ID: 1186786339

View in Genome Browser
Species Human (GRCh38)
Location X:12959485-12959507
Sequence AGATTACCCTCTGTTAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786339_1186786341 -6 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786339_1186786340 -7 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786339_1186786343 13 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786343 X:12959521-12959543 TGGGCTAGTTGAAGACCCTTTGG No data
1186786339_1186786344 14 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786344 X:12959522-12959544 GGGCTAGTTGAAGACCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786339 Original CRISPR AGATTACCCTCTGTTAGTTG AGG (reversed) Intergenic