ID: 1186789706

View in Genome Browser
Species Human (GRCh38)
Location X:12984954-12984976
Sequence CAAACCACAGGCTGTGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186789697_1186789706 24 Left 1186789697 X:12984907-12984929 CCAGCGCTACCACACTTCAGGCC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789693_1186789706 29 Left 1186789693 X:12984902-12984924 CCACCCCAGCGCTACCACACTTC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789698_1186789706 15 Left 1186789698 X:12984916-12984938 CCACACTTCAGGCCACACCCTAC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789700_1186789706 3 Left 1186789700 X:12984928-12984950 CCACACCCTACCCAGAGTGTGGT No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789692_1186789706 30 Left 1186789692 X:12984901-12984923 CCCACCCCAGCGCTACCACACTT No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789696_1186789706 25 Left 1186789696 X:12984906-12984928 CCCAGCGCTACCACACTTCAGGC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789703_1186789706 -7 Left 1186789703 X:12984938-12984960 CCCAGAGTGTGGTTTTCAAACCA No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789704_1186789706 -8 Left 1186789704 X:12984939-12984961 CCAGAGTGTGGTTTTCAAACCAC No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789694_1186789706 26 Left 1186789694 X:12984905-12984927 CCCCAGCGCTACCACACTTCAGG No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789702_1186789706 -3 Left 1186789702 X:12984934-12984956 CCTACCCAGAGTGTGGTTTTCAA No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data
1186789701_1186789706 -2 Left 1186789701 X:12984933-12984955 CCCTACCCAGAGTGTGGTTTTCA No data
Right 1186789706 X:12984954-12984976 CAAACCACAGGCTGTGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186789706 Original CRISPR CAAACCACAGGCTGTGTCGT AGG Intergenic