ID: 1186786334

View in Genome Browser
Species Human (GRCh38)
Location X:12959457-12959479
Sequence ATTTTCCTCCTATCCCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786334_1186786340 21 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786334_1186786337 -2 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786337 X:12959478-12959500 ATAGTCACCTCAACTAACAGAGG No data
1186786334_1186786341 22 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786334_1186786338 -1 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786334 Original CRISPR ATTTTCCTCCTATCCCACTG GGG (reversed) Intergenic