ID: 1186786341

View in Genome Browser
Species Human (GRCh38)
Location X:12959502-12959524
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786339_1186786341 -6 Left 1186786339 X:12959485-12959507 CCTCAACTAACAGAGGGTAATCT No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786335_1186786341 21 Left 1186786335 X:12959458-12959480 CCCAGTGGGATAGGAGGAAAATA No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786332_1186786341 29 Left 1186786332 X:12959450-12959472 CCACTTTCCCCAGTGGGATAGGA No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786336_1186786341 20 Left 1186786336 X:12959459-12959481 CCAGTGGGATAGGAGGAAAATAG No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data
1186786334_1186786341 22 Left 1186786334 X:12959457-12959479 CCCCAGTGGGATAGGAGGAAAAT No data
Right 1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786341 Original CRISPR TAATCTATCAAACACCTACT GGG Intergenic
No off target data available for this crispr