ID: 1186789699

View in Genome Browser
Species Human (GRCh38)
Location X:12984927-12984949
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186789694_1186789699 -1 Left 1186789694 X:12984905-12984927 CCCCAGCGCTACCACACTTCAGG No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789693_1186789699 2 Left 1186789693 X:12984902-12984924 CCACCCCAGCGCTACCACACTTC No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789689_1186789699 20 Left 1186789689 X:12984884-12984906 CCATTCTAACCTCTATCCCCACC No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789696_1186789699 -2 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789691_1186789699 4 Left 1186789691 X:12984900-12984922 CCCCACCCCAGCGCTACCACACT No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789697_1186789699 -3 Left 1186789697 X:12984907-12984929 CCAGCGCTACCACACTTCAGGCC No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789690_1186789699 11 Left 1186789690 X:12984893-12984915 CCTCTATCCCCACCCCAGCGCTA No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data
1186789692_1186789699 3 Left 1186789692 X:12984901-12984923 CCCACCCCAGCGCTACCACACTT No data
Right 1186789699 X:12984927-12984949 GCCACACCCTACCCAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186789699 Original CRISPR GCCACACCCTACCCAGAGTG TGG Intergenic
No off target data available for this crispr