATGAAATTTTCTGATTATGG + Intronic
920706312 1:208253097-208253119 AGAAAGAAAAAGAATGATTAAGG - Intergenic
922033024 1:221822653-221822675 AGGAAGAAACTCATTGATGATGG + Intergenic
922036145 1:221850622-221850644 GGCAAAGAACTGTCTGATTAGGG - Intergenic
923744759 1:236690010-236690032 ATCAAGCCACGGACTGATTATGG - Intronic
1063043981 10:2372961-2372983 AACAAGAAACTGTCTGGTTTGGG + Intergenic
1063395474 10:5683678-5683700 AGAAAAAAACTTACAGATTAAGG + Intergenic
1067014301 10:42745288-42745310 AGCTAGACTCTGACTCATTATGG - Intergenic
1067546972 10:47199141-47199163 ATCAAGAAACAGTCTGATTTTGG - Intergenic
1077796215 11:5495271-5495293 AGCATGAAACTCACTGGTAAAGG + Intronic
1078958124 11:16226900-16226922 AGCAAGAAAAAGATAGATTATGG - Intronic
1080759523 11:35235078-35235100 AGCTAGAAGCTGTCTGATTTCGG + Intergenic
1081332107 11:41816157-41816179 AGAAAAAAACTCACTGTTTATGG - Intergenic
1081841812 11:46207706-46207728 TGCAAGCAACTGATTGACTATGG - Intergenic
1082896270 11:58193526-58193548 AGCAAGAAAGTGGCAGATGAGGG + Intergenic
1087011620 11:93519670-93519692 AGCAAGAAGGTGGCTTATTATGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087459744 11:98430938-98430960 AGAAAAAAACTCACTGATAAAGG - Intergenic
1088362843 11:109009176-109009198 TGCAAGCAACTGATTTATTATGG + Intergenic
1088398895 11:109400853-109400875 AGTAATAAACTGAGTGATTAGGG + Intergenic
1090678486 11:129027976-129027998 GGCAAGAAAAAGACTGATTAGGG + Intronic
1092987794 12:13863401-13863423 CTCAAGAAAATGACTGGTTAAGG - Intronic
1094355127 12:29569441-29569463 AGCAAGAAAGAGAGTGATTAGGG - Intronic
1099154858 12:79161708-79161730 AGCTAGTAAGTGACTGAGTAGGG + Intronic
1099312191 12:81040668-81040690 TGCAAGAAAATGATTGCTTATGG - Intronic
1104063368 12:125286347-125286369 ACCAAGTAACTGAATGATCATGG + Intronic
1105540432 13:21311579-21311601 AACAAGAAACTCACTGGTGAGGG + Intergenic
1106324012 13:28670369-28670391 AGTAATAAACTGAATGATTTGGG - Intronic
1106518943 13:30479943-30479965 AGAGAGAAACTGCCAGATTAGGG - Intronic
1106844600 13:33724791-33724813 AGAAAGAACATGACTAATTAAGG + Intergenic
1107343027 13:39430297-39430319 ATCAAGTAACTGACTGATGTAGG + Intronic
1107609898 13:42102614-42102636 AGGAAGGAGCTGACTGATTCAGG + Intronic
1113735263 13:112673964-112673986 AGCTCAAAATTGACTGATTAGGG + Intronic
1114978212 14:28128067-28128089 AGCAAGAAAATGACAGAAAAAGG + Intergenic
1115275499 14:31604234-31604256 AGAAATAAACTGAATGATTAAGG + Intronic
1115582368 14:34773976-34773998 AGCAAAAAAGTGACAGATGATGG + Intronic
1117938194 14:60931320-60931342 AGCAGGGATCTGAATGATTAAGG + Intronic
1119070195 14:71575280-71575302 AGTAAGACACTGAATGATAAGGG - Intronic
1120648887 14:87106987-87107009 AGCAAGAAATAGACTGAATGAGG - Intergenic
1121591986 14:95122193-95122215 AGGAAGTAACCGACTGATTCTGG + Intronic
