ID: 1186791028

View in Genome Browser
Species Human (GRCh38)
Location X:12998900-12998922
Sequence AAATTTTTTTAGAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186791023_1186791028 16 Left 1186791023 X:12998861-12998883 CCTAAGTGACATATCCAGATGTG No data
Right 1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG No data
1186791025_1186791028 2 Left 1186791025 X:12998875-12998897 CCAGATGTGGCTCAATTTCTCAT No data
Right 1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186791028 Original CRISPR AAATTTTTTTAGAGGGCAGT AGG Intergenic
No off target data available for this crispr