ID: 1186789705

View in Genome Browser
Species Human (GRCh38)
Location X:12984942-12984964
Sequence GAGTGTGGTTTTCAAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186789691_1186789705 19 Left 1186789691 X:12984900-12984922 CCCCACCCCAGCGCTACCACACT No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789694_1186789705 14 Left 1186789694 X:12984905-12984927 CCCCAGCGCTACCACACTTCAGG No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789700_1186789705 -9 Left 1186789700 X:12984928-12984950 CCACACCCTACCCAGAGTGTGGT No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789690_1186789705 26 Left 1186789690 X:12984893-12984915 CCTCTATCCCCACCCCAGCGCTA No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789697_1186789705 12 Left 1186789697 X:12984907-12984929 CCAGCGCTACCACACTTCAGGCC No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789696_1186789705 13 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789698_1186789705 3 Left 1186789698 X:12984916-12984938 CCACACTTCAGGCCACACCCTAC No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789693_1186789705 17 Left 1186789693 X:12984902-12984924 CCACCCCAGCGCTACCACACTTC No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data
1186789692_1186789705 18 Left 1186789692 X:12984901-12984923 CCCACCCCAGCGCTACCACACTT No data
Right 1186789705 X:12984942-12984964 GAGTGTGGTTTTCAAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186789705 Original CRISPR GAGTGTGGTTTTCAAACCAC AGG Intergenic