1126103278 15:45132489-45132511 AGCAAGAAACTGTCTACTGAAGG - Intronic
1127248543 15:57205351-57205373 AGCAAGAAATCTACTGATTCTGG + Intronic
1130099924 15:80885543-80885565 ACCAGGAAACTGACTATTTACGG + Intronic
1130701035 15:86182100-86182122 AGCAAGAAATGGACTGGTTTCGG + Intronic
1132023426 15:98384305-98384327 GGCAAGAAATTGACAGAATAGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133515528 16:6505153-6505175 AGCAAGAAACTGCATAACTAGGG - Intronic
1134904090 16:17964459-17964481 AGAAAGAAACTGGCTGTTAAGGG + Intergenic
1135679517 16:24444508-24444530 AGCCAGAAACTGAGTTTTTAAGG - Intergenic
1136531296 16:30871188-30871210 AGCTAGAAACTGACTTAGGAGGG + Intronic
1139072221 16:63396540-63396562 GGCAAGCAGCTGACTGATTTTGG + Intergenic
1141017255 16:80462069-80462091 AGCAAGGAACAGACAGTTTAAGG + Intergenic
1141239656 16:82253997-82254019 AGCAAGGAAGTGACTGAGTTGGG - Intergenic
1142792558 17:2279179-2279201 AGAAAGAAAGTGACTGATAAAGG + Intronic
1144408644 17:14977180-14977202 ACTGAGAAACTGACTGACTAAGG - Intergenic
1145840219 17:27988414-27988436 AGCTAGAAAGTGGCTGAGTAGGG - Intergenic
1146014976 17:29225631-29225653 AACAAGAAACAGACTGATAGGGG + Intergenic
1146803212 17:35844150-35844172 AACAAGACACTTACGGATTAGGG - Exonic
1147538530 17:41336251-41336273 AGCATGTATCTGACTGCTTAGGG - Intergenic
1149139886 17:53419341-53419363 TGCAAGCAATTGATTGATTATGG - Intergenic
1150551524 17:66215150-66215172 AGCCAAAGACTGACTGATGAGGG + Intronic
1150555248 17:66248498-66248520 AGCTATTAACTGACTGATAAGGG + Intronic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1157079813 18:44511086-44511108 TGCAACTAACTGATTGATTATGG + Intergenic
1157449781 18:47776711-47776733 AGCAGGAACCTGACAGAATATGG - Intergenic
1158923272 18:62219222-62219244 AGTAAAACACTGAATGATTAAGG - Intronic
1159022854 18:63157171-63157193 GGCAAGAAACTGAAGGAATATGG + Intronic
1159828725 18:73247112-73247134 AGCTAGAAACTAATTGATGATGG + Intronic
1162461104 19:10814818-10814840 AGCAAGAAACGGGTTGATCAGGG - Intronic
1162517819 19:11160046-11160068 AGCAAGAAACTGTGTGATGGCGG + Intergenic
1163003539 19:14383646-14383668 TGCAGGAAACTGACTACTTAGGG + Intronic
1163098917 19:15081833-15081855 TGGAAGAAACTGGCTCATTAAGG - Intergenic
1168505822 19:56934008-56934030 AGCAGGAAAGTGACGGTTTATGG - Intergenic
926221200 2:10936677-10936699 AGAAAGAAACTGACGGAAAAGGG - Intergenic
928276283 2:29903022-29903044 ATCATGAAACTAACTGATGATGG + Intronic
928993118 2:37256568-37256590 TGCAAGAGACAGACTGATTTGGG + Intronic
929539467 2:42809207-42809229 AGCAAACAACAGAATGATTATGG - Intergenic
930524996 2:52517601-52517623 AGCAACAAACTTACAGAATAAGG - Intergenic
930565222 2:53010397-53010419 ATCAAGAAAATGACTTATTTGGG - Intergenic
930733863 2:54755190-54755212 ATCCAGAAACAGACTTATTAGGG - Intronic
