ID: 1186787637

View in Genome Browser
Species Human (GRCh38)
Location X:12968462-12968484
Sequence GGGGTTAAAGAGGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186787634_1186787637 -10 Left 1186787634 X:12968449-12968471 CCAGTGAAAGGAAGGGGTTAAAG No data
Right 1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG No data
1186787628_1186787637 16 Left 1186787628 X:12968423-12968445 CCTGTGTACACACTCAGACTGAT No data
Right 1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG No data
1186787633_1186787637 -7 Left 1186787633 X:12968446-12968468 CCACCAGTGAAAGGAAGGGGTTA No data
Right 1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186787637 Original CRISPR GGGGTTAAAGAGGAGGAGCA TGG Intergenic
No off target data available for this crispr