ID: 1186792021

View in Genome Browser
Species Human (GRCh38)
Location X:13008834-13008856
Sequence CTAGGGTTCCACAGCTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186792018_1186792021 -8 Left 1186792018 X:13008819-13008841 CCAGTTCCAGTGGGCCTAGGGTT No data
Right 1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG No data
1186792013_1186792021 15 Left 1186792013 X:13008796-13008818 CCATTACTCTTCTGGAGGGAAAA No data
Right 1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG No data
1186792012_1186792021 16 Left 1186792012 X:13008795-13008817 CCCATTACTCTTCTGGAGGGAAA No data
Right 1186792021 X:13008834-13008856 CTAGGGTTCCACAGCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186792021 Original CRISPR CTAGGGTTCCACAGCTATGT AGG Intergenic
No off target data available for this crispr