931442693 2:62302553-62302575 AGCAAGAAACAGGCTGAGTGCGG - Intergenic
931567771 2:63633281-63633303 AGTATGAAACTGACTGGTAAAGG + Intronic
933066019 2:77797402-77797424 AACAAGAAACTGGCTTAATATGG - Intergenic
933244151 2:79956252-79956274 AAGCAGAAATTGACTGATTAGGG - Intronic
933480688 2:82853593-82853615 TGCAAGAAATTGATTTATTATGG + Intergenic
933593520 2:84259794-84259816 AGGAATAGACAGACTGATTAAGG - Intergenic
934647151 2:96065613-96065635 AGCAAGAACCTGCCTGAGTGGGG + Intergenic
935199760 2:100845960-100845982 GGCAAGAAACTGACTGAAGGAGG - Intronic
936671685 2:114663691-114663713 AGAGAGAAACTGACTGACTTGGG + Intronic
937077391 2:119117166-119117188 AGGAAGAAATTGACTAAGTAAGG + Intergenic
939944859 2:148397169-148397191 AGATAGAAAAGGACTGATTAAGG + Intronic
941242015 2:163051161-163051183 AGCAAGAAAATGACAGTTTCAGG + Intergenic
941255603 2:163227531-163227553 AGAAAGGAATTGAATGATTATGG + Intergenic
941413939 2:165195203-165195225 AGTAAGAAACTGACTAGTGAGGG + Intronic
941529319 2:166646415-166646437 AGCAAAAAAATGACTGAAAAAGG - Intergenic
946069929 2:217025478-217025500 CACAAGAAACTAACTGAGTATGG - Intergenic
946730258 2:222702855-222702877 AACAAAAAACTGACTAAGTAAGG + Intronic
947936081 2:234004978-234005000 AACAAGGAACTGATTAATTATGG - Intronic
948607954 2:239147784-239147806 ATCAAGTAAATGACTAATTAAGG + Intronic
1173356530 20:42297564-42297586 AGCTAGAAACTCACTGAAAAAGG + Intronic
1177929067 21:27257501-27257523 AGCTGGAAGCTGGCTGATTAAGG - Intergenic
1179202446 21:39237274-39237296 GGCAAGAAACTGACTACTTAAGG - Intronic
1182897684 22:33872675-33872697 AGCCAGAAACTGAGTGAATTTGG + Intronic
1183583663 22:38739902-38739924 GGCAAGGAACTGACTGATCCAGG + Exonic
1183749503 22:39711856-39711878 AGCAAGAAACAGAGGGATTTAGG + Intergenic
1184178807 22:42805640-42805662 AGCAAGTAACTGACTGCCCAAGG + Intronic
1184514154 22:44951138-44951160 TGCAAGCAACTGACTTACTATGG + Intronic
1185397072 22:50598126-50598148 ATCAAGGAACTGACTGACCAGGG + Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
952716110 3:36482557-36482579 CTCAGGAAAATGACTGATTAAGG - Intronic
954476270 3:50749116-50749138 AGAAAGAAACTAACTGATGAAGG - Intronic
955599932 3:60634378-60634400 AGCAAGAAGCTGCCCGAGTAGGG + Intronic
957305031 3:78447047-78447069 AGCAAGAAACTAAATGGTTCAGG + Intergenic
958860399 3:99438264-99438286 AGCATGAAACTCTCTTATTATGG + Intergenic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
971700251 4:29963466-29963488 GGCAAAAAACTGCCTGAGTAGGG - Intergenic
972370003 4:38414341-38414363 AACAAGGAACTGACCCATTAAGG + Intergenic
974107283 4:57484693-57484715 AGCTAGATGCTGACTGAATAAGG + Intergenic
974432425 4:61816624-61816646 ACAAAAAAACTGACTGATAAAGG + Intronic
974870201 4:67633144-67633166 AGCAAGAAACTGAGAAAATAGGG - Intronic
975347401 4:73308385-73308407 AGCACTAAACTGACTCAGTATGG - Intergenic
