ID: 1186786340

View in Genome Browser
Species Human (GRCh38)
Location X:12959501-12959523
Sequence GTAATCTATCAAACACCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786332_1186786340 28 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786339_1186786340 -7 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786334_1186786340 21 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786335_1186786340 20 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data
1186786336_1186786340 19 Left 1186786336 X:12959459-12959481 CCAGTGGGATAGGAGGAAAATAG No data
Right 1186786340 X:12959501-12959523 GTAATCTATCAAACACCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786340 Original CRISPR GTAATCTATCAAACACCTAC TGG Intergenic