ID: 1186792018

View in Genome Browser
Species Human (GRCh38)
Location X:13008819-13008841
Sequence AACCCTAGGCCCACTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186792018_1186792022 -7 Left 1186792018 X:13008819-13008841 CCAGTTCCAGTGGGCCTAGGGTT No data
Right 1186792022 X:13008835-13008857 TAGGGTTCCACAGCTATGTAGGG No data
1186792018_1186792024 26 Left 1186792018 X:13008819-13008841 CCAGTTCCAGTGGGCCTAGGGTT No data
Right 1186792024 X:13008868-13008890 ACTGAAGACTTTAGACCATTTGG No data
1186792018_1186792021 -8 Left 1186792018 X:13008819-13008841 CCAGTTCCAGTGGGCCTAGGGTT No data
Right 1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186792018 Original CRISPR AACCCTAGGCCCACTGGAAC TGG (reversed) Intergenic
No off target data available for this crispr