ID: 1186783221

View in Genome Browser
Species Human (GRCh38)
Location X:12934244-12934266
Sequence GGGCTTGTTAAAACACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186783219_1186783221 -8 Left 1186783219 X:12934229-12934251 CCTATATCACCTAAAGGGCTTGT No data
Right 1186783221 X:12934244-12934266 GGGCTTGTTAAAACACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186783221 Original CRISPR GGGCTTGTTAAAACACAGTC TGG Intergenic