975771039 4:77722847-77722869 AGAAAGAAACTGACTCAAAAGGG - Intronic
978639174 4:110848712-110848734 AACAAGAAACTGAATGAATCTGG - Intergenic
978690108 4:111497677-111497699 AACAAGAATATGACAGATTAAGG + Intergenic
982995867 4:162344193-162344215 AGCAAGAAACTGCTATATTAAGG + Intergenic
983977646 4:173954756-173954778 ACCTAGAAACTGACAGATTGTGG + Intergenic
984104663 4:175530000-175530022 AGCAAGAAACTTACTGGCAAGGG - Intergenic
985149609 4:186932983-186933005 AGCATGAAGTAGACTGATTAGGG - Intergenic
987346924 5:16987064-16987086 AGCAAGAAACTGATTTAAAAAGG + Intergenic
987860373 5:23478849-23478871 AGCAAAAAACAGAATGGTTATGG - Intergenic
989262964 5:39439146-39439168 AGCAAGAAATTGACTTGTTTGGG - Intronic
989575401 5:42983071-42983093 AGCAAGAAACTGAAAAATTGGGG + Intergenic
990298093 5:54423496-54423518 AGAAAGAAAATGACAGGTTAAGG + Intergenic
993704474 5:91153979-91154001 ACCATGAAACCGCCTGATTAAGG + Intronic
996107787 5:119525577-119525599 AGCAAGGAACTGAAAGGTTAGGG + Intronic
997191372 5:131939318-131939340 ACCAAGAAACAAACTGATTCAGG - Intronic
997743044 5:136274656-136274678 AGCAAGGTACAGACTGCTTAAGG - Exonic
998542846 5:142999178-142999200 AGTAAGGCAGTGACTGATTAGGG + Intronic
998562946 5:143188371-143188393 AGCAAGAAATTGAATGACTATGG - Intronic
999273185 5:150310039-150310061 AGCAAGAGATTGACTGAATAGGG - Intronic
999762030 5:154709839-154709861 TGCAAGCAACTGATTTATTATGG + Intergenic
1001894441 5:175366268-175366290 TGCAAGCAACTGATTTATTATGG - Intergenic
1003314591 6:5001063-5001085 AGCAAAAAACTGACTCAGAACGG + Intronic
1004598675 6:17126568-17126590 AGCAAGAAAATGATTTTTTAGGG - Intronic
1006284654 6:33083303-33083325 AGGAAAGAACTGAGTGATTAGGG + Intronic
1006633269 6:35444500-35444522 AGGATGAAACTGACTGCTAATGG - Intergenic
1008023458 6:46606589-46606611 ATAAAGAAACTGAGTGATTTGGG + Intronic
1008278018 6:49563397-49563419 TGCAAGCAACTGATTTATTATGG - Intergenic
1008287923 6:49676842-49676864 AGCAAGAAACTGACTCATGGAGG - Intergenic
1008512191 6:52286762-52286784 AGCAACAACCTGATTGATTTTGG - Intergenic
1010355636 6:74929420-74929442 ATCATGACACTGACTTATTAAGG - Intergenic
1011412046 6:87075971-87075993 AGCATTAAAATGTCTGATTATGG + Intergenic
1012614383 6:101258648-101258670 TGCAAGAAATTGATTTATTATGG - Intergenic
1014430004 6:121358169-121358191 AGCAAGGTACTGACTTAATAGGG - Intergenic
1016348432 6:143141216-143141238 AGAAAGAAAGAGACTGATAATGG - Intronic
1016805580 6:148208819-148208841 ATATAGAAACTGACTGAATACGG + Intergenic
1020038619 7:4983438-4983460 AGCAATGAACATACTGATTAAGG - Intergenic
1020156682 7:5731029-5731051 AGCAATGAACATACTGATTAAGG + Intronic
1020891048 7:13878046-13878068 AGCAAGAAAATGACTTAATCAGG - Intergenic
1021292137 7:18859057-18859079 AGCAAATAACTGACTGACTTGGG - Intronic
