ID: 1186793935

View in Genome Browser
Species Human (GRCh38)
Location X:13025589-13025611
Sequence TCCTATGCATGTACATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186793932_1186793935 15 Left 1186793932 X:13025551-13025573 CCAGTTGGTGTTTACACATGAAA No data
Right 1186793935 X:13025589-13025611 TCCTATGCATGTACATCAGAGGG No data
1186793931_1186793935 27 Left 1186793931 X:13025539-13025561 CCATGAGCACAGCCAGTTGGTGT No data
Right 1186793935 X:13025589-13025611 TCCTATGCATGTACATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186793935 Original CRISPR TCCTATGCATGTACATCAGA GGG Intergenic
No off target data available for this crispr