ID: 1186786338

View in Genome Browser
Species Human (GRCh38)
Location X:12959479-12959501
Sequence TAGTCACCTCAACTAACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786328_1186786338 21 Left 1186786328 X:12959435-12959457 CCTTAAGTGCTCAGGCCACTTTC No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786335_1186786338 -2 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786336_1186786338 -3 Left 1186786336 X:12959459-12959481 CCAGTGGGATAGGAGGAAAATAG No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786326_1186786338 23 Left 1186786326 X:12959433-12959455 CCCCTTAAGTGCTCAGGCCACTT No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786332_1186786338 6 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786334_1186786338 -1 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data
1186786327_1186786338 22 Left 1186786327 X:12959434-12959456 CCCTTAAGTGCTCAGGCCACTTT No data
Right 1186786338 X:12959479-12959501 TAGTCACCTCAACTAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786338 Original CRISPR TAGTCACCTCAACTAACAGA GGG Intergenic