ID: 1186786635

View in Genome Browser
Species Human (GRCh38)
Location X:12962158-12962180
Sequence CCAAAGTTCTTAAAATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186786631_1186786635 2 Left 1186786631 X:12962133-12962155 CCTAACTCATGCAAAAAAAGGAA No data
Right 1186786635 X:12962158-12962180 CCAAAGTTCTTAAAATGGCCTGG No data
1186786629_1186786635 12 Left 1186786629 X:12962123-12962145 CCAGTGGCTTCCTAACTCATGCA No data
Right 1186786635 X:12962158-12962180 CCAAAGTTCTTAAAATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186786635 Original CRISPR CCAAAGTTCTTAAAATGGCC TGG Intergenic
No off target data available for this crispr