ID: 1186786332

View in Genome Browser
Species Human (GRCh38)
Location X:12959450-12959472
Sequence TCCTATCCCACTGGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786332_1186786337 5 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786337 X:12959478-12959500 ATAGTCACCTCAACTAACAGAGG No data
1186786332_1186786341 29 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786332_1186786340 28 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786332_1186786338 6 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786332 Original CRISPR TCCTATCCCACTGGGGAAAG TGG (reversed) Intergenic