ID: 1186792013

View in Genome Browser
Species Human (GRCh38)
Location X:13008796-13008818
Sequence TTTTCCCTCCAGAAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186792013_1186792017 -2 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792017 X:13008817-13008839 AACCAGTTCCAGTGGGCCTAGGG No data
1186792013_1186792014 -10 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792014 X:13008809-13008831 GGAGGGAAAACCAGTTCCAGTGG No data
1186792013_1186792016 -3 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792016 X:13008816-13008838 AAACCAGTTCCAGTGGGCCTAGG No data
1186792013_1186792015 -9 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792015 X:13008810-13008832 GAGGGAAAACCAGTTCCAGTGGG No data
1186792013_1186792022 16 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792022 X:13008835-13008857 TAGGGTTCCACAGCTATGTAGGG No data
1186792013_1186792021 15 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186792013 Original CRISPR TTTTCCCTCCAGAAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr