ID: 1186780998

View in Genome Browser
Species Human (GRCh38)
Location X:12911828-12911850
Sequence CTTTCGGCACAGAAGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186780990_1186780998 17 Left 1186780990 X:12911788-12911810 CCATTATACCATCAGCTGTTGAC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780992_1186780998 9 Left 1186780992 X:12911796-12911818 CCATCAGCTGTTGACATCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780985_1186780998 30 Left 1186780985 X:12911775-12911797 CCTGGCCCGAGCCCCATTATACC 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780986_1186780998 25 Left 1186780986 X:12911780-12911802 CCCGAGCCCCATTATACCATCAG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780989_1186780998 18 Left 1186780989 X:12911787-12911809 CCCATTATACCATCAGCTGTTGA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780987_1186780998 24 Left 1186780987 X:12911781-12911803 CCGAGCCCCATTATACCATCAGC 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1186780988_1186780998 19 Left 1186780988 X:12911786-12911808 CCCCATTATACCATCAGCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 305
Right 1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186780998 Original CRISPR CTTTCGGCACAGAAGGCACA GGG Intronic
905880953 1:41463507-41463529 CTGTCTGCAGAGACGGCACAGGG - Intergenic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
915436534 1:155911066-155911088 GTCTCGGCACAGTAGGGACAAGG + Intronic
920051977 1:203169786-203169808 CTTGGGGCACACAAGGGACAGGG + Intronic
921077715 1:211712929-211712951 CTCCCGGGACAGAAGTCACATGG - Intergenic
921422375 1:214963390-214963412 GTCTCGGCACAGAAGTGACAGGG + Intergenic
924205356 1:241706180-241706202 CCTTAGGCACAGCTGGCACAAGG - Intronic
1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG + Intronic
1069984868 10:72276188-72276210 TTCTTGGCACAGATGGCACACGG - Intergenic
1074749594 10:116572048-116572070 TTTCTGGCACACAAGGCACAAGG + Intergenic
1076031737 10:127164883-127164905 CATTTGGCCCAGAAGGCACCAGG + Intronic
1078352811 11:10608499-10608521 ATTTAGGCAGAGAAGCCACATGG + Intronic
1079387518 11:19994026-19994048 CTCTCTGCACCCAAGGCACATGG - Intronic
1080883578 11:36345251-36345273 CCTTTGGAACAGCAGGCACAAGG + Intronic
1083708846 11:64535005-64535027 CTTTGGGGACAGCAGGCAGAAGG + Intergenic
1085753409 11:79183638-79183660 GTGTGGGCACAGAAGACACAAGG + Intronic
1087866190 11:103229154-103229176 CTTTCTCAACAGAAGGCTCATGG - Intronic
1096272583 12:50177957-50177979 CTTTGGGCACAGACCACACAAGG - Exonic
1097332900 12:58351691-58351713 TTTTGGTCACAGAATGCACAAGG + Intergenic
1097962801 12:65548943-65548965 CTTTTGTCACTGAAGGCAGAAGG - Intergenic
1098992202 12:77076194-77076216 CTTTCGGTACAGAAGACACCAGG + Intergenic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1102347624 12:112169783-112169805 CTGAGGGCAGAGAAGGCACAGGG - Intronic
1109994620 13:70107701-70107723 CTTTACGCACAGAAGGCAAAAGG + Exonic
1111386788 13:87538352-87538374 CTTTGGGCAAAGGAGACACAGGG - Intergenic
1112119630 13:96395784-96395806 CCTTGGGCATAGAAGGCACTAGG + Intronic
1113717634 13:112524414-112524436 CCTCCGGCACAGCAGGCGCATGG + Intronic
1114634360 14:24179019-24179041 CTTGGGCCTCAGAAGGCACAAGG - Intronic
1121614978 14:95307632-95307654 CTTTCGGCACCCAAGGCCCTTGG + Intronic
1122544280 14:102513550-102513572 CTTGGGGCCAAGAAGGCACAGGG + Intergenic
1123175970 14:106419423-106419445 TTTTCAGTTCAGAAGGCACAGGG + Intergenic
1131892632 15:96989174-96989196 CTTTCAGAACAGAGAGCACAAGG - Intergenic
1135919322 16:26634384-26634406 CTTTGGCCAAAGAAGTCACATGG + Intergenic
1140137924 16:72224374-72224396 CTTGGGGCACAGAAGTCACGTGG - Intergenic
1142428195 16:90011774-90011796 CTCTCCGCCCAGAGGGCACAGGG + Intronic
1143591191 17:7886478-7886500 CGTTTGCCACAGAAGCCACACGG - Intronic
1144518362 17:15936710-15936732 CTTTGGGCACCGGAGGCAGAAGG + Intergenic
1147548739 17:41422935-41422957 CTTCCGTCACAGGAGGCACAGGG + Intronic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1152092240 17:78253349-78253371 CTTCCCCCACAGAAGGCAAATGG - Intergenic
1152499232 17:80697151-80697173 CTTTCTGCAGAGAGGGGACATGG + Intronic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1153675420 18:7452429-7452451 CTTAAGGCACAGAAGACTCAGGG + Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1158856318 18:61545961-61545983 CTTTGGGCACAGATGGGAAAAGG + Intronic
1159349957 18:67259601-67259623 CTTACTGCACAGAAGGCAGCAGG + Intergenic
1160824212 19:1071795-1071817 CTTTCGGCACCGAAGACCCCAGG - Intronic
1161237678 19:3206032-3206054 CTGGCGGCACAGAGGGCTCAGGG - Intronic
1161706547 19:5824890-5824912 CTTTCGGCTCAGCTGTCACAAGG + Intronic
1161786376 19:6328600-6328622 CTTTGGGAAGTGAAGGCACAAGG + Intronic
1162772555 19:12958033-12958055 CTGTGTGCACAGAAGACACATGG - Intergenic
1163746563 19:19052279-19052301 CTTTAGGCACGGCAGGCTCAAGG + Intronic
1166991527 19:46695678-46695700 CAGGCGGGACAGAAGGCACAGGG + Intronic
1167396767 19:49234718-49234740 CTCTCTGCACTGAAGCCACAGGG - Intergenic
927856976 2:26533967-26533989 CTCTTGGCTCAGAAGGCCCAGGG + Intronic
927984405 2:27398030-27398052 ATTTCTGCACAAAAGGCACCTGG - Intronic
932674917 2:73771327-73771349 GATTAGGCACAAAAGGCACAGGG - Intronic
934133280 2:88970211-88970233 CTATCGGCCCAGGGGGCACATGG - Intergenic
936039519 2:109139480-109139502 ATTCAGCCACAGAAGGCACAAGG - Intronic
938988818 2:136606945-136606967 CTTTTGCCACAGAAGGGCCATGG + Intergenic
942734850 2:179097612-179097634 CCCAGGGCACAGAAGGCACAAGG + Intergenic
943946735 2:194074634-194074656 CTCTCTGCAAAGAAGGGACATGG - Intergenic
1170470254 20:16661528-16661550 CTTTCGGGACTGAAGGAAGAAGG - Intergenic
1184808513 22:46812332-46812354 CTGTGGGCACAGCAGGCACAAGG + Intronic
950077235 3:10195827-10195849 CTTTTGACACAGATGTCACAAGG + Intronic
952953409 3:38542317-38542339 CTTGTGGCAAAGAAGGCAGAGGG - Intergenic
954216685 3:49128699-49128721 CCTTCGGCACAGAGGCCACCAGG + Exonic
955916822 3:63914884-63914906 CTTGAGGCACAAAAGGGACATGG + Intronic
968920117 4:3518118-3518140 CGTCCTGCACAGCAGGCACACGG - Exonic
969514484 4:7638804-7638826 CTTTCTGCACACCAGTCACAAGG + Intronic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
993661972 5:90648575-90648597 CTTTCAGTCCAAAAGGCACAAGG - Intronic
995429774 5:112061165-112061187 CTTTGGGTACAGAAAGCAAAAGG + Intergenic
996197765 5:120631407-120631429 CTTTCTGGACAGGAGGCTCATGG + Intronic
996282286 5:121745078-121745100 CCTTCCACAAAGAAGGCACAGGG - Intergenic
1001316629 5:170646107-170646129 CTTTCGAAACAGAAAGCACCAGG + Intronic
1002648217 5:180672753-180672775 CTTTGGGAACTCAAGGCACAAGG + Intergenic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1006904590 6:37524645-37524667 GTGTCGGCACAGATGGTACATGG - Intergenic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1010550637 6:77218265-77218287 CTTTTGGCACTCAAGTCACATGG + Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1017701499 6:157077471-157077493 ATTTCGGCACAGGCGGCACTTGG - Intronic
1018050791 6:160006119-160006141 CGTGGGGCACAGCAGGCACACGG - Intronic
1018983660 6:168618805-168618827 CTCTCGACGCAGCAGGCACACGG + Intronic
1024035457 7:45504295-45504317 CTTGCTGCTCAGAAGTCACATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025904715 7:65775089-65775111 CTTTGGGCACTGAGGGCTCAGGG + Intergenic
1032196842 7:129794349-129794371 CTTTCAGCCCAGCAGGCACTGGG + Intergenic
1032369436 7:131331676-131331698 CTTTCGTAACAGAAGTCAAAAGG - Intronic
1032500860 7:132398687-132398709 CTTTCGGCCCAATAGGCTCAGGG + Intronic
1033928200 7:146489767-146489789 CTCTCAGCAGAGAAGGCACGTGG + Intronic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040601615 8:48890394-48890416 CTGGCGGCACAGCAGCCACATGG + Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1049388776 8:142357613-142357635 GTTCTGGCCCAGAAGGCACACGG + Intronic
1052025342 9:23567827-23567849 CTTTCTGCACTGTAGGCACTGGG + Intergenic
1056983114 9:91335200-91335222 CTTTCCACACAGAAAGCACCGGG - Intronic
1061849062 9:133403876-133403898 CTCATGGCACAGCAGGCACAAGG + Intronic
1185559554 X:1049161-1049183 GATTTGGTACAGAAGGCACAAGG - Intergenic
1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG + Intronic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1196062979 X:111431171-111431193 CTGTTGGCACAGCAGGCACTGGG + Intergenic
1200576315 Y:4892894-4892916 CAATCATCACAGAAGGCACATGG + Intergenic