1021446180 7:20736115-20736137 AGAAAGAAACTTACTGAGTAAGG + Intronic
1021790759 7:24203268-24203290 AAGAAGAAACTGACTGATGTGGG - Intergenic
1024106217 7:46089145-46089167 AGCAATAAACTGTCTTATTGAGG + Intergenic
1031414393 7:121478375-121478397 AGCATGAGACTGTCTGGTTATGG - Intergenic
1031750050 7:125560658-125560680 AGCAAGAGAGTGACTCATGAGGG - Intergenic
1032251913 7:130264955-130264977 AGCAGGTAACTGATTGATGAGGG - Intergenic
1032950392 7:136902554-136902576 AGAAAGAAAGTGGCTGCTTATGG - Intronic
1034825475 7:154258319-154258341 AGCCAGAAACTGAATTGTTATGG - Intronic
1036383830 8:8260633-8260655 AAAAAGAAACAGGCTGATTACGG + Intergenic
1039393890 8:37206405-37206427 AGCAAGAAAGTGACTCTTGATGG - Intergenic
1039681812 8:39747194-39747216 GGCAAGAAACAGGCTGATAAAGG - Intronic
1041804379 8:61834163-61834185 AGCAAGAGAGTGAGTGATTCTGG - Intergenic
1044890549 8:96830760-96830782 AGCAAGATTCTTACAGATTAAGG + Intronic
1045753174 8:105510508-105510530 TGAAATAAAGTGACTGATTATGG + Intronic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1047608227 8:126495818-126495840 AGGAAGAAACTGAATGAGTTTGG + Intergenic
1047665115 8:127083254-127083276 AGCAAGAGACTGTCTGACAAAGG + Intergenic
1051377054 9:16412758-16412780 AGAGAGAGACTGACTGATTGTGG + Exonic
1052073373 9:24110557-24110579 AGCAAGAAACTGAGAGACTTAGG - Intergenic
1054831440 9:69629818-69629840 AGCAAGCAAACAACTGATTAAGG + Intronic
1055740060 9:79378236-79378258 AGCAAGAAAATGAGTGTGTAGGG - Intergenic
1055898092 9:81202548-81202570 AGCAAGATACATACTGATTCAGG + Intergenic
1055920665 9:81457314-81457336 AGCAAGATGCTGACTGCTTTGGG + Intergenic
1057369224 9:94454718-94454740 ACAAAAAAAATGACTGATTATGG + Intronic
1059557719 9:115298178-115298200 AGCAAGAAATTGACAAATTTGGG + Intronic
1186247330 X:7628319-7628341 AGCAACATACTGTCTGCTTATGG + Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1188464184 X:30460275-30460297 AGGAAGAACCTGAATGTTTATGG - Intergenic
1190501492 X:51083056-51083078 ATCAAGAAAATGTCTGATTTTGG + Intergenic
1191214622 X:57921784-57921806 AGCAGGACACTGAAGGATTATGG + Intergenic
1191912359 X:66164368-66164390 ACCAAGATACTGACTGAACATGG + Intronic
1191947312 X:66549539-66549561 AGCAAAAAACCTACAGATTAGGG + Intergenic
1192382013 X:70626799-70626821 AGTAAGAAAGTGAATGACTACGG - Intronic
1192888308 X:75361226-75361248 AGAAAGAATCTGAATGTTTATGG - Intergenic
1196212389 X:113010540-113010562 AGCAAAAAACAGTCTGATCATGG - Intergenic
1196504267 X:116422733-116422755 AGCAGGAAACTGCCTGCTTGAGG + Intergenic
1198614933 X:138446459-138446481 AGGAAGAAATTGATTTATTAAGG + Intergenic
1200695687 Y:6356689-6356711 GCCAAGAAACTGACAGATTCAGG + Intergenic
1201039590 Y:9818021-9818043 GCCAAGAAACTGACAGATTCAGG - Intergenic
1201333689 Y:12855730-12855752 TGAAAAAAACTTACTGATTATGG - Intronic