ID: 1186786327

View in Genome Browser
Species Human (GRCh38)
Location X:12959434-12959456
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786327_1186786338 22 Left 1186786327 X:12959434-12959456 CCCTTAAGTGCTCAGGCCACTTT No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786327_1186786333 -5 Left 1186786327 X:12959434-12959456 CCCTTAAGTGCTCAGGCCACTTT No data
Right 1186786333 X:12959452-12959474 ACTTTCCCCAGTGGGATAGGAGG No data
1186786327_1186786337 21 Left 1186786327 X:12959434-12959456 CCCTTAAGTGCTCAGGCCACTTT No data
Right 1186786337 X:12959478-12959500 ATAGTCACCTCAACTAACAGAGG No data
1186786327_1186786331 -8 Left 1186786327 X:12959434-12959456 CCCTTAAGTGCTCAGGCCACTTT No data
Right 1186786331 X:12959449-12959471 GCCACTTTCCCCAGTGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786327 Original CRISPR AAAGTGGCCTGAGCACTTAA GGG (reversed) Intergenic