ID: 1186789696

View in Genome Browser
Species Human (GRCh38)
Location X:12984906-12984928
Sequence GCCTGAAGTGTGGTAGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186789696_1186789706 25 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789696_1186789699 -2 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789696_1186789705 13 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186789696 Original CRISPR GCCTGAAGTGTGGTAGCGCT GGG (reversed) Intergenic