ID: 1186786335

View in Genome Browser
Species Human (GRCh38)
Location X:12959458-12959480
Sequence TATTTTCCTCCTATCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786335_1186786340 20 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786335_1186786338 -2 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1186786335_1186786337 -3 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786337 X:12959478-12959500 ATAGTCACCTCAACTAACAGAGG No data
1186786335_1186786341 21 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786335 Original CRISPR TATTTTCCTCCTATCCCACT GGG (reversed) Intergenic