ID: 1186778554

View in Genome Browser
Species Human (GRCh38)
Location X:12890700-12890722
Sequence GTCCTACAAAACTGCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186778554_1186778562 21 Left 1186778554 X:12890700-12890722 CCCTCAGTGCAGTTTTGTAGGAC No data
Right 1186778562 X:12890744-12890766 CCCACAAAGCTCTGAACGTGGGG No data
1186778554_1186778558 19 Left 1186778554 X:12890700-12890722 CCCTCAGTGCAGTTTTGTAGGAC No data
Right 1186778558 X:12890742-12890764 TCCCCACAAAGCTCTGAACGTGG No data
1186778554_1186778557 -4 Left 1186778554 X:12890700-12890722 CCCTCAGTGCAGTTTTGTAGGAC No data
Right 1186778557 X:12890719-12890741 GGACTGGAGCTGTTCACAGACGG No data
1186778554_1186778560 20 Left 1186778554 X:12890700-12890722 CCCTCAGTGCAGTTTTGTAGGAC No data
Right 1186778560 X:12890743-12890765 CCCCACAAAGCTCTGAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186778554 Original CRISPR GTCCTACAAAACTGCACTGA GGG (reversed) Intergenic
No off target data available for